ID: 1173583866

View in Genome Browser
Species Human (GRCh38)
Location 20:44166951-44166973
Sequence CCAAGATGAGGCAGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 0, 2: 3, 3: 83, 4: 828}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583866_1173583876 14 Left 1173583866 20:44166951-44166973 CCACCTCCCCTGCCTCATCTTGG 0: 1
1: 0
2: 3
3: 83
4: 828
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583866_1173583875 13 Left 1173583866 20:44166951-44166973 CCACCTCCCCTGCCTCATCTTGG 0: 1
1: 0
2: 3
3: 83
4: 828
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583866_1173583874 12 Left 1173583866 20:44166951-44166973 CCACCTCCCCTGCCTCATCTTGG 0: 1
1: 0
2: 3
3: 83
4: 828
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583866 Original CRISPR CCAAGATGAGGCAGGGGAGG TGG (reversed) Intronic
900003783 1:30570-30592 AGAAGAGGAGGCAGGGAAGGCGG - Intergenic
900023503 1:201084-201106 AGAAGAGGAGGCAGGGAAGGCGG - Intergenic
900329686 1:2127818-2127840 CCAGGCTGAGTCAGGTGAGGTGG + Intronic
900401624 1:2475172-2475194 CCAAGGTCAGGCGTGGGAGGTGG - Intronic
900601361 1:3504106-3504128 CCCAGGGGAGGCAGAGGAGGGGG + Intronic
900601374 1:3504134-3504156 CCCAGGGGAGGCAGAGGAGGGGG + Intronic
900636245 1:3667179-3667201 CCAAGAGAAGACAGGGGAGTAGG + Intronic
900694771 1:4002851-4002873 GGAAGAGGAGGCAGGAGAGGAGG + Intergenic
901034549 1:6328527-6328549 CCAAAATTAGCCAGGGGTGGTGG + Intronic
901122197 1:6905119-6905141 CCAAGCTGGGGCAGTGGAGATGG - Intronic
901154098 1:7123881-7123903 CCAAGGGCAGCCAGGGGAGGTGG + Intronic
901223225 1:7595973-7595995 CCAAGAGGAGGCAGAGGCTGAGG - Intronic
901262711 1:7885637-7885659 GCAAGGTGAAGCAGGTGAGGCGG + Intergenic
901337492 1:8463718-8463740 CCAAGAAGAGGCAGGGAAGTGGG + Intronic
901629714 1:10642173-10642195 GAGAGAAGAGGCAGGGGAGGGGG + Intronic
901659232 1:10788379-10788401 CCAGGATGAGGCAGGGGGGCAGG - Intronic
901686251 1:10945256-10945278 TCCAGATGACGCAGGGAAGGTGG - Intergenic
901975882 1:12943460-12943482 CAATAATGAGGCAGGGGTGGAGG - Intronic
902009290 1:13258305-13258327 CAATAATGAGGCAGGGGTGGAGG + Intronic
902829642 1:19003756-19003778 CCAAGATGAGGTAGAGGAGTGGG - Intergenic
902911958 1:19605202-19605224 AAAAGATGAGGCAGGAAAGGTGG + Intronic
902990459 1:20184047-20184069 CCAGGGGGAGGCAGGAGAGGAGG - Intergenic
903327368 1:22577085-22577107 GCAAGATGGGGGAGGGGAGAGGG + Intronic
903891976 1:26575738-26575760 CCAAGATGAGGCTGGAAAGGAGG + Intergenic
903974679 1:27141734-27141756 GCAAGATGGGGGAGGGGAGCAGG - Intronic
904045095 1:27603947-27603969 GCAGGAGGAGGGAGGGGAGGAGG - Intronic
904288584 1:29469551-29469573 CCAGGATGAGTCAGGGCAGAGGG - Intergenic
904325403 1:29724628-29724650 CCAAGAAGAGGCTGAGGGGGAGG - Intergenic
904345336 1:29864595-29864617 CCAAGAAGAAATAGGGGAGGAGG - Intergenic
904444878 1:30562601-30562623 TCAAAATGAGGCAGGAGAAGAGG + Intergenic
904647978 1:31982508-31982530 CAAAAATTAGGCAGGGGTGGTGG - Intergenic
904768709 1:32869596-32869618 CCAAGATGCAGGTGGGGAGGTGG + Intronic
904983448 1:34525647-34525669 CCCAGGTGACCCAGGGGAGGAGG + Intergenic
905366008 1:37451996-37452018 CCAAGATGGGGCCTGGGAGCTGG + Intergenic
905366584 1:37454925-37454947 GCATGATGAGGCAGCTGAGGTGG - Intergenic
905393517 1:37652980-37653002 CCAAGGAGAGGCAGGGGCAGGGG - Intergenic
905803149 1:40858714-40858736 CCAAGATGCGGGAGGTGTGGTGG + Intergenic
905928198 1:41767050-41767072 CCCAGATGGGGCAGAGGAAGTGG - Intronic
906058620 1:42934378-42934400 CCAAGCTGAGGCTGGGGAGTGGG + Intronic
906493401 1:46285747-46285769 AGAAGAAGAGGCAGAGGAGGTGG + Exonic
906608373 1:47186417-47186439 CTGAGATGAGGCTGGTGAGGTGG - Intronic
906645317 1:47470439-47470461 ACAATAGGTGGCAGGGGAGGTGG + Intergenic
907001346 1:50861544-50861566 CCAAAATGTGGCAGGGTAGGAGG + Intronic
907049546 1:51320798-51320820 GAAAGATGAGGGAAGGGAGGTGG + Intronic
907139024 1:52168187-52168209 CGAAGAGGAGGAAGAGGAGGAGG - Intronic
907398738 1:54210967-54210989 CAAAGATGAGGCTGGGGATGGGG - Intronic
907418902 1:54333278-54333300 CCAGGAATAGGCAGAGGAGGCGG - Intronic
907962578 1:59297044-59297066 GGAGGAGGAGGCAGGGGAGGAGG - Exonic
907962584 1:59297059-59297081 CCAGGAGGAGGAAGGGGAGGAGG - Exonic
908211261 1:61902779-61902801 ACAAAATAAAGCAGGGGAGGAGG + Intronic
908454143 1:64285477-64285499 CAAAGATTAGCCAGGGGTGGTGG - Intergenic
908963215 1:69727095-69727117 CCAAAATGAGGCAAGGCAGCTGG + Intronic
909779064 1:79520074-79520096 GAAAGAGGAGGAAGGGGAGGAGG + Intergenic
909779086 1:79520199-79520221 GAAAGAGGAGGAAGGGGAGGAGG + Intergenic
910521223 1:88124377-88124399 CCCAGAGAAGGCAAGGGAGGAGG - Intergenic
910633059 1:89376759-89376781 CCAGGTTGAGACAGCGGAGGTGG + Intronic
910763559 1:90758662-90758684 CCACCTTGAGGCAAGGGAGGAGG + Intergenic
912077434 1:105892822-105892844 CCAAGATGAAACGAGGGAGGTGG - Intergenic
912189621 1:107322659-107322681 TCAAAATGAGCCAGGGGAGGGGG - Intronic
913575672 1:120171952-120171974 GCAAGATGAGGCTGGGTATGGGG + Intronic
914445912 1:147750600-147750622 GGAAGAAGAGGCAGGTGAGGCGG + Intergenic
914557986 1:148787522-148787544 GCAAGATGAGGCTGGGTATGGGG + Intergenic
914614848 1:149342708-149342730 GCAAGATGAGGCTGGGTATGGGG - Intergenic
915025743 1:152827861-152827883 CCAGGAGGAGACAGGTGAGGAGG - Exonic
915085306 1:153384083-153384105 CCAAAAGGAGGGAGGGCAGGAGG + Intergenic
915263297 1:154695097-154695119 CCAAGAGGTGGGAGGTGAGGAGG + Intergenic
915482595 1:156197253-156197275 CCAGGCTGAGGCTGGGGAGGAGG + Intronic
915527841 1:156487176-156487198 CCAGCATGAGGCGGGGGTGGGGG - Intronic
915570684 1:156743713-156743735 CCAAGAGGAAGAAGAGGAGGAGG - Exonic
915940845 1:160117360-160117382 CTAAGATGGAGCAGGGTAGGGGG - Intronic
916681343 1:167108053-167108075 GCAAGTTGAGGCTGGGGAGGAGG + Intronic
916752647 1:167737428-167737450 CCAAGATCAGGAAGGGGTTGAGG + Intronic
916890726 1:169109761-169109783 CCAAGATGAGGTGGGGGTGGGGG + Intronic
917038288 1:170773562-170773584 CTAAGTGGAGGCAGGGGAAGGGG + Intergenic
917239959 1:172937636-172937658 CCAAGATTAGCCAGGTGTGGTGG - Intergenic
917339571 1:173961198-173961220 CTAGGATGAGGCTGGGGAGGAGG + Exonic
917533175 1:175855214-175855236 CCAAGATGAGGCATTGGAAGGGG + Intergenic
917901988 1:179551929-179551951 CGGGGATGAGGAAGGGGAGGAGG - Intronic
917957676 1:180117165-180117187 CCAAGAGGAGACAGTGCAGGAGG + Intergenic
918195052 1:182213431-182213453 CCAAGAAGAGCCAGGGCAGGTGG - Intergenic
918233250 1:182554784-182554806 CCAAGGAGAGGCAGGGTATGAGG - Intronic
918373203 1:183882038-183882060 GCAGGCTGAGGCAGGGGAGAGGG + Intronic
918477250 1:184938047-184938069 ACAAGATGAGGCTGGAGAGGTGG + Intronic
919616497 1:199814904-199814926 GCAAGATGAGAGAGGGAAGGGGG - Intergenic
919750729 1:201036403-201036425 CCAAGAGGAGGCAGGGAGGAGGG - Intergenic
919821791 1:201477742-201477764 TCAAGATCAGGCAGAGAAGGAGG + Intergenic
919876739 1:201874857-201874879 CCAGGAGGAGGAAGAGGAGGAGG + Exonic
919919890 1:202161502-202161524 CCAAGGTCAGGCAGGGGCAGTGG - Exonic
919942654 1:202298884-202298906 TCTGGATGAGGCAAGGGAGGTGG - Intronic
920088186 1:203433154-203433176 CTGAGATGAGGGAGGCGAGGAGG - Intergenic
920095887 1:203486636-203486658 CCAAGATGAGGAAGGGGAAGGGG - Intronic
920504932 1:206508723-206508745 CCAGGAGGAGGAAGGGGAGGAGG - Intronic
921521847 1:216166123-216166145 CCCAGATTTGGCATGGGAGGAGG + Intronic
922173693 1:223178435-223178457 CCAAGGGGAGGCTGGGGAGGAGG + Intergenic
922207365 1:223460104-223460126 CCAAGATGGGCCAGGGGTGGTGG + Intergenic
922341987 1:224664885-224664907 CCCAGAATAGCCAGGGGAGGTGG - Intronic
922555121 1:226527086-226527108 GAAAGAGGAGGCAGGGGCGGGGG + Intergenic
922563090 1:226583136-226583158 CCAATATAATGCAGGGGAAGTGG - Intronic
922574706 1:226654073-226654095 CCAGGGTGAGGGAGGGGTGGTGG + Intronic
922825058 1:228512067-228512089 CCAAGAAGAGGGAGGGGCAGGGG - Intergenic
923577876 1:235176838-235176860 CAAAGGTCAGGCAGTGGAGGTGG + Intronic
923603523 1:235423586-235423608 CCGAGAGGAGGCTGAGGAGGAGG + Intronic
924279519 1:242422203-242422225 CCATGAGGAGGGAGGGCAGGAGG + Intronic
1063168241 10:3483217-3483239 AAAAGATTAGGCAGGGGTGGTGG + Intergenic
1063366344 10:5493198-5493220 CCAAGAAGAGGGAGAGGTGGGGG + Intergenic
1063996589 10:11625797-11625819 CCAAGATCAGGCAGTGTAGAAGG - Intergenic
1064032754 10:11893679-11893701 CAAAGATGAGACAGGGGGGCAGG + Intergenic
1064302197 10:14132624-14132646 CAAAGAGGAGGAATGGGAGGTGG - Intronic
1065414908 10:25473763-25473785 ATAAGATGAGGCTGGGGAGATGG - Intronic
1065667665 10:28080051-28080073 CCAAGATTGGGAGGGGGAGGGGG + Intronic
1065967920 10:30783992-30784014 CCCAGAAAAGGCAGGGGAAGGGG + Intergenic
1067107073 10:43373629-43373651 GCGAGAGGAGGCAGGGGCGGGGG - Exonic
1067426909 10:46217397-46217419 GAAAGATGAGGGAGGGGAGTGGG + Intergenic
1067567019 10:47346715-47346737 CCAAGTGGAGGCAGAGGAGAAGG + Intergenic
1067705628 10:48604764-48604786 CAAAGATCAGGCAGGCCAGGAGG - Exonic
1067837339 10:49649732-49649754 CCAAGGAGAGGCAGAGGAGCTGG - Intronic
1067848641 10:49741211-49741233 GCAAGACGGGGCAGGGGAAGTGG - Intronic
1068726470 10:60308626-60308648 ACAGGCTGAGGGAGGGGAGGAGG + Intronic
1068835209 10:61545326-61545348 TGAAGAAGAGGAAGGGGAGGAGG + Intergenic
1068948335 10:62752163-62752185 CCAAGGTGAGGAGGAGGAGGAGG + Intergenic
1069079338 10:64071051-64071073 CCAAAAGGAGGGAGAGGAGGAGG - Intergenic
1069328661 10:67263598-67263620 CCAAGATGAAGCAGGGAGGCTGG - Intronic
1069980565 10:72249480-72249502 CAAAAATGAGCCAGGGGTGGTGG - Intergenic
1070088635 10:73261277-73261299 CAAAGATTAGCCAGGGGTGGTGG - Intronic
1070539484 10:77406053-77406075 CCAAGAGGAGGCCCAGGAGGGGG + Intronic
1070668373 10:78361210-78361232 AGAAGGTGAAGCAGGGGAGGAGG - Intergenic
1070889043 10:79928491-79928513 CCAAGACCTGGCAGGGGAAGAGG - Intergenic
1071348355 10:84714992-84715014 CTAATATGAGTTAGGGGAGGGGG - Intergenic
1071522360 10:86339260-86339282 GCAAGGGAAGGCAGGGGAGGAGG + Intronic
1072062568 10:91829525-91829547 CCAAGATGGTGCAGAGGAGTAGG + Intronic
1072307321 10:94120179-94120201 CCAAGTTTAGGCAGGGCAGGAGG - Intronic
1072810477 10:98457700-98457722 CCAAGATGGGGGCGGGGCGGGGG - Intronic
1073067084 10:100767992-100768014 CCAGGATGGGGTGGGGGAGGGGG - Intronic
1073148851 10:101298196-101298218 GCAAGATGAAACAGGGCAGGTGG + Intergenic
1073208222 10:101779806-101779828 CCAAGAAGAGGAAGGGAAAGAGG + Intronic
1073302881 10:102481591-102481613 CCCAGATGAGGCAGGGTACTAGG - Intronic
1073396019 10:103218208-103218230 TCAAAGTGAGGCAGGGGTGGGGG + Intergenic
1074681160 10:115909160-115909182 GCATGAAGAGGAAGGGGAGGGGG - Intronic
1074769102 10:116722007-116722029 CCAAGTTCAGGCAAGGGAGGAGG + Intronic
1074782425 10:116811621-116811643 CAAAGAGGAGACAGGGGATGGGG - Intergenic
1075822313 10:125325348-125325370 CCAGGATGAGCCATGGGAGTGGG + Intergenic
1076001620 10:126917552-126917574 TGAAGCTGAGGCAGGGGAGTGGG - Intronic
1076046223 10:127296272-127296294 ACAAGGGAAGGCAGGGGAGGAGG + Intronic
1076177303 10:128377914-128377936 CCAACATCAGGCAGCGGTGGTGG - Intergenic
1076235581 10:128861524-128861546 CCAAGCAGAGGGAGGAGAGGTGG + Intergenic
1076318986 10:129564532-129564554 GGAAGATGAGGAAGTGGAGGAGG - Intronic
1076367903 10:129934170-129934192 CTAAGAGGAGGCTGGAGAGGGGG - Intronic
1076448257 10:130533859-130533881 GCAAGAGGAGGCTGGGGAGATGG - Intergenic
1076482253 10:130792359-130792381 CCAAGAGGAGCAAGGGAAGGAGG - Intergenic
1076559013 10:131348995-131349017 TCCAGATGAGGCTGGGGAGGAGG + Intergenic
1076559390 10:131351227-131351249 TCATGATGAGGCTGGGGAGGAGG + Intergenic
1076603678 10:131675726-131675748 ACCAGATGAGAAAGGGGAGGTGG + Intergenic
1076991605 11:278832-278854 CCAAAGTGTGGCAGGGGTGGGGG + Intronic
1076999322 11:314805-314827 CCCGGGTGAGGAAGGGGAGGAGG + Intronic
1077000546 11:320095-320117 CCCGGGTGAGGAAGGGGAGGAGG - Intronic
1077024254 11:432272-432294 CCAGGATGAGGCTGGGCTGGGGG + Intronic
1077150753 11:1072143-1072165 GGAAGAGGAGGCTGGGGAGGGGG - Intergenic
1077533161 11:3106725-3106747 ACAAGAGGAGGCTGGGGAGCAGG - Intronic
1078421405 11:11216026-11216048 GCAGCAAGAGGCAGGGGAGGTGG - Intergenic
1078526372 11:12104606-12104628 CCAAGATGAAGCTAGAGAGGTGG - Intronic
1078601346 11:12733917-12733939 CCTAGAGGGGGCGGGGGAGGTGG - Intronic
1079024184 11:16932925-16932947 AAAAGATGAGGTAGGGGAGTCGG + Intronic
1079779700 11:24585196-24585218 AGAAGATGAGGCAGGGAAAGAGG - Intronic
1080023683 11:27591497-27591519 GAGGGATGAGGCAGGGGAGGAGG + Intergenic
1080276101 11:30504893-30504915 CCAGGAGAAGGCAGGGGATGCGG + Intronic
1080663753 11:34317959-34317981 CAAAAAAGAGGTAGGGGAGGGGG - Intronic
1081542436 11:44045617-44045639 CCAGGATGCGGCAGGGAAGCTGG - Intergenic
1081561115 11:44217752-44217774 CAAAGATGGAGGAGGGGAGGAGG - Intronic
1081710427 11:45212464-45212486 CCAAGATGATGAAGATGAGGAGG + Intronic
1081723635 11:45309173-45309195 CAAAGATAAGGCTGGCGAGGTGG - Intergenic
1081926848 11:46837243-46837265 CAAAGATCAGCAAGGGGAGGAGG + Intronic
1082130395 11:48481711-48481733 TCAAGGTGGGGCAGGGCAGGGGG - Intergenic
1083129897 11:60615625-60615647 CCAAGACGAGGGTGGGGTGGCGG - Intergenic
1083421220 11:62554376-62554398 CCAAGGTCAGGCAGGAGGGGTGG - Intronic
1083424346 11:62575447-62575469 TCAGGGTGAGGCAGGGAAGGGGG - Exonic
1083862830 11:65433859-65433881 GCAGGAGGCGGCAGGGGAGGCGG - Intergenic
1084148882 11:67278915-67278937 CCAGGGTGAGGCAGAGGAGCGGG - Intronic
1084169843 11:67395812-67395834 CGAGGAGGAGGCAGGTGAGGGGG + Exonic
1084266461 11:68007899-68007921 CAAGGAGGAGGCAGGGCAGGCGG + Intergenic
1084302458 11:68260418-68260440 CCAAGCTCAGGCTGGGCAGGTGG + Intergenic
1084506806 11:69573458-69573480 CCAAGGTGAGGCAGCAGAAGAGG + Intergenic
1084547123 11:69820044-69820066 AAAAGAGGAGGCAGGGGAGATGG + Intergenic
1084566521 11:69931779-69931801 CCAAGAGGTGGATGGGGAGGGGG - Intergenic
1084685741 11:70694074-70694096 CCATGATGAGGCTGGGGATTTGG + Intronic
1084982145 11:72835366-72835388 CTGAGAAGAGGCAGGAGAGGTGG + Intronic
1085414742 11:76312520-76312542 ACGAGATGAGGCCGGAGAGGTGG + Intergenic
1085456660 11:76669287-76669309 GCAAGAGGAGGCAGGAGAGTCGG + Intronic
1085468083 11:76737781-76737803 CCAGTAGGAGGCAGGGCAGGTGG - Intergenic
1086675628 11:89603414-89603436 CTAAGATGGGGCAGGCGTGGCGG - Intergenic
1087161097 11:94948855-94948877 GCAAGATGAGGCAGGCGATGAGG - Intergenic
1087505276 11:99013019-99013041 TGAAGAGGAGGAAGGGGAGGAGG + Intergenic
1088320381 11:108549437-108549459 CAAAGAAGAGGAGGGGGAGGTGG - Intronic
1088984631 11:114894677-114894699 ACAGGGTGAGGGAGGGGAGGAGG + Intergenic
1089043780 11:115480936-115480958 CCATGATGAGGCTCAGGAGGAGG - Intronic
1089213201 11:116820098-116820120 CCGAGACGAGTCTGGGGAGGAGG - Intergenic
1089302268 11:117505793-117505815 CCCAGGTAAGGCAGGTGAGGCGG - Intronic
1089432796 11:118436994-118437016 CCCGGATGGGGGAGGGGAGGGGG - Intronic
1089875289 11:121715449-121715471 CTATGATGTGGCAGGGGTGGGGG + Intergenic
1090022291 11:123138610-123138632 CCAAATGGTGGCAGGGGAGGGGG - Intronic
1090185200 11:124734445-124734467 GCAAGCTGAGGAAAGGGAGGTGG + Intergenic
1090610115 11:128463496-128463518 CCCAGATGAGGTAAGGAAGGAGG - Exonic
1090940037 11:131379336-131379358 GGAAGAAGAGGCAGGGGAAGAGG + Intronic
1091347097 11:134862855-134862877 CCAAGAGGAGGCTGGGCAGACGG - Intergenic
1091377202 12:32622-32644 AGAAGAGGAGGCAGGGAAGGCGG - Intergenic
1091448546 12:558758-558780 GCAGGGTGGGGCAGGGGAGGAGG - Intronic
1091793206 12:3283243-3283265 CGAGGCTGAGGCAGGGTAGGTGG - Exonic
1092203810 12:6603520-6603542 ACAGGAAGTGGCAGGGGAGGGGG + Intronic
1092286437 12:7131453-7131475 CGGAGATGAGGCGTGGGAGGGGG + Intronic
1092307054 12:7311840-7311862 CAAAAATGAGCCAGGGGTGGTGG - Intronic
1092786004 12:12027653-12027675 CCAAAAAGAGGCAGGAGAGTCGG + Intergenic
1093219422 12:16401099-16401121 CGAAGATGAGGAAAAGGAGGAGG - Intronic
1093416638 12:18928006-18928028 ACAAGAGAAGGCAGGGGAGTTGG - Intergenic
1094057449 12:26281473-26281495 TCAAGCTGAGGCAGGGCTGGAGG + Intronic
1094065689 12:26358769-26358791 CACAGATGGGGGAGGGGAGGGGG - Intronic
1094454008 12:30611966-30611988 CCACGATGAGGAGGAGGAGGAGG + Intergenic
1095752358 12:45727489-45727511 ACAAAATGGGGCCGGGGAGGCGG + Intergenic
1096109990 12:49022934-49022956 CCAGGAGGTGGCAGAGGAGGTGG - Intronic
1096188636 12:49600193-49600215 CCAAGAGGAGCCCTGGGAGGAGG - Exonic
1096356999 12:50949684-50949706 CAAAGATTAGCCAGGTGAGGTGG - Intergenic
1096651658 12:53064918-53064940 GCAAGCTGAGGCATGGGACGGGG + Exonic
1096865401 12:54559803-54559825 ACAAGACGAGGCAGGGAAGTTGG + Intronic
1097094720 12:56537210-56537232 TCAAGATGAGCCAGGCAAGGTGG - Intronic
1097179498 12:57163109-57163131 CCAACAGGAAGCAAGGGAGGGGG + Intronic
1097936446 12:65257398-65257420 CAAACATTAGGCAGGGGTGGTGG - Intergenic
1099189667 12:79549195-79549217 CCCAGCTGAGGCAGGAGAGGAGG + Intergenic
1099263087 12:80408857-80408879 GGAAGAGGAGGAAGGGGAGGAGG - Intronic
1100091559 12:90978169-90978191 CCAGGAAGAGGAAGAGGAGGAGG - Exonic
1100320013 12:93481962-93481984 GAAAGAGGATGCAGGGGAGGTGG - Intronic
1100975447 12:100117607-100117629 CAAGGTGGAGGCAGGGGAGGTGG - Intronic
1101277333 12:103216993-103217015 CAAAAATGAGCCAGGGGTGGTGG - Intergenic
1101733269 12:107443957-107443979 CCTAGATGAGGATGGGGAGCAGG + Intronic
1102532940 12:113560148-113560170 CCAGGATGGGGCTGGGAAGGAGG - Intergenic
1102677623 12:114669052-114669074 ACAGGATGAGGGAAGGGAGGGGG + Intergenic
1102986211 12:117280687-117280709 CCATGTTGGGGCAGGGTAGGGGG + Intronic
1103012188 12:117465976-117465998 TCAAGAGGAGGGAGGGAAGGTGG + Exonic
1103185792 12:118956089-118956111 CCAAGAAGAGACAAGGGAAGGGG - Intergenic
1103216989 12:119209197-119209219 CAAGGTGGAGGCAGGGGAGGTGG - Intronic
1103322584 12:120100637-120100659 CAAGGATGGGGCAGGGGCGGTGG - Intronic
1103324423 12:120110970-120110992 CCAGGAGGAAGCAGAGGAGGCGG - Intronic
1103386575 12:120537199-120537221 AGAGGCTGAGGCAGGGGAGGAGG + Intronic
1103795383 12:123499641-123499663 AGAGGATGAGGCTGGGGAGGAGG - Intronic
1103840776 12:123862361-123862383 ACAAGAAGAGGAAGAGGAGGAGG - Intronic
1104018274 12:124974927-124974949 ACAAGATGAGCCAGGTGTGGTGG - Intronic
1104069483 12:125331570-125331592 CCAAGCTGAGGAAGAGGAGCAGG + Intronic
1104468602 12:129009946-129009968 CAAAGCTGGGGCAGAGGAGGGGG + Intergenic
1104506744 12:129339299-129339321 AGAAGAGGAGGAAGGGGAGGAGG + Intronic
1104775177 12:131386508-131386530 CCAATGAAAGGCAGGGGAGGAGG - Intergenic
1104819069 12:131664522-131664544 GCAGGAAGAGGCAGAGGAGGAGG - Intergenic
1105049545 12:133036663-133036685 GCAAGATGGGGCCGGGGAGATGG - Intergenic
1105401590 13:20100871-20100893 CAAAAATGAGGCAGGCGTGGTGG + Intergenic
1105492672 13:20903167-20903189 CAAGGAGGAGCCAGGGGAGGCGG - Intergenic
1105620811 13:22064120-22064142 ACAAGATGAGGCACGCGATGAGG - Intergenic
1105741150 13:23324399-23324421 CCAAGCTGGTGCAGGGGACGTGG + Exonic
1105805644 13:23950403-23950425 CCTAGATGAGGAGGGGGAGGAGG - Intergenic
1106087008 13:26551692-26551714 CCCAGGTGAGGAAGGGCAGGAGG + Intergenic
1106269352 13:28138695-28138717 CGAGGAGGAGGAAGGGGAGGCGG - Exonic
1106315187 13:28587062-28587084 TCCAAATGGGGCAGGGGAGGTGG + Intergenic
1106419965 13:29577919-29577941 CCAAGCAGAGGGAGTGGAGGAGG - Intronic
1106435540 13:29720448-29720470 CCAAGCTCTGGCAGGGGAAGGGG + Intergenic
1106653796 13:31720796-31720818 GAAAGAAGAGGCAGGGTAGGAGG + Intergenic
1107189408 13:37561267-37561289 CCAAGATGATTCAGAAGAGGTGG - Intergenic
1107461819 13:40611598-40611620 ACAAGAAGAGTCAGGTGAGGAGG - Intronic
1107739866 13:43438320-43438342 ACAAGATGAGGCAGTGGCAGCGG + Intronic
1107886259 13:44876608-44876630 CTGATATGATGCAGGGGAGGGGG - Intergenic
1109211841 13:59544382-59544404 CCAGGATGAGGCTGGAGAGGTGG + Intergenic
1111160992 13:84394483-84394505 AGAAGCTGAGGCAGGTGAGGAGG - Intergenic
1111306112 13:86414860-86414882 GCATGAGGAGGGAGGGGAGGAGG - Intergenic
1111791286 13:92858649-92858671 CCAAAAAGAGGGAGGGCAGGAGG + Intronic
1112643928 13:101307671-101307693 CCAAGAAAAGGGAAGGGAGGAGG + Intronic
1113458412 13:110465121-110465143 CCAGGCTGATGCAGGGGAGCTGG + Intronic
1113641336 13:111959457-111959479 CCAAAATGAGGAGGGGTAGGAGG - Intergenic
1113805951 13:113110104-113110126 CCAAGCGGAGGCGGGGAAGGCGG + Intronic
1113850382 13:113414379-113414401 CCAAGGGGAGGAAGGGGGGGCGG - Intergenic
1114248387 14:20935358-20935380 CCAAAAGGAGGAAGAGGAGGAGG + Intergenic
1114290143 14:21281307-21281329 CCAAGATTGGGCAGGTGTGGTGG - Intergenic
1114484395 14:23054404-23054426 CCAGGATCTGGCTGGGGAGGAGG + Intronic
1114613766 14:24057835-24057857 CCAGGTTGAGGTAGGTGAGGTGG - Exonic
1114615964 14:24068633-24068655 CCAAGATGGGGAAGAGGAGAAGG + Exonic
1116436175 14:44897459-44897481 CATAGATGAGGCAGCGGCGGCGG + Exonic
1116655740 14:47651444-47651466 TCAAGATGAGGCAGCAGAGTGGG + Intronic
1117409512 14:55438562-55438584 CCATGATGGGGAAGGGGAAGGGG - Intronic
1117632303 14:57706791-57706813 ACAAGATGAGGCTGGAGAAGTGG + Intronic
1118507238 14:66426755-66426777 GGAATGTGAGGCAGGGGAGGGGG + Intergenic
1118984031 14:70738330-70738352 CCCAAAGGAGGAAGGGGAGGAGG - Exonic
1120915004 14:89702907-89702929 CCAACTTGAGGCAAGGGAGCTGG + Intergenic
1120968627 14:90189622-90189644 CCAAGCTGGGGTTGGGGAGGAGG + Intergenic
1121308570 14:92922932-92922954 CCAAGAGGTGGCGTGGGAGGCGG - Intergenic
1121337280 14:93085093-93085115 CCAAGATGCCGCAGGGCAGGCGG - Intronic
1121909107 14:97772954-97772976 AGAAGCTGAGGCAGGAGAGGTGG + Intergenic
1122075819 14:99233867-99233889 CTCAACTGAGGCAGGGGAGGGGG + Intronic
1122323207 14:100867753-100867775 CCAAGAAGAGGCAGGGGGGGAGG - Intergenic
1122412597 14:101533599-101533621 CCAGGGTGAGGCTGGGCAGGAGG + Intergenic
1122634280 14:103122991-103123013 CCACAAGGAGGCAGGGGACGGGG - Intergenic
1122651338 14:103228753-103228775 GCAGGAGGATGCAGGGGAGGGGG + Intergenic
1122899168 14:104775058-104775080 CCAAGGTGGGGCCGGGGCGGTGG - Exonic
1124107249 15:26751517-26751539 TCAGGAGGAGGCAGTGGAGGTGG - Intronic
1124819780 15:33033315-33033337 CGAAGATGAGCCAGGCGTGGTGG - Intronic
1124989005 15:34652160-34652182 CAAAGATGAGGAAGTGGAAGTGG + Intergenic
1125929913 15:43593267-43593289 CAAAGGTGAGGTAGGGGACGTGG + Exonic
1125943081 15:43693099-43693121 CAAAGGTGAGGTAGGGGACGTGG + Intronic
1125958126 15:43805196-43805218 CCAAGCTGAGTCAAAGGAGGTGG + Exonic
1126143666 15:45457058-45457080 CCAAGAGGGGGCTCGGGAGGGGG - Intergenic
1127381567 15:58434842-58434864 GCAAGCTGAGGCTGGGGTGGAGG - Intronic
1127673438 15:61217452-61217474 ACTAGGTGAGGCAGAGGAGGAGG + Intronic
1127690897 15:61396292-61396314 CCTTGATGGGGCAGGGCAGGGGG + Intergenic
1128186948 15:65650726-65650748 CGAAGAGGAGGAAGAGGAGGAGG + Exonic
1128294634 15:66507331-66507353 ACTAGATAAGGCAGGGGTGGGGG - Intronic
1128742977 15:70096272-70096294 CGAAGACAAGACAGGGGAGGGGG + Intronic
1129219178 15:74121546-74121568 CCAAGATGAGGCAGGAAGGAGGG + Intronic
1129226709 15:74174471-74174493 CCAGGATGTGGGAGGGCAGGGGG + Intronic
1129265135 15:74389322-74389344 CCAGAGTGAGGCAGGGAAGGAGG - Intergenic
1129320796 15:74773596-74773618 CCAAGGTGGGGCAGGTGAGAAGG - Intergenic
1129468424 15:75737387-75737409 CCAAAATGAGGCAGGGATTGGGG - Intergenic
1129727147 15:77907110-77907132 CCAAAATGAGGCAGGGATTGGGG + Intergenic
1129832319 15:78679081-78679103 CCATCCTGAGGCATGGGAGGTGG + Intronic
1129834413 15:78692938-78692960 GCAAGAGGAGGAAGGGGAGGGGG + Intronic
1129840575 15:78740916-78740938 CCAGGATGTGGCGGGGAAGGAGG - Intergenic
1130050268 15:80478580-80478602 ACAAGATGAGGCTGGAGAAGTGG + Intronic
1130404618 15:83587176-83587198 ACAGAATGAGGCAGGGGAAGGGG - Intronic
1130669218 15:85895736-85895758 CAAAGATCAGGCAGGTGTGGTGG - Intergenic
1130908685 15:88256808-88256830 CCGCGACGAGGGAGGGGAGGAGG - Intergenic
1130938668 15:88490343-88490365 CCAAGATGACCAAGGGCAGGGGG - Intergenic
1131283679 15:91040337-91040359 CCATCCTGAGGCATGGGAGGTGG - Intergenic
1132078588 15:98845378-98845400 CGAGGAGGAGGGAGGGGAGGAGG - Intronic
1132104186 15:99051010-99051032 CAAAGATGTGGCAGGGTATGAGG + Intergenic
1132299485 15:100767306-100767328 CAAGGATGAGGGAAGGGAGGGGG - Intergenic
1132449719 15:101960370-101960392 AGAAGAGGAGGCAGGGAAGGCGG + Intergenic
1132587431 16:711692-711714 CGGAGATGAGGCTGGGGAGGAGG + Intronic
1132594137 16:740594-740616 CCCAGAGGAGGCAGCAGAGGCGG - Intronic
1132617185 16:847496-847518 AAAAGATGAGGCAGAGGAGATGG + Intergenic
1132879008 16:2153041-2153063 CCAAGGTGAGTCAGGGCAGGGGG + Exonic
1133028076 16:2997258-2997280 CCAAAATGAGGGAGGAGAGGTGG + Intergenic
1133044047 16:3076331-3076353 CCAAGCTGAGGCAGGGAGGCAGG - Intronic
1133103718 16:3494025-3494047 CCAAGGGGAGGCTGGGGGGGAGG + Intronic
1133302024 16:4788191-4788213 CCAAGGTCAGGCAGGGAAGATGG + Intronic
1133601991 16:7348787-7348809 CCAAAATTAGCCAGGGGTGGTGG + Intronic
1134036145 16:11032799-11032821 CCAAGGTGAGGCTGGCCAGGCGG + Intronic
1134280440 16:12812313-12812335 CCATGGTGAGGCAGGAGAAGAGG - Intergenic
1134756240 16:16670096-16670118 CCAAGATGACTCCAGGGAGGTGG - Intergenic
1134989830 16:18689068-18689090 CCAAGATGACTCCAGGGAGGTGG + Intergenic
1135206049 16:20484734-20484756 GCAAGGTGAGGAAGGGAAGGGGG + Intronic
1135212863 16:20539050-20539072 GCAAGGTGAGGAAGGGAAGGGGG - Intronic
1135850284 16:25957267-25957289 CAGAGAAGAGGCAGGGGAAGGGG - Intronic
1136531800 16:30875027-30875049 GAAAGATGAGGCCGGGAAGGAGG - Intronic
1136582210 16:31159909-31159931 CCAAGAGGTGGGTGGGGAGGTGG - Intergenic
1137277310 16:46944363-46944385 AGAAGAAGAGGCAGAGGAGGAGG + Intergenic
1137483692 16:48874144-48874166 CCAAAAAGAGGGAGGGAAGGAGG + Intergenic
1137696429 16:50465069-50465091 CCAACCTGAGGCAAGGGAGTGGG - Intergenic
1137869866 16:51939778-51939800 CCAAGATGGGGGAGGGGAGAAGG - Intergenic
1137960412 16:52876740-52876762 CCAAGAAGAGACAGTGGAGGAGG + Intergenic
1138318458 16:56090525-56090547 ACAGGTTGAGGCAGGGGAAGTGG - Intergenic
1138565222 16:57828167-57828189 TCATGATGAGGAAGGAGAGGAGG - Intronic
1139304313 16:65970283-65970305 CAGAGATGGGGCAGGGGTGGGGG - Intergenic
1139378720 16:66516852-66516874 CCAAGATGGGGAGGGGCAGGTGG + Intronic
1139527259 16:67524680-67524702 CCCAGATGAGGCAGGGGCTTTGG - Intronic
1139774799 16:69310381-69310403 CCAAGTTGAGGCTGGGTATGGGG - Intronic
1140044236 16:71430144-71430166 CCAAGCTAAGGCAGAGGAGATGG + Intergenic
1140067822 16:71625883-71625905 GTAAGTTGAGCCAGGGGAGGTGG + Intergenic
1140194394 16:72844865-72844887 CGGAAATGAGGAAGGGGAGGGGG - Intronic
1140218859 16:73029104-73029126 CCATGTTGAGGCAGTGGAGAGGG - Intronic
1140380640 16:74484072-74484094 CAAAGAGGGGGCAGGGGAGAGGG - Intronic
1141625724 16:85260036-85260058 CGGAGATGAGGCAGTGGAGGAGG + Intergenic
1141692970 16:85606902-85606924 CCAGGCCGAGGCAGGGGAAGGGG - Intergenic
1141840728 16:86572601-86572623 CCAAGGCCAGGCAGGGGAAGTGG - Intergenic
1141882959 16:86872058-86872080 CCAAGATGAGTGAGGGAGGGAGG - Intergenic
1141926651 16:87174341-87174363 CCAGGTGGAGGCAGGGGATGGGG - Intronic
1141980194 16:87545323-87545345 GCAGGAAGGGGCAGGGGAGGGGG + Intergenic
1141995580 16:87634689-87634711 CCTATAGGAGGCAGGTGAGGCGG + Intronic
1142800033 17:2338904-2338926 CCAAAATAAGCCAGGGGTGGTGG + Intronic
1142912417 17:3106178-3106200 CCAGGAAGAGTGAGGGGAGGGGG - Intergenic
1142991962 17:3737367-3737389 CGAAAAAGAGGCAGGGGAGGGGG + Intronic
1143016838 17:3895311-3895333 CCAGGAGGAGGCAGAAGAGGGGG + Intergenic
1143035191 17:3991150-3991172 CAAAAATTAGGCAGGTGAGGTGG - Intergenic
1143078547 17:4365648-4365670 CCAGGCGGAGGCAGGCGAGGCGG + Intronic
1143091694 17:4452769-4452791 CCAGGATGAGACAGGAGATGAGG + Intronic
1143178724 17:4971258-4971280 CCAAGATGACGGAGGGCAGCTGG - Intronic
1143184743 17:5003480-5003502 CCAGGAGGAGGCGAGGGAGGAGG - Intronic
1143384802 17:6522630-6522652 CCAGCATGAGGCAGGGGAGGGGG + Intronic
1143476722 17:7207416-7207438 CAAAGCTGGGGCAGGGGACGAGG + Intronic
1143510738 17:7393949-7393971 GAAAGATGGGGCAGGGGAGCAGG + Intronic
1143990359 17:10954459-10954481 TCCAGCTCAGGCAGGGGAGGTGG - Intergenic
1144584405 17:16479349-16479371 CCAAGAAGATGCATGGGAGAAGG + Intronic
1144835105 17:18152694-18152716 AGGAGATGAGGCTGGGGAGGTGG - Intronic
1144966306 17:19078808-19078830 ACAAGAAGAGGCAGAGGAGGAGG - Intergenic
1144981612 17:19173249-19173271 ACAAGAAGAGGCAGAGGAGGAGG + Intergenic
1144986612 17:19204990-19205012 ACAAGAAGAGGCAGAGGAGGAGG - Intergenic
1146028224 17:29341664-29341686 CGAAGAGTAGGGAGGGGAGGTGG + Intergenic
1146042445 17:29469210-29469232 CTGAGATGGGGCGGGGGAGGGGG - Intronic
1146124176 17:30218902-30218924 CCATGATGGTGTAGGGGAGGAGG + Exonic
1146251083 17:31344968-31344990 CAAAAATTAGGCAGGTGAGGTGG + Intronic
1147159747 17:38563065-38563087 CCAGGAAGAGGCCGGGGTGGAGG - Intronic
1147423781 17:40335535-40335557 CAAAAATTAGGCAGGCGAGGTGG + Intronic
1147497112 17:40927148-40927170 CAGAGATGAAGCAGAGGAGGAGG - Intronic
1147511113 17:41069554-41069576 CCAGGTTGAGGCAAAGGAGGGGG + Intergenic
1147872693 17:43598689-43598711 ACAAAAGGAGGCAGGGAAGGGGG - Intergenic
1147944720 17:44074409-44074431 CCAAGCTGAGTTATGGGAGGAGG + Intronic
1148047779 17:44754379-44754401 CAAGCATGAGACAGGGGAGGTGG + Intergenic
1148234816 17:45961737-45961759 ACCAGGTGAGGCAGGTGAGGTGG - Intronic
1149341650 17:55692812-55692834 CTAAGATGAGGAAACGGAGGAGG + Intergenic
1149418285 17:56483251-56483273 ACAAGATGAAGCATGGGAAGGGG - Intronic
1149598621 17:57878817-57878839 CAAAGATTAGCCAGGGGTGGTGG - Intronic
1149598900 17:57880757-57880779 CAAAGATTAGCCAGGGGTGGTGG - Intronic
1149604431 17:57914769-57914791 CCAGGATCAGGCCAGGGAGGAGG + Intronic
1149866649 17:60154837-60154859 CCAAGATGAGGGAGGAGATTAGG - Intronic
1150069720 17:62140368-62140390 CCAGAATGTGGCAGTGGAGGTGG - Intergenic
1150457335 17:65317367-65317389 AGAAGATGAGGAAGGGGAAGGGG + Intergenic
1150699618 17:67435697-67435719 CCAAAATTAGGCAGGTGTGGTGG + Intronic
1151349917 17:73525613-73525635 CTGAGAAGAGGCAGAGGAGGTGG - Intronic
1151388861 17:73772242-73772264 CCAGGGTGTGGGAGGGGAGGGGG - Intergenic
1151597568 17:75087835-75087857 CCAGGATGCGGGAGGGGCGGCGG - Intronic
1151716050 17:75831495-75831517 CCCAGGTGAGGCTGGGGAGAGGG + Intronic
1151796252 17:76347894-76347916 CAAAGATGAGGCAGGTAAAGGGG + Intronic
1151816056 17:76472004-76472026 CCACGAAGAGGCAGGCGAGGAGG + Exonic
1151960876 17:77405041-77405063 ACAGGATGTGGCTGGGGAGGCGG + Intronic
1152098385 17:78286454-78286476 CCCAGGGGAGGCAGGGGTGGGGG - Intergenic
1152266243 17:79296681-79296703 GGAAGAGGAGGAAGGGGAGGAGG - Intronic
1152763605 17:82122757-82122779 CCTGGAGGAGGCAGGGGAAGGGG - Intronic
1153748858 18:8209221-8209243 CCAAGAGATGGCAAGGGAGGAGG + Intronic
1153864193 18:9247937-9247959 CAAAAATTAGGCAGGCGAGGTGG - Intronic
1153915621 18:9741864-9741886 CCTGGATGAGGCAGTGGATGAGG - Intronic
1154275310 18:12954304-12954326 CCAAGGGGTGGGAGGGGAGGTGG - Intronic
1155083205 18:22430621-22430643 CCAGGCTGTGGCAGGAGAGGGGG - Intergenic
1155256582 18:24003094-24003116 CAGAGACGAGGCAGGAGAGGTGG - Intronic
1155446249 18:25915835-25915857 ACAGGGTGAGGCAGGGGATGAGG - Intergenic
1156399080 18:36724660-36724682 CCAAGATGAGGGAGAGGCAGAGG - Intronic
1156462148 18:37327170-37327192 GCAAGAGGAGGCAGGGGAAGCGG - Intronic
1157553410 18:48597001-48597023 CCCACATGATGCAGTGGAGGTGG - Intronic
1157598651 18:48879160-48879182 GCCAGGTGAGGCAGGGGTGGCGG - Intergenic
1157618790 18:49003382-49003404 CTAGGAGGAGGCAGGGGAGGAGG - Intergenic
1157675148 18:49562992-49563014 CCAGGAGGAGGAAAGGGAGGAGG - Intronic
1158027706 18:52921544-52921566 CCAAAATGAGCCAGGTGTGGTGG + Intronic
1158423157 18:57313617-57313639 GGAAGAGGAGGAAGGGGAGGAGG + Intergenic
1158571088 18:58597658-58597680 CTAAGATGAGCCAGTGGGGGTGG - Intronic
1158935902 18:62364324-62364346 GGAAGATGAGGCTGGAGAGGAGG + Intronic
1159067665 18:63588238-63588260 CCATGATAAGGCAGGGGGGTAGG - Intronic
1159800655 18:72895424-72895446 GAAGGATGAAGCAGGGGAGGCGG - Intergenic
1160375177 18:78406097-78406119 GGAAGAGGAGGCAGGGGAGTGGG - Intergenic
1160635536 19:72177-72199 AGAAGAGGAGGCAGGGAAGGCGG - Intergenic
1160948083 19:1652573-1652595 GGAAGATGAGGCAGCGGCGGCGG - Intronic
1161103657 19:2433195-2433217 CCAATACGAGGCAGGGGACAAGG - Intronic
1161103692 19:2433300-2433322 CCAATACGAGGCAGGGGACAAGG - Intronic
1161103795 19:2433615-2433637 CCAATACGAGGCAGGGGACAAGG - Intronic
1161304915 19:3561947-3561969 ACAAGAAAAGGCAGTGGAGGGGG - Intronic
1161765087 19:6203023-6203045 CCAAGATGTAGCAGGAGAGAGGG + Intergenic
1161823330 19:6544960-6544982 CAAAAATGAGCCAGGTGAGGTGG - Intergenic
1161865983 19:6832526-6832548 AGAAGAAGAGGAAGGGGAGGAGG - Intronic
1162055916 19:8063985-8064007 CCAAAATTAGCCAGGGGTGGTGG - Intronic
1162095567 19:8307952-8307974 CCATGCTGGGGGAGGGGAGGAGG - Intronic
1162301842 19:9849018-9849040 CCAGGATGAGGCAGGGCGGGTGG - Intronic
1162318979 19:9959802-9959824 GCAAGGTGAGCCTGGGGAGGTGG + Exonic
1162506814 19:11090484-11090506 CCAATGTGAGGCGGTGGAGGCGG + Intronic
1162816933 19:13201471-13201493 CAAAAATTAGACAGGGGAGGTGG - Intergenic
1162927138 19:13936280-13936302 CGCAGATGGGGCGGGGGAGGGGG + Intronic
1163513527 19:17749453-17749475 CCAGGAGGAGGGAGGGGAAGGGG + Intronic
1163614458 19:18318441-18318463 GCTAGGAGAGGCAGGGGAGGAGG + Intronic
1163685104 19:18708165-18708187 CCTACAGGAGGCAGGGAAGGAGG + Intronic
1164292429 19:23880268-23880290 AGAAGAGGAGGCAGAGGAGGGGG + Intergenic
1164541729 19:29126519-29126541 CCAAGATGAGGAAGTGTCGGGGG + Intergenic
1164566158 19:29327485-29327507 CCAGGGAGAGGCTGGGGAGGCGG - Intergenic
1164590879 19:29506150-29506172 CCAAGGGGAGGCACTGGAGGCGG + Intergenic
1164592626 19:29514562-29514584 GGAAGATGAGGAAGGAGAGGAGG + Intergenic
1164618207 19:29679035-29679057 CTAGGAAGAGGCAGGGGACGAGG - Intergenic
1164881139 19:31733919-31733941 CGACGATGAGGCAGGAGAAGTGG - Intergenic
1165532551 19:36416601-36416623 ACAAGATTAGGCAGGCGTGGTGG + Intronic
1165581124 19:36864678-36864700 CTAAGATGAGGCAAGTGAGACGG + Intronic
1165789505 19:38483146-38483168 CCAGGCTGAGGCAGGAGATGTGG + Intronic
1166144674 19:40825996-40826018 CCCAGATGGGGCAGGGTTGGGGG - Intronic
1166183069 19:41122211-41122233 CCCAGATGGGGCAGGGTTGGGGG + Intronic
1166337426 19:42116826-42116848 CGAGGAGGAGGCAGAGGAGGAGG + Intronic
1166524824 19:43504391-43504413 TAGAGATGAGGGAGGGGAGGCGG - Intronic
1166845001 19:45721925-45721947 GGAGGCTGAGGCAGGGGAGGTGG - Intronic
1166860044 19:45804788-45804810 CGAGGAGGAGGCAGAGGAGGAGG - Exonic
1167095647 19:47373696-47373718 TCAAGGTGAGGCTCGGGAGGAGG + Exonic
1167143807 19:47670597-47670619 CCAAGGTGGTGCTGGGGAGGTGG - Intronic
1167270181 19:48501963-48501985 GGAAGAGGAGCCAGGGGAGGGGG - Intronic
1167646091 19:50705867-50705889 CCAAGGTGGGCCAGGGGTGGTGG + Intronic
1168005085 19:53480223-53480245 TGAAAAAGAGGCAGGGGAGGAGG - Intronic
1168488255 19:56783668-56783690 ACAAGAGGAGGCAGGGAGGGAGG + Intronic
1168512884 19:56987460-56987482 CCGGGATGAGGAAGTGGAGGTGG + Intergenic
925198022 2:1943126-1943148 CAATGATGAGCCAGGGGATGAGG - Exonic
925681798 2:6429990-6430012 CCAAGGTGAGGCAGGGGGATTGG + Intergenic
925847318 2:8045453-8045475 GCAAGATGAGGCTGGGCAGTTGG - Intergenic
925957168 2:8978155-8978177 GCGAGATGAGGCTGGAGAGGTGG - Intronic
925998864 2:9314134-9314156 CAAAAATGAGCCAGGCGAGGTGG - Intronic
927196491 2:20551274-20551296 CCCAGAAGAGAAAGGGGAGGTGG + Intergenic
927318997 2:21720783-21720805 CCTAGATGAGGGAGGGGTGAAGG + Intergenic
927505148 2:23608030-23608052 CCAAGATGAGGAAGGAGGGAGGG + Intronic
927686499 2:25174860-25174882 CCAACATGGGGCAGGGGATAAGG + Intergenic
927704867 2:25290830-25290852 AAAGGAAGAGGCAGGGGAGGAGG - Intronic
928034710 2:27811219-27811241 CCATGGTGATGCAGTGGAGGGGG - Intronic
928037954 2:27843849-27843871 CCTGAATGAGGCAGGGGTGGTGG + Intronic
928251972 2:29689068-29689090 CCTAGGTGAGGAAGGGTAGGAGG - Intronic
928420645 2:31135897-31135919 ATAAGAAGAGGCAGGAGAGGAGG + Intronic
928615964 2:33039936-33039958 CCAAAATGAGGAAGGAGAGTAGG + Intronic
929444322 2:41991100-41991122 CCAGGTTGAGGCAGAGGTGGAGG - Intergenic
929641370 2:43583343-43583365 CCAAGATGTAGCAGTGGAGTTGG - Intronic
929902053 2:46013425-46013447 CCAAGAAGACTCAGGGGAGGGGG + Intronic
930005375 2:46892258-46892280 CCACCTTGAGGCAGGGGAGGTGG + Intergenic
930314022 2:49775604-49775626 CAAAAATGAGCCAGGTGAGGTGG - Intergenic
931402616 2:61944852-61944874 CAAAGATGGGGAAGGGGAAGGGG + Intronic
932278762 2:70471726-70471748 CCAAGTCGAGGCAGGGTAGGCGG + Intronic
932307937 2:70717056-70717078 CCCAGCTGAGGGAGGTGAGGGGG - Intronic
932412603 2:71556099-71556121 CCCAGTTGAGCCAGGAGAGGTGG - Intronic
932457470 2:71858575-71858597 TCAAGAAGAGGCAGGGCAGAAGG - Intergenic
933280226 2:80324722-80324744 GCAAGATGAGGGGAGGGAGGTGG - Intronic
933819320 2:86095243-86095265 CCAAGAAGAGGGAGGAGAAGAGG + Intronic
934941530 2:98506567-98506589 ACCAGATGAGGCAGGTGAGCGGG + Intronic
935171139 2:100612368-100612390 ACTTGATGAGGCAGGGAAGGTGG + Intergenic
935177815 2:100664615-100664637 CTGAGATGTGGCCGGGGAGGGGG + Intergenic
935266908 2:101402669-101402691 CCTAGAGGAGGAAGAGGAGGAGG - Exonic
936565946 2:113582870-113582892 AGAAGAGGAGGCAGGGAAGGCGG + Intergenic
938133951 2:128738601-128738623 ACAAGCTGGGGCTGGGGAGGTGG - Intergenic
938198839 2:129356551-129356573 CCAAGATGAGACTGTGGGGGTGG - Intergenic
938219975 2:129557510-129557532 GCAGGATGAGGCAGGAGGGGAGG + Intergenic
938399623 2:130978872-130978894 CCAATATGAAGCAGAGCAGGAGG - Intronic
939578938 2:143925650-143925672 CCAAGGTGAGGCAGTGGAGATGG - Intergenic
939630631 2:144523435-144523457 CCAAGCTGAGCGGGGGGAGGGGG - Intronic
939998766 2:148946548-148946570 TTAAAGTGAGGCAGGGGAGGAGG + Intronic
941087388 2:161133826-161133848 GAAAGGGGAGGCAGGGGAGGTGG - Intergenic
941784042 2:169479049-169479071 CCAAAATTAGCCAGGGGTGGTGG - Intergenic
941842411 2:170100569-170100591 CCAACATCAGGTAGGGGAGGAGG - Intergenic
942235015 2:173895548-173895570 CCAAGAGGAGGTAAGTGAGGTGG + Intergenic
942253111 2:174064517-174064539 CAAAAATGAGCCAGGTGAGGTGG - Intergenic
942678048 2:178449744-178449766 ACAAAATGAGGAAGGGGAGAAGG - Intronic
943018646 2:182546179-182546201 CCAAGAAGAAGCAGGAGAGAAGG + Intergenic
944190995 2:197003632-197003654 CCAGGTACAGGCAGGGGAGGAGG - Intronic
944649737 2:201817653-201817675 ATACAATGAGGCAGGGGAGGAGG + Intronic
945199150 2:207264176-207264198 GGAAACTGAGGCAGGGGAGGAGG - Intergenic
945574904 2:211518499-211518521 CCAAAATTAGCCAGGGGTGGTGG + Intronic
945921018 2:215754737-215754759 GCAAGATGAGAAAGGGAAGGGGG - Intergenic
946232737 2:218302593-218302615 CCAAGAGGAGACTGGGGAGGTGG + Intronic
946427734 2:219608375-219608397 AGAAGAGGAGGCAGGAGAGGAGG + Exonic
946432518 2:219633242-219633264 GCAGGGTGAGGCAGGTGAGGAGG - Intronic
947769471 2:232659533-232659555 CCAAGGTCAGGCTGGAGAGGAGG - Intronic
948259350 2:236591310-236591332 GCAAAATGAGACAGAGGAGGAGG - Intergenic
948273512 2:236691531-236691553 CCAAGGAGAGGCAGGTGAGAAGG + Intergenic
948352771 2:237354582-237354604 ACAACTCGAGGCAGGGGAGGAGG - Intronic
948418859 2:237839902-237839924 CCCAGAATAGGCTGGGGAGGGGG + Intronic
1169075424 20:2757123-2757145 CCAGGCTGAGACAGGGGAGGGGG + Intronic
1169274412 20:4224001-4224023 CCAGGATGAGGCAGGGCAGAGGG + Intronic
1169440223 20:5627647-5627669 GCAATATGAGGAAGAGGAGGAGG + Intergenic
1169464724 20:5827312-5827334 CCAAGAGGAGGCCTGGCAGGAGG - Intronic
1169632297 20:7647230-7647252 CCACGATGTGGCAAGGAAGGGGG + Intergenic
1169799367 20:9499315-9499337 CCAAGAGGAGGAAGAGGAGGAGG + Intergenic
1170164200 20:13345013-13345035 GCATGAGGAGGCTGGGGAGGTGG - Intergenic
1170190267 20:13638662-13638684 CGGAGATGAGGCTGGGAAGGGGG + Intronic
1170717794 20:18847070-18847092 GCAAGAGGAGGCAGGAGAGCAGG + Intergenic
1171149511 20:22814779-22814801 CCAAGGGCAGGCAGAGGAGGAGG + Intergenic
1171433317 20:25100846-25100868 CCACAATGAGGGAGTGGAGGAGG + Intergenic
1172549080 20:35784896-35784918 CAAAAATGAGGAAGGGGTGGTGG + Intronic
1172809413 20:37636782-37636804 CCAAGCTAAGGCTGGGAAGGTGG + Intergenic
1172880630 20:38197659-38197681 CCAAGATGGGGAGGGGGTGGTGG - Intergenic
1172965091 20:38828936-38828958 CCAAAATATGGCAGGGGAGTAGG - Intronic
1173154983 20:40601100-40601122 TCAGGTTAAGGCAGGGGAGGAGG + Intergenic
1173251754 20:41367228-41367250 CAAAGAGGTGGCGGGGGAGGTGG - Intergenic
1173371692 20:42442075-42442097 CAAAGCTGAGGGATGGGAGGAGG + Intronic
1173465138 20:43274662-43274684 GGAAGATGAAGCAGAGGAGGAGG - Intergenic
1173583866 20:44166951-44166973 CCAAGATGAGGCAGGGGAGGTGG - Intronic
1173592992 20:44239993-44240015 ACAAAATTAGCCAGGGGAGGTGG + Intergenic
1173657422 20:44709972-44709994 CCAAGCCGACGCTGGGGAGGTGG - Intergenic
1173803638 20:45910650-45910672 CCAGGGTGTGGGAGGGGAGGGGG - Intronic
1174419550 20:50390746-50390768 CCAGGATGAGGCTGTGGAAGCGG + Intergenic
1174704485 20:52641493-52641515 CAAGGATGAGGAAGGAGAGGTGG + Intergenic
1175052194 20:56166146-56166168 ACAGGATAAGGAAGGGGAGGAGG + Intergenic
1175145900 20:56895968-56895990 TAAAAATAAGGCAGGGGAGGGGG - Intergenic
1175529165 20:59662385-59662407 CCTAGATGAGGAATGAGAGGTGG + Intronic
1175575199 20:60055817-60055839 CCAAGAAGAGGGAAGTGAGGTGG - Intergenic
1175871588 20:62211829-62211851 CCAGCACGAGGCAGGTGAGGTGG + Intergenic
1175965321 20:62657384-62657406 GCAAGAGTTGGCAGGGGAGGAGG + Intronic
1176057021 20:63154404-63154426 CCAAGAACAGGCAGGGGGGAGGG + Intergenic
1176093644 20:63329782-63329804 CCCAGCAGAGGCAGGCGAGGTGG + Intronic
1176197923 20:63846216-63846238 CCCAGATGGGACAGGGCAGGAGG - Intergenic
1176298418 21:5086625-5086647 ACCAGATGGGGCAGGGGAAGTGG + Intergenic
1178019653 21:28394391-28394413 CCAAGAGGAAGAAGGGGAGAAGG + Intergenic
1178616962 21:34143158-34143180 CCGGGGTGGGGCAGGGGAGGAGG + Intergenic
1178752749 21:35319913-35319935 CCAAGCCGAGGCAGGAGAAGTGG - Intronic
1179286913 21:39985355-39985377 CCCAGATGATGCAGGGATGGAGG - Intergenic
1179553880 21:42160311-42160333 AGAAGAAGAGGCAGAGGAGGCGG - Intergenic
1179590221 21:42403225-42403247 CCAAAATGAGGCGGGGGTGGTGG - Intergenic
1179858608 21:44175324-44175346 ACCAGATGGGGCAGGGGAAGTGG - Intergenic
1179881889 21:44296482-44296504 GCCGGCTGAGGCAGGGGAGGGGG - Intronic
1180783826 22:18536060-18536082 GCAAGATGTGGCAGGCGAGGTGG - Intergenic
1181127395 22:20710109-20710131 GCAAGATGTGGCAGGCGAGGTGG - Intronic
1181236078 22:21448368-21448390 CCAAGATGAGGGGCGAGAGGTGG - Exonic
1181240726 22:21475412-21475434 GCAAGATGTGGCAGGCGAGGTGG - Intergenic
1181421640 22:22803400-22803422 CCTTGAAGAGGAAGGGGAGGGGG - Intronic
1181528677 22:23503798-23503820 CCAAGAGGAAGAAGAGGAGGAGG - Intergenic
1181533830 22:23531677-23531699 CCAGGAGGAGGCAGAGGAAGGGG - Intergenic
1181584693 22:23846707-23846729 AATAGCTGAGGCAGGGGAGGGGG - Intergenic
1181694460 22:24585940-24585962 CCAGGTGGAGGCAGGGGTGGTGG + Exonic
1181694763 22:24587507-24587529 CCAAGGTGGGACAGGGGTGGAGG + Intronic
1181886088 22:26023515-26023537 CCAGGAGGAGGAAGAGGAGGAGG - Intronic
1182224073 22:28782088-28782110 CGAAGATTAGCCAGGGGTGGTGG - Intronic
1182548403 22:31088614-31088636 CCAGGCTGGGGCAGGGGATGGGG + Intronic
1183832377 22:40425162-40425184 GGAAGCAGAGGCAGGGGAGGAGG + Intronic
1184116646 22:42426391-42426413 CCGAGAAGAGCCAGAGGAGGTGG - Intronic
1184245602 22:43234458-43234480 CCCAGATGGGGCAGGGGATGGGG - Intronic
1184368092 22:44065201-44065223 CCCAGATGAATCAGGGGACGTGG + Intronic
1184445336 22:44543932-44543954 TCTGGATGAGGCAGGGGAAGAGG - Intergenic
1184457081 22:44616860-44616882 CCAAGATCAGTCAGGGAGGGAGG + Intergenic
1184487936 22:44792406-44792428 CCAAGGTGAGGCCCAGGAGGAGG - Intronic
1184521584 22:44997746-44997768 CTGGGATGAGGCAGGAGAGGAGG - Intronic
1184650640 22:45918084-45918106 GGGAGCTGAGGCAGGGGAGGAGG + Intergenic
1184675294 22:46038520-46038542 CCAACAGAAGGCAGGGGAAGAGG - Intergenic
1184788813 22:46686507-46686529 CCGTGATGAGGCAGGTGTGGAGG + Exonic
1184850131 22:47115208-47115230 GCAAGCTCTGGCAGGGGAGGTGG - Intronic
1184988989 22:48154764-48154786 GCAAGTTGGGGCTGGGGAGGGGG + Intergenic
1185032678 22:48452956-48452978 CCCAGAGGAGGCATGGGAGATGG + Intergenic
1185070697 22:48654224-48654246 CCAAGAGGAGGAGGAGGAGGAGG + Intronic
1185119869 22:48959909-48959931 CCAAGATGAGACAGGTGAGTGGG - Intergenic
1185120052 22:48960676-48960698 CCAAGATGAGACAGCTGAGTGGG - Intergenic
1185265858 22:49903662-49903684 CCCAGCTGAGGCTGTGGAGGAGG + Exonic
1185349044 22:50324817-50324839 CTGAGAAGAGACAGGGGAGGGGG - Intronic
1185399613 22:50609011-50609033 TCAAGATGTGGCAGGGGTGTGGG + Intronic
949624209 3:5849346-5849368 CCAAGATTGGGCAGAGAAGGAGG - Intergenic
949955699 3:9266923-9266945 CCAACATTAGACAGAGGAGGAGG - Intronic
950135891 3:10580577-10580599 CAAAGATGAGGAAGCAGAGGAGG - Intronic
950136535 3:10585016-10585038 CCTGGGTGTGGCAGGGGAGGAGG - Intronic
950506730 3:13399737-13399759 CGAAGATGATGCTGGTGAGGCGG + Exonic
950557480 3:13704233-13704255 CCAAGTTGAGGCAACTGAGGGGG + Intergenic
950655644 3:14434726-14434748 CCAGGATGAGGCAGGGTGGCTGG - Intronic
950682930 3:14597477-14597499 CAAAGTGGAGGCAGGGCAGGTGG + Intergenic
950863807 3:16173353-16173375 CCAAGATGGGGAAGGAGAGAAGG - Intergenic
951017442 3:17745841-17745863 CCAACGGGTGGCAGGGGAGGGGG - Intronic
951168721 3:19513020-19513042 GGAAGATGAGGAAGAGGAGGAGG + Exonic
951327433 3:21320508-21320530 CCAATATGAGGCAGGGAACTGGG + Intergenic
951409458 3:22344540-22344562 CCAAAATGAGGCAGGCATGGTGG - Intronic
951593214 3:24289041-24289063 CTAAGAAGAGGGAGGGGATGAGG + Intronic
952481982 3:33771081-33771103 CCAAGAGGATTCGGGGGAGGGGG - Intergenic
952956374 3:38560359-38560381 AGAAGATGAGGCAGACGAGGAGG + Exonic
952977978 3:38712376-38712398 AGAAGATGAGGCAGACGAGGAGG + Exonic
953495978 3:43387375-43387397 CCAAGATGAGGCTGGAGACATGG - Intronic
953860706 3:46541868-46541890 CACAGCTGAGGCAGGGGAGGTGG + Intronic
954099345 3:48357557-48357579 CCAAGAGGAGGCACTGGAGTGGG + Intergenic
954351620 3:50048953-50048975 CAAAAATCAGGCAGGTGAGGTGG - Intronic
954377591 3:50203316-50203338 CAGAGATGGGGCAGTGGAGGCGG + Intergenic
954638645 3:52085216-52085238 CCCAGCTGGGGCAGGGGATGGGG - Intronic
954884752 3:53862912-53862934 GGAAGAGGAGGCAGGAGAGGTGG - Intronic
954959782 3:54554009-54554031 ACTAGATGAGGCTGGAGAGGTGG - Intronic
955239536 3:57166732-57166754 CCAAGATAAGGCTGGGGCTGGGG - Intronic
955277138 3:57557032-57557054 CCAAGAAGAAGAAGGTGAGGAGG - Exonic
955710953 3:61778598-61778620 CCAAGTTGAGGCAGGAGAATAGG - Intronic
956618636 3:71198408-71198430 CCAAGATGGGGGGAGGGAGGGGG + Intronic
956834668 3:73086827-73086849 CCATGAGGAGGAAGGGGAGAGGG + Intergenic
958173931 3:89971423-89971445 CCAATATGCAGCAGGGGTGGAGG + Intergenic
958762224 3:98322904-98322926 GCCAGATGAGGCCAGGGAGGTGG - Intergenic
959817449 3:110691602-110691624 TTAAGATGAGGCAGAGGTGGAGG - Intergenic
961030583 3:123600061-123600083 GGAAGATTAGGAAGGGGAGGAGG - Intergenic
961819851 3:129570469-129570491 CCATGTAGAGGCAGGGGAGCAGG - Intronic
962119854 3:132549952-132549974 CCAAGATGAGGCATTGGACTTGG - Intergenic
962234314 3:133694383-133694405 CCAACATCAGGCTGAGGAGGAGG - Intergenic
962390347 3:134966465-134966487 ACAAGAAGAGCCAGGGTAGGTGG - Intronic
962500030 3:135981839-135981861 ACAAGATGAGGTCAGGGAGGTGG + Intronic
962609369 3:137061101-137061123 CCAACCTGAGGCAAGGGAGCTGG + Intergenic
962906098 3:139804410-139804432 GCAAGGTGGGGCAGGGGAAGAGG + Intergenic
963456753 3:145555218-145555240 CGAGGATCAGGCTGGGGAGGAGG + Intergenic
963475360 3:145796918-145796940 ACTAGATGAGGGAGGGAAGGAGG + Intergenic
963841692 3:150114297-150114319 CCAAGAGAATGCAGAGGAGGAGG + Intergenic
963858254 3:150279225-150279247 CAGGGATGTGGCAGGGGAGGTGG - Intergenic
964569679 3:158097875-158097897 CCAAGATGCGATAGGGGACGAGG + Exonic
965384034 3:168024525-168024547 CCAGGAAGAGGCAGAAGAGGAGG - Exonic
965547884 3:169934080-169934102 GCAAGATGAGACTGGAGAGGTGG + Intronic
965568931 3:170151736-170151758 CCTAGTGGAGGCAGGGAAGGAGG + Intronic
966854901 3:184187024-184187046 CCATGATGGGGGTGGGGAGGAGG + Intronic
966883587 3:184362678-184362700 CCAGGAGAAGGCAGTGGAGGGGG + Intronic
967220737 3:187245984-187246006 AGAAGATGAGGCCAGGGAGGGGG - Intronic
968574660 4:1360022-1360044 CCAGGCACAGGCAGGGGAGGAGG + Intronic
968725465 4:2245904-2245926 CCAAGAAGAGGGTGGGTAGGAGG + Intergenic
968728707 4:2259948-2259970 CCAAGGTGAGGGAGGGGACATGG - Intronic
969125336 4:4943800-4943822 CCAGGCTGAGGCAGGGGTTGTGG + Intergenic
969526140 4:7705087-7705109 CCAAGATGAGGCCATGGAGTAGG + Intronic
969530885 4:7729526-7729548 CCAGTATGAGGCAGGGAATGAGG + Intronic
969665912 4:8557632-8557654 CCCGGATGTGGCAGGGAAGGAGG - Intergenic
969713972 4:8859752-8859774 CCACGATGACGAAGGGGCGGGGG - Intronic
970332724 4:15002619-15002641 CCTAGGTGGGGCAGGGGACGAGG + Intergenic
972006348 4:34112884-34112906 GGAAGAGGAGGCAGGGGAGGAGG + Intergenic
972032390 4:34477799-34477821 CAAAGAAGAAGAAGGGGAGGAGG - Intergenic
972733457 4:41817474-41817496 CCAGGCAGAGGCAGGGGAGATGG - Intergenic
972876374 4:43366189-43366211 TCAGTTTGAGGCAGGGGAGGTGG - Intergenic
973336129 4:48958604-48958626 CCTAGGTGAGGGAGTGGAGGGGG + Intergenic
974280563 4:59786240-59786262 GAAAGATGAGGAAGAGGAGGAGG - Intergenic
974383230 4:61169899-61169921 ACTAGATGAGGAAGGGAAGGAGG + Intergenic
975116845 4:70689127-70689149 TCAACAGGAGGCAGAGGAGGAGG + Exonic
976387687 4:84480278-84480300 CCAAGATGAGGAAGGAGGTGGGG + Intergenic
976897418 4:90128279-90128301 CGAAGAGGGGGAAGGGGAGGAGG + Intronic
977667160 4:99654445-99654467 CCTGGATGAGGCGGTGGAGGTGG + Exonic
977810081 4:101347574-101347596 CCGGGAGGAGGAAGGGGAGGAGG - Intronic
978508033 4:109481744-109481766 CGATGATGAGGAAGAGGAGGAGG + Exonic
978912480 4:114080821-114080843 CCAAAAGAAGGCAGGGAAGGTGG - Intergenic
979715704 4:123835001-123835023 CCAAGTGGCGGCAGGGGCGGTGG + Intergenic
981638888 4:146912708-146912730 CCAAGAGAAGGGAGGGGAGGAGG + Intronic
982533410 4:156577202-156577224 CCAAGCAGAGGCAGGGAAAGAGG + Intergenic
982634542 4:157877106-157877128 CCAAAAGGAGGCAGAGAAGGAGG - Intergenic
983515483 4:168651713-168651735 AGAAGAAGAGGTAGGGGAGGAGG + Intronic
983690721 4:170465647-170465669 CTCAAATGAGGCAGTGGAGGTGG + Intergenic
984644052 4:182201591-182201613 CCAAGAAGATCCAGGGGTGGGGG + Intronic
985391692 4:189497151-189497173 ACAAAGTGAGGCAGGGAAGGAGG - Intergenic
985433087 4:189900326-189900348 CCATGAAGGGGCAGGGCAGGAGG - Intergenic
985655979 5:1131563-1131585 CCAACACCAGGCAGGAGAGGTGG - Intergenic
986035567 5:3933762-3933784 CCAAGACCAAGCAGTGGAGGAGG - Intergenic
986274380 5:6260765-6260787 CAAAGAGGGGGCAGGGGATGGGG + Intergenic
986741741 5:10710887-10710909 CCAAGCTGAGCCAGGGGAAGTGG + Intronic
987133527 5:14880878-14880900 TCAAGATGAGTCAGGGGATGGGG + Intergenic
987839983 5:23211283-23211305 ACAAAATTAGCCAGGGGAGGTGG - Intergenic
988550471 5:32196552-32196574 CAAAGATGAGCCAGGGATGGTGG - Intergenic
988927488 5:36004261-36004283 ACAACTTGAGGCAGGGGTGGGGG - Intergenic
989572484 5:42957470-42957492 CCAAAATGAGCCAGGCGTGGTGG + Intergenic
991981024 5:72230862-72230884 ACAAGATGAGGCAGGGAAGCAGG - Intronic
992206888 5:74439634-74439656 CCCAAGTGTGGCAGGGGAGGGGG + Intergenic
992898227 5:81266226-81266248 CCAAACTGAGGCAGAGGGGGTGG - Exonic
993064948 5:83086632-83086654 GGAAGAGGAGGCAGGAGAGGTGG + Intronic
993911356 5:93688877-93688899 CCTGGATGAGGCAGTGGAGATGG - Intronic
995751849 5:115460386-115460408 CCCAGATGGGGGTGGGGAGGCGG - Intergenic
995830579 5:116350482-116350504 GGAAGGGGAGGCAGGGGAGGCGG + Intronic
996406653 5:123111891-123111913 CCAAGATGTAGCAGGGGCGAAGG - Intronic
997586529 5:135046995-135047017 CCAACAGGAGGCAAGGGAGGGGG - Intronic
998393785 5:141805241-141805263 CCAAGAAGAGACAAGGAAGGTGG + Intergenic
999327344 5:150651268-150651290 CCAGGGGGAGGCAGGAGAGGAGG + Exonic
1000515761 5:162235301-162235323 CCAACAGGAGGCAAGGAAGGAGG - Intergenic
1000588977 5:163135312-163135334 GCACGCTGAGGCAGGAGAGGCGG + Intergenic
1002213700 5:177613047-177613069 CCAGAATGAGGCAGGTGAGTGGG + Intergenic
1002323198 5:178387897-178387919 CCAAGATGTGGCAGCTGTGGTGG + Intronic
1002424409 5:179166889-179166911 CCAGGATGAGGCAGCGAACGCGG + Intronic
1002457768 5:179355485-179355507 CCAGGAGGATGCAGGAGAGGAGG - Intergenic
1003089133 6:3086629-3086651 ACAAGGTGAGGTATGGGAGGAGG + Intronic
1003550420 6:7098155-7098177 CAAAAATGAGGAAGCGGAGGGGG - Intergenic
1003634014 6:7814817-7814839 TCGGGGTGAGGCAGGGGAGGGGG + Intronic
1004024390 6:11805102-11805124 ACAAGTTGAAGCAGGGGAGGGGG - Intronic
1004058004 6:12160626-12160648 AAAACAGGAGGCAGGGGAGGGGG + Intronic
1004643655 6:17539335-17539357 CCTGGAGGAGGCAGAGGAGGAGG - Exonic
1005135969 6:22570073-22570095 CCAAGAGGAGGAGGCGGAGGCGG + Exonic
1005143552 6:22662321-22662343 CAAAAATGAGGCAGGCGTGGTGG - Intergenic
1006078065 6:31547070-31547092 ACAACGGGAGGCAGGGGAGGGGG - Intronic
1006136213 6:31897618-31897640 CCGAGGTGCGGAAGGGGAGGGGG - Exonic
1006287058 6:33104638-33104660 CCAAGATAAGGGTGGGGAGAAGG + Intergenic
1006377203 6:33678215-33678237 CCAAGATGAGGCTGGAGTTGGGG - Intronic
1006461967 6:34164724-34164746 ACAAAATGAGGCAGGCGTGGTGG + Intergenic
1006468944 6:34215175-34215197 CAAAGATTAGCCAGGGGTGGTGG - Intergenic
1006711619 6:36077978-36078000 ACAAGAAGAGGAAGGGGAGCAGG - Intronic
1006816315 6:36852835-36852857 CCAACATGAAACTGGGGAGGGGG - Intergenic
1006879198 6:37324330-37324352 CCAAGAAGAGGCAGAGGAAGAGG + Intronic
1007287182 6:40755935-40755957 CCAAGGTTTGTCAGGGGAGGTGG + Intergenic
1007399264 6:41594606-41594628 CCAAGATGTGGCAGGGAGAGAGG + Intronic
1007477758 6:42130296-42130318 CCAAGATCAGACAGGGCATGCGG + Intronic
1007752955 6:44081174-44081196 ACAAAATGGGGCAGGGGAGGGGG + Intergenic
1007925090 6:45643914-45643936 CCAAGGTGAGGCAGCTAAGGGGG + Intronic
1008383705 6:50862638-50862660 AAAAGAAGAGGCAGGGGAGAAGG - Intergenic
1008419805 6:51284889-51284911 GCAAGAGAAGGCAGTGGAGGAGG - Intergenic
1008684178 6:53905683-53905705 CCAAGATGAGGAAAGGAAAGAGG - Intronic
1008874704 6:56313077-56313099 TCAAGGTGGGGCAGGGGAGGAGG + Intronic
1010887411 6:81261858-81261880 GGAAGAAGAGGAAGGGGAGGGGG + Intergenic
1013435526 6:110101803-110101825 CCAGGTGGAGGCAGAGGAGGCGG + Exonic
1013562192 6:111316511-111316533 CAAAAATTAGCCAGGGGAGGTGG + Intronic
1013744893 6:113333923-113333945 CCAAGATGCTGCAGGGGACTCGG + Intergenic
1014528053 6:122524141-122524163 GCAAGAGGAGGAGGGGGAGGAGG - Intronic
1015559627 6:134500732-134500754 CAAAAATGAGCCAGGCGAGGGGG + Intergenic
1016023063 6:139255927-139255949 CCAAAATTAGTCAGGGGTGGTGG + Intronic
1016718175 6:147258584-147258606 CAAAGATTAGCCAGGCGAGGTGG - Intronic
1017043462 6:150325909-150325931 CAAGGATGGTGCAGGGGAGGTGG + Intergenic
1017696671 6:157022124-157022146 CCAAGAACAGGGCGGGGAGGCGG + Intronic
1017732914 6:157333786-157333808 CCAAGAGCAGGCAGGCGAAGGGG + Intergenic
1017795873 6:157844025-157844047 CAAAAATTAGGCAGGTGAGGAGG - Intronic
1018864115 6:167734410-167734432 CAAAGCGGAGGCAGGAGAGGAGG - Intergenic
1019296361 7:277643-277665 ACAGGATGAGACATGGGAGGTGG + Intergenic
1019369760 7:655514-655536 ACAAGATGATGCAGGGGATGGGG - Intronic
1019404659 7:877175-877197 CCAAGGTGGGGCGGGGGAGGCGG - Intronic
1019737572 7:2658289-2658311 CCCTGATGAGGACGGGGAGGAGG + Exonic
1019918071 7:4145854-4145876 CCAAGACGAGGCAGGGCTGGGGG + Exonic
1020137198 7:5594046-5594068 CCAAGATTGGGCGGGGGGGGGGG - Intronic
1020243327 7:6412065-6412087 CAAAAATGAGCCAGGGGTGGTGG - Intronic
1022461557 7:30613131-30613153 ACAAGATGAGGCAGGTGCTGTGG - Intronic
1022658088 7:32339755-32339777 CAGAGATGAGGCAGAGCAGGAGG + Intergenic
1022702049 7:32770817-32770839 CAAAGCTGAGGCAGCTGAGGCGG + Intergenic
1023910654 7:44553322-44553344 CCAACAGGAGGAGGGGGAGGAGG + Intergenic
1023960461 7:44922068-44922090 CCCTGGTGAGGAAGGGGAGGAGG - Intergenic
1023974921 7:45021671-45021693 GTGAGATGAGGCAGGGGAGTAGG + Intronic
1024084618 7:45883111-45883133 CCAAGAGCAGGGAGGGGTGGGGG - Intergenic
1024116384 7:46197670-46197692 GCAAGAAGAGTCAGGGCAGGAGG - Intergenic
1024156853 7:46634716-46634738 CCAAGAAGTGGCGGGGGTGGGGG + Intergenic
1024194623 7:47047028-47047050 CCAGGATCTGGCAGGGAAGGAGG + Intergenic
1024241589 7:47440187-47440209 CAAGGATGAGGCTGGTGAGGTGG + Intronic
1024599029 7:50963330-50963352 CAAAGATGAGGAGGAGGAGGAGG - Intergenic
1024619980 7:51148756-51148778 CCAAGGTGTGGGAAGGGAGGTGG + Intronic
1025230671 7:57201612-57201634 CCAGGAGGAGGCAGGGTGGGTGG - Intergenic
1025251403 7:57353735-57353757 CCAGGATGAGGCTGTGGAAGCGG - Intergenic
1025730317 7:64102144-64102166 CCAGGAGCAGGCAGGGTAGGTGG + Intronic
1026614410 7:71888790-71888812 CCTAGAGGAGAAAGGGGAGGAGG + Intronic
1026883250 7:73920621-73920643 GCAGGCAGAGGCAGGGGAGGTGG + Intergenic
1027249393 7:76389627-76389649 CCAAGAAGAGGGAAGGCAGGAGG - Exonic
1027539935 7:79453846-79453868 ACGGGAGGAGGCAGGGGAGGAGG + Intergenic
1027912643 7:84271734-84271756 GCAAGATGAGGCAATGGAGTGGG + Intronic
1028067867 7:86410821-86410843 CCATGATGATTCAGGTGAGGAGG - Intergenic
1028382663 7:90215923-90215945 CAAAAATTAGGCAGGGGTGGTGG - Intronic
1028456579 7:91044560-91044582 CCATGATGGGGAAGGGGAGCTGG - Intronic
1028470048 7:91196123-91196145 TCAAGATTGGGAAGGGGAGGTGG - Intronic
1028491349 7:91415407-91415429 CCAGAATGAAGCAGGGAAGGAGG - Intergenic
1029507105 7:100969100-100969122 CCATGTTGAGGCAGGGGATGGGG + Intergenic
1029713922 7:102315479-102315501 CAAAAATGAGCCAGGCGAGGTGG - Intronic
1030416537 7:109251090-109251112 CCAAAGTGAGGCAGCGGAGCTGG - Intergenic
1030615920 7:111738229-111738251 CCAAGTTCAGGCAGGGGGTGAGG + Intronic
1030706897 7:112702039-112702061 GCAAGAGGAAGCAGAGGAGGGGG + Intergenic
1032645019 7:133814144-133814166 CCCATAGGAGGCAGGGGTGGGGG - Intronic
1032886978 7:136151091-136151113 ACAAGATGAGGGAGGCGAGCAGG - Intergenic
1032948198 7:136875891-136875913 CGAAGAGGAGGAAGAGGAGGAGG - Intronic
1033064733 7:138143893-138143915 CCAGGATGAAGCTGGGGATGGGG + Intergenic
1033534373 7:142298582-142298604 CTGAGATGAGGGAGGGGAGCTGG + Intergenic
1034255926 7:149724672-149724694 CCAAGATCAGGATGGGGAGGAGG - Exonic
1034346499 7:150388513-150388535 GAAAGAGGAGGCAGGGGAGCGGG + Intronic
1034412029 7:150946891-150946913 CCAAGGTGAGGGTGGGGAGGGGG + Exonic
1034429527 7:151034198-151034220 CCAAGATCTGGCTGGGGATGGGG + Intronic
1034701722 7:153102121-153102143 GAAAGAGGAGGCAGAGGAGGAGG - Intergenic
1034824254 7:154247158-154247180 CAAAGATGAGCCAGGAGTGGTGG + Intronic
1035530868 8:349921-349943 CCATGATGGGGCAAAGGAGGGGG + Intergenic
1036178047 8:6557964-6557986 TCAAGATGAGGAAGAGGGGGAGG - Intronic
1037129557 8:15391010-15391032 CCAAAAAGAGGGAGGGAAGGGGG + Intergenic
1037777430 8:21844919-21844941 ACAAGATGAGGTGAGGGAGGTGG - Intergenic
1037799211 8:22023489-22023511 CTAAATGGAGGCAGGGGAGGGGG - Intergenic
1037983365 8:23271282-23271304 CAAAGATTAGCCAGGTGAGGTGG - Intronic
1038151003 8:24942317-24942339 CCAACATGGGGCTGGGAAGGGGG - Intergenic
1038472973 8:27840723-27840745 TCAGGAGGAGGCAGGGGATGGGG + Intergenic
1039836409 8:41259613-41259635 CCAAAAGGAGGAAGGGGTGGGGG + Intergenic
1039897376 8:41725743-41725765 CCAAGGTGAGGGCGAGGAGGAGG - Exonic
1040447656 8:47511880-47511902 CCAAGATGAGGATGAGGAAGAGG - Intronic
1040995067 8:53392772-53392794 CCAGGCAGAGGCAGGGGAGGAGG + Intergenic
1040996916 8:53411636-53411658 CCAGGATGGAGAAGGGGAGGAGG + Intergenic
1041160545 8:55038298-55038320 CCAAAATAAGGCAGGAAAGGAGG + Intergenic
1041292867 8:56323518-56323540 CCAAAATTAGCCAGGGGTGGTGG + Intergenic
1041642783 8:60220536-60220558 CCAAGATGTGGAGGAGGAGGGGG - Intronic
1041876628 8:62695113-62695135 CCATGATAAGGCAAGGAAGGAGG - Intronic
1042491086 8:69398524-69398546 TCAAGAGGAGGCTGGAGAGGAGG + Intergenic
1045013329 8:97977524-97977546 CCAGGATGTTGCAGGGGATGAGG - Intronic
1045430371 8:102108121-102108143 CCCAGCTGAGGCGGGGGAGCTGG - Intronic
1045553323 8:103192202-103192224 CCAAAATTAGCCAGGGGTGGTGG - Intronic
1046090494 8:109497750-109497772 GCAAGAAGAGGGAAGGGAGGAGG - Intronic
1046773452 8:118139062-118139084 CCAAGTGGAGGCAGAGGTGGTGG + Intergenic
1048235540 8:132686311-132686333 ACATGGTGAGGCAGGGGAGCAGG + Intronic
1048874754 8:138827989-138828011 GAGAGATGAGGAAGGGGAGGGGG - Intronic
1048965945 8:139614565-139614587 TCAAGATGAAGCAGTGCAGGTGG + Intronic
1049151605 8:141038601-141038623 CCAAGAAGGGGCTGGGGAGGAGG - Intergenic
1049198153 8:141326583-141326605 CGAGGAGGAGGCAGAGGAGGAGG + Intergenic
1049335048 8:142079848-142079870 ACAAAATGAGGCAGAGGAAGGGG - Intergenic
1049376633 8:142292463-142292485 CCAAGATGGGCCTGTGGAGGTGG + Intronic
1049478315 8:142807110-142807132 ACAGGATGAGGAGGGGGAGGTGG - Intergenic
1049852532 8:144840737-144840759 CCAGGGAGAAGCAGGGGAGGTGG + Intronic
1049886480 9:30348-30370 AGAAGAGGAGGCAGGGAAGGCGG - Intergenic
1051193905 9:14542671-14542693 CAGTGATGAGGCAGGAGAGGAGG - Intergenic
1051311497 9:15778484-15778506 CAAAAATGAGCCAGGGGTGGTGG + Intronic
1052503743 9:29326026-29326048 CTAAGAAAAGGAAGGGGAGGAGG - Intergenic
1052739459 9:32379548-32379570 CAAGGATGGGGCAAGGGAGGAGG + Intergenic
1053188268 9:36037155-36037177 CCAAGATGGCGCGGGGCAGGGGG + Intronic
1054944614 9:70782939-70782961 CAAAGATGAGGAAGGGGATAGGG + Intronic
1055202737 9:73686050-73686072 CCCAGATGAGGAGGGTGAGGTGG + Intergenic
1056085974 9:83149557-83149579 CCAAGATGAGGCAGCAGGGTAGG + Intergenic
1056486526 9:87063632-87063654 AAAAGATGAGGAAGGGGAAGAGG - Intergenic
1057185479 9:93055278-93055300 GCTGGAGGAGGCAGGGGAGGAGG - Intergenic
1057225226 9:93289451-93289473 CCCAGCTGAGGCTGAGGAGGTGG - Exonic
1057938370 9:99259286-99259308 CCAACACGCAGCAGGGGAGGAGG + Intergenic
1058280711 9:103109993-103110015 CCAAAAGGGGGCAGGGAAGGAGG + Intergenic
1058555042 9:106158218-106158240 CCAGGATGGGGCAGGAGTGGAGG + Intergenic
1058894705 9:109389036-109389058 CCAAGCTGGGACTGGGGAGGAGG + Intronic
1059135210 9:111799335-111799357 CTAAGATGAGGATGGGAAGGAGG + Intergenic
1059449422 9:114361053-114361075 CCAGTCTGAGGCTGGGGAGGTGG - Intronic
1059757236 9:117304871-117304893 CCAGGCTGAGGGTGGGGAGGAGG + Intronic
1060025368 9:120166245-120166267 CAAAGATTAGCCAGGGGTGGTGG - Intergenic
1060030535 9:120211309-120211331 CCAAGAGGAGCAAGGTGAGGAGG + Intergenic
1060209044 9:121699288-121699310 ACAAGAGGGGGAAGGGGAGGCGG - Intronic
1060282778 9:122225483-122225505 CCAAGACGCGGCAGGACAGGAGG + Intronic
1060297741 9:122354795-122354817 CCAGCAGGAGGCTGGGGAGGTGG + Intergenic
1060495220 9:124113419-124113441 GGAACATGAGGCAGGAGAGGTGG + Intergenic
1060872437 9:127053572-127053594 CCCAGATCAGGCAGGCCAGGAGG - Intronic
1061061363 9:128251938-128251960 CCAAAATGAGGCAGGGATTGGGG + Intronic
1061139068 9:128753363-128753385 CCAAGTTGAGGAAGCGGAGGCGG + Exonic
1061185269 9:129049290-129049312 CCATGGTCAGGCAGTGGAGGAGG + Intronic
1061246636 9:129404163-129404185 CCAGGAGGAGGCAGAGGAAGGGG + Intergenic
1061255435 9:129452356-129452378 CCAAGAGGAAGAAGAGGAGGAGG + Intergenic
1061441377 9:130606287-130606309 CAAAGAAGAGGCAGAGGAGGGGG + Intronic
1061497936 9:130986333-130986355 GCAGGATGAGGCAGGGGAGTGGG + Intergenic
1061719363 9:132542264-132542286 CTAAGATGTGCCAGGGGATGGGG - Intronic
1061854916 9:133436802-133436824 CCAGGAGGAGGCAGAGGAGGGGG - Intronic
1061921786 9:133786696-133786718 CGAAGGGGAGGCAGGGAAGGGGG - Intronic
1062064118 9:134517229-134517251 CCAAGGAGAGGGAGAGGAGGCGG - Intergenic
1062501234 9:136852879-136852901 CCCTGAAGAGGCTGGGGAGGGGG - Intronic
1062679483 9:137770739-137770761 CTCAGAGGAGGCAGGGAAGGTGG - Intronic
1062683504 9:137797948-137797970 TCCAGAAGAGGCAGGGGAGCCGG - Intronic
1185514266 X:687339-687361 CAAAGATTAGCCAGGGGTGGTGG + Intergenic
1186688146 X:11947111-11947133 CCAACTTGTGGCAGGGGTGGGGG - Intergenic
1188237396 X:27747255-27747277 ACAAGAGGAGGGAGGGGAGGAGG + Exonic
1188985779 X:36767276-36767298 CCAAGATGAGTCAGAGCAGTTGG - Intergenic
1189110716 X:38286451-38286473 GGAAGAGGAGGAAGGGGAGGGGG - Exonic
1189110725 X:38286472-38286494 GGAAGAGGAGGAAGGGGAGGGGG - Exonic
1189259586 X:39669013-39669035 CCAACTTGAGGCAGGGAAGCTGG - Intergenic
1189294768 X:39910479-39910501 CCAAGCTGTGGCAGGGCTGGAGG - Intergenic
1189406887 X:40733339-40733361 GGAGGCTGAGGCAGGGGAGGGGG - Intronic
1189676516 X:43466229-43466251 CCAAGCTTCAGCAGGGGAGGTGG - Intergenic
1190101083 X:47523680-47523702 CCAGGGGGAGGCAGGGGAAGGGG - Intergenic
1190560698 X:51682658-51682680 CCAAGAGGTGGCTGGGTAGGTGG - Intergenic
1190563593 X:51710663-51710685 CCAAGAGGTGGCTGGGTAGGTGG + Intergenic
1191647834 X:63502853-63502875 CAAAGATTAGCCAGGCGAGGTGG - Intergenic
1192362375 X:70447879-70447901 GCAAGAAGAGGCAAGGGAAGGGG - Intronic
1193333076 X:80256928-80256950 TCAACATGAGGTTGGGGAGGGGG - Intergenic
1193369442 X:80676934-80676956 GGAAGAGGAGGCAGGGGACGAGG - Exonic
1194667315 X:96689560-96689582 CTAAGGAGAGGCAAGGGAGGTGG - Intronic
1195169495 X:102252143-102252165 CGAAAATGAGCCAGGCGAGGTGG - Intergenic
1195189362 X:102434956-102434978 CGAAAATGAGCCAGGCGAGGTGG + Intronic
1195273331 X:103254442-103254464 CGGAAATGAGGCGGGGGAGGAGG - Intronic
1196944942 X:120814517-120814539 CCAGGTTTAGGAAGGGGAGGGGG - Intergenic
1197925882 X:131646803-131646825 CCAAGAGGAAGAAGAGGAGGAGG + Intergenic
1197941419 X:131793964-131793986 CAAAGATGAGCCAGGTGTGGTGG + Intergenic
1198188603 X:134281022-134281044 CCAAGATGAGATATGGGTGGGGG - Intergenic
1198334770 X:135655588-135655610 CAAAAATGAGCCAGGCGAGGTGG + Intergenic
1199685430 X:150260973-150260995 CCAAGAGGAGGCCTGGGAGGTGG + Intergenic
1200968696 Y:9126619-9126641 CCACTATGAGGCAGGGTTGGAGG + Intergenic
1201951317 Y:19567411-19567433 CCGAGAAGAGGCAGCGGCGGTGG + Intergenic
1202142126 Y:21735901-21735923 CCACTATGAGGCAGGGTTGGAGG - Intergenic
1202144739 Y:21767901-21767923 CCACTATGAGGCAGGGTTGGAGG + Intergenic