ID: 1173583868

View in Genome Browser
Species Human (GRCh38)
Location 20:44166954-44166976
Sequence AGTCCAAGATGAGGCAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583868_1173583876 11 Left 1173583868 20:44166954-44166976 CCTCCCCTGCCTCATCTTGGACT 0: 1
1: 0
2: 1
3: 39
4: 438
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583868_1173583874 9 Left 1173583868 20:44166954-44166976 CCTCCCCTGCCTCATCTTGGACT 0: 1
1: 0
2: 1
3: 39
4: 438
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583868_1173583875 10 Left 1173583868 20:44166954-44166976 CCTCCCCTGCCTCATCTTGGACT 0: 1
1: 0
2: 1
3: 39
4: 438
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583868 Original CRISPR AGTCCAAGATGAGGCAGGGG AGG (reversed) Intronic
900484552 1:2915248-2915270 AGTCCAAGGAGGGGCAGTGGGGG + Intergenic
901154096 1:7123878-7123900 AGTCCAAGGGCAGCCAGGGGAGG + Intronic
901731613 1:11284324-11284346 AGCTCAAGGTGAGGCAGGAGAGG + Intronic
902120885 1:14164694-14164716 AGTACAAAATGAGCCAGGCGTGG - Intergenic
902191044 1:14763509-14763531 ACTCCAAGGGGAGGCAGGGGTGG - Intronic
902416408 1:16242419-16242441 AGGCCATGCTGAGGGAGGGGTGG - Intergenic
902602744 1:17551253-17551275 ATTCCAAGATGAGTAAGGTGTGG + Intronic
903671058 1:25035553-25035575 ATTCCCAGATGAGGCAGTTGAGG + Intergenic
904325405 1:29724631-29724653 AGGCCAAGAAGAGGCTGAGGGGG - Intergenic
905015698 1:34777091-34777113 AGTCTGAGAGGTGGCAGGGGTGG + Intronic
905068139 1:35201268-35201290 AGTCAGGGATGAGGCTGGGGAGG - Intergenic
905651738 1:39661342-39661364 AGTCCTGTATGAGGCAGGTGGGG - Intronic
906639245 1:47431847-47431869 GCTCCAGGATGAGGCAGGGAGGG - Intergenic
907001344 1:50861541-50861563 ACTCCAAAATGTGGCAGGGTAGG + Intronic
907818461 1:57943474-57943496 AGGCCAATGGGAGGCAGGGGTGG - Intronic
908356538 1:63328953-63328975 AGTGCAAGATGCGGCCTGGGAGG + Intergenic
909550506 1:76894461-76894483 AGCGCAGGAAGAGGCAGGGGGGG + Intronic
910915075 1:92279627-92279649 AGGGCAAGCTGAGGCAGGGCGGG + Intronic
911814946 1:102336534-102336556 ATTTCCAGCTGAGGCAGGGGTGG + Intergenic
912254731 1:108047241-108047263 AGTGCAAGATGAGGCTGATGGGG - Intergenic
912378280 1:109230690-109230712 AGTCCCAGCTGAGGCTGAGGTGG + Intronic
912950256 1:114115890-114115912 AGTCCCAGAGGAGGCTGGGTGGG - Intronic
913289808 1:117261664-117261686 AGGGCAAGATGAGGCTGGGATGG + Intergenic
913363166 1:118004785-118004807 AGGGCAAGATGAAGCAGGGCAGG - Intronic
914720630 1:150285855-150285877 AGTCCCAGCTGAGGCTGGGTGGG + Intronic
915023654 1:152805539-152805561 AGGACAAGAATAGGCAGGGGTGG - Intronic
915147173 1:153802068-153802090 AGCCCAGGAAGAGGCAGAGGAGG - Intergenic
915571282 1:156746682-156746704 AGGCCAAGCTGAGCCAGGGGTGG + Intronic
915789753 1:158655432-158655454 ACTCCAACCTGAGGAAGGGGTGG - Intronic
916681342 1:167108050-167108072 AGTGCAAGTTGAGGCTGGGGAGG + Intronic
916684985 1:167136234-167136256 AGGCAAAGAAGAGGCTGGGGTGG + Intergenic
916752637 1:167737397-167737419 GGGCCAGGATGAGGCTGGGGAGG + Intronic
917207171 1:172588841-172588863 AGTTCAAGAGGAGGAAGAGGAGG + Exonic
917339570 1:173961195-173961217 AGACTAGGATGAGGCTGGGGAGG + Exonic
917349561 1:174062950-174062972 AGTCCAACATGAGCCAGGGAAGG - Intergenic
917707538 1:177649332-177649354 AATCCAACTTGAGGGAGGGGAGG + Intergenic
918424543 1:184394983-184395005 ATCCCAGGGTGAGGCAGGGGTGG - Intronic
919897055 1:202015505-202015527 ATTCCAAGAGGAGGGTGGGGAGG - Exonic
920165329 1:204031632-204031654 AGTCCAAGGAGGGGCAGGGAGGG + Intergenic
920388795 1:205586108-205586130 AGCCCCAGAAGAGGCTGGGGAGG - Exonic
921318392 1:213914051-213914073 AATGAAAGATGAGGCTGGGGTGG + Intergenic
921792837 1:219309486-219309508 AGTTCAAGATGAGATATGGGTGG - Intergenic
922555118 1:226527083-226527105 AGGGAAAGAGGAGGCAGGGGCGG + Intergenic
922928286 1:229368841-229368863 AAGCAAAGATGAGGCTGGGGAGG - Intergenic
923498399 1:234544472-234544494 AATCCCAGATGTGGCAGGGGTGG + Intergenic
923908882 1:238417381-238417403 AGTTCAAGATGAGATTGGGGTGG - Intergenic
924519184 1:244791356-244791378 ACTGGAAGCTGAGGCAGGGGAGG + Intergenic
924701951 1:246463085-246463107 GGTTCAAGATGAGGCAGGGAGGG + Intronic
1062982498 10:1737067-1737089 AGTCCAAGAGGAGGAGGAGGCGG - Exonic
1063328691 10:5133172-5133194 AGTCCGAGATGAAGTGGGGGAGG - Intronic
1065265401 10:23970102-23970124 AGTTCAAGATGAGGTTTGGGTGG + Intronic
1068091186 10:52434419-52434441 AGTGAAGGCTGAGGCAGGGGTGG - Intergenic
1069855982 10:71441250-71441272 CCTCCCACATGAGGCAGGGGGGG - Intronic
1070572606 10:77651270-77651292 AGCCAAGGATGAGGCAGGGGAGG + Intergenic
1071858221 10:89646678-89646700 AGCCCCTGATGAGGCAGGAGAGG - Intergenic
1072116424 10:92374473-92374495 ACTCCAAAAGGAGGGAGGGGAGG - Intergenic
1072246355 10:93547435-93547457 GGTCACAGATGTGGCAGGGGAGG + Intergenic
1072316765 10:94211032-94211054 AGTCCAAGAGGTGGCAGTGGCGG - Intronic
1072626220 10:97113945-97113967 ACTCCCAGGTGGGGCAGGGGTGG + Intronic
1072631159 10:97147566-97147588 AGACCCAGGTGAGGCAGAGGTGG + Intronic
1073295391 10:102435564-102435586 AGACCAAGGTGAGGAAGGGGAGG + Intergenic
1073396016 10:103218205-103218227 AATTCAAAGTGAGGCAGGGGTGG + Intergenic
1074279389 10:112036678-112036700 AGTCCAAGATGAGATTTGGGTGG + Intergenic
1074452175 10:113568159-113568181 AGTGCATGATGTGGAAGGGGTGG - Intronic
1075403859 10:122180860-122180882 AATCCCAGCTGAGGCAGGAGAGG - Intronic
1075669561 10:124255078-124255100 AATTCAAGATGAGACTGGGGTGG - Intergenic
1076732937 10:132447284-132447306 ATTCAAAGCTGAGGCAGGAGGGG - Intronic
1077024250 11:432269-432291 CGTCCAGGATGAGGCTGGGCTGG + Intronic
1077231888 11:1461415-1461437 CGCCCCAGATGAGGCAAGGGAGG - Exonic
1077501026 11:2909769-2909791 AGGCCAAGAGGAGGCGGGGCGGG - Intronic
1078145687 11:8720611-8720633 GGACCAAGCTGAGGCTGGGGAGG - Intronic
1078860106 11:15239037-15239059 AGACCCAGATGTGGCACGGGAGG + Exonic
1080074054 11:28127090-28127112 GGTGCAAGATGAGGCTGGAGAGG + Intronic
1080214228 11:29823001-29823023 AGTGCTAGATGAGCCAGAGGGGG - Intergenic
1080513785 11:33001257-33001279 AGTCCAAGATGATGGAGCAGAGG - Intergenic
1080755676 11:35195399-35195421 TGTCTAAGATCATGCAGGGGTGG + Intronic
1080824898 11:35839556-35839578 AATTCAAGATGAGACATGGGTGG + Intergenic
1082765576 11:57164888-57164910 AGTCCAGGACCAGGCAGGTGGGG + Intergenic
1082798553 11:57396368-57396390 GGTAGAAGATGGGGCAGGGGAGG - Intronic
1082837591 11:57663004-57663026 TGTACAAGATGAGGCTGGAGGGG + Intergenic
1083301450 11:61741540-61741562 AATCCTACATGAGCCAGGGGAGG + Intronic
1084045311 11:66564677-66564699 ACTCCAAGAAGAGGTCGGGGAGG + Intronic
1084421554 11:69063069-69063091 AGTCCAAGATGAGACTCCGGTGG - Intronic
1084971274 11:72773396-72773418 AGTCAGAGCTGAGCCAGGGGCGG + Intronic
1085114582 11:73919521-73919543 AGTCATAGATGAGGCAAGCGGGG + Intronic
1085540465 11:77263505-77263527 AGTCCAAAAGGAGGCAGGAAAGG + Intronic
1085701157 11:78747257-78747279 AGACCCAGATGTGGCAGGGATGG + Intronic
1085868169 11:80319405-80319427 AGTGAAAGATGAGGCTGGTGAGG - Intergenic
1086306733 11:85487896-85487918 AGTCCAAGATGAGATTTGGGTGG - Intronic
1087377199 11:97358745-97358767 AGCACAAGATGAGGAAGGAGAGG - Intergenic
1089456006 11:118626170-118626192 CGTCCAATCAGAGGCAGGGGAGG - Intronic
1090797300 11:130146185-130146207 AGTCCTGGGGGAGGCAGGGGCGG + Intergenic
1090904046 11:131058206-131058228 AGTTCAAGATGAGACGTGGGTGG + Intergenic
1092105999 12:5922163-5922185 AGAACACGATGAAGCAGGGGAGG + Intronic
1093465110 12:19440393-19440415 AGTTCAAGAGGAGGAAGGGAAGG - Intronic
1094436719 12:30428999-30429021 AATCCAATATGAAGCAGAGGAGG + Intergenic
1094784522 12:33830955-33830977 AGTCAAGAATGAGGCAGAGGGGG - Intergenic
1095689353 12:45069738-45069760 AGTTCAAGATGAGATTGGGGTGG - Intergenic
1096141045 12:49242776-49242798 AGTCACAGATGAGCCAGGCGCGG - Intronic
1096443857 12:51670488-51670510 AGTGGAAGATGAGGCTGGGGAGG + Intronic
1096804040 12:54129503-54129525 AGCCCAAGGTGAGGCGGGGAGGG - Intergenic
1097009758 12:55944353-55944375 AGTCCCAGCTGAGGCTGAGGCGG + Intronic
1097867735 12:64573196-64573218 AGTCCTAGTTGAGGCTGAGGTGG + Intergenic
1098592200 12:72227511-72227533 AATCCAAGATGAGATATGGGGGG + Intronic
1099189665 12:79549192-79549214 AATCCCAGCTGAGGCAGGAGAGG + Intergenic
1099600280 12:84726733-84726755 GGTGGAAGATGAGGCAGGAGAGG + Intergenic
1100311128 12:93395654-93395676 AGTCCAGGATTAGGTAGGGAGGG + Intronic
1100386043 12:94105318-94105340 AGGCCAAGAAGAAGCTGGGGTGG + Intergenic
1100908204 12:99326169-99326191 AATTCAAGATGAGACTGGGGTGG + Intronic
1100924182 12:99524906-99524928 AGTCCAAGATGAGATTTGGGTGG + Intronic
1102003285 12:109572150-109572172 CATCCAAGAAGAGGCAGGAGTGG + Intronic
1102590422 12:113952266-113952288 AGGCTAAGATGAGGAAGGGAAGG + Intronic
1102677620 12:114669049-114669071 AGTACAGGATGAGGGAAGGGAGG + Intergenic
1102701608 12:114844191-114844213 AGTTCAAGATGAGCCTGGGCAGG - Intergenic
1104018275 12:124974930-124974952 AATACAAGATGAGCCAGGTGTGG - Intronic
1104594654 12:130112916-130112938 AGTTCAAGATGAGACTTGGGTGG + Intergenic
1105413103 13:20187883-20187905 AGGACAAAATGGGGCAGGGGAGG - Exonic
1105705666 13:22966187-22966209 GGTCCAAGAACAGGCAGAGGAGG + Intergenic
1105805646 13:23950406-23950428 AGGCCTAGATGAGGAGGGGGAGG - Intergenic
1105858569 13:24391172-24391194 GGTCCAAGAACAGGCAGAGGAGG + Intergenic
1106045998 13:26142713-26142735 ACTCCAAGAGGAGGGAGGGATGG + Intronic
1106135786 13:26972394-26972416 AGTGAAAGATCAGGCAGGTGAGG + Intergenic
1106230682 13:27819032-27819054 AGACCGAGATTGGGCAGGGGTGG + Intergenic
1107100661 13:36587266-36587288 AGTTCAAGATGAGACTTGGGTGG + Intergenic
1109173714 13:59128585-59128607 GTTGGAAGATGAGGCAGGGGAGG + Intergenic
1110724304 13:78801637-78801659 AATTCAAGATGAGGCTTGGGTGG + Intergenic
1111960177 13:94801491-94801513 AGTGCAAGATAAGACAGGGCTGG - Intergenic
1113272159 13:108685587-108685609 GGTCCCAGATGAGGCTGGGAGGG + Intronic
1113368175 13:109697743-109697765 AGTGGAAGATGAGGCAGGACAGG + Intergenic
1114062860 14:19036941-19036963 AGTCCAGGGTTAGGCAGGGGTGG + Intergenic
1114099399 14:19363056-19363078 AGTCCAGGGTTAGGCAGGGGTGG - Intergenic
1114290146 14:21281310-21281332 AGCCCAAGATTGGGCAGGTGTGG - Intergenic
1114973417 14:28063081-28063103 AGTCCAAGATGAGGCTGGAGAGG - Intergenic
1115582633 14:34776858-34776880 AGTCCAAGATCAAGCAGGGTTGG - Intronic
1116436174 14:44897456-44897478 ACTCATAGATGAGGCAGCGGCGG + Exonic
1117232043 14:53729817-53729839 AGTCCAAAATTAGCCAGGCGTGG + Intergenic
1118294277 14:64554614-64554636 AGGCCAGGCTGAGGCAGAGGTGG + Intronic
1119736443 14:76985757-76985779 AGTCCCAGAAGATGCAGGGAGGG - Intergenic
1119956110 14:78799939-78799961 AATTCAAGATGAGGTTGGGGCGG + Intronic
1120744541 14:88141857-88141879 AGGCAGAGAGGAGGCAGGGGTGG + Intergenic
1120922043 14:89764169-89764191 AGTCCTAGGGGAGGCAGGAGAGG + Intergenic
1121596962 14:95171124-95171146 AGACAATGATGAGGCAGGTGAGG - Intergenic
1122323209 14:100867756-100867778 TTGCCAAGAAGAGGCAGGGGGGG - Intergenic
1122402424 14:101475388-101475410 GGTCCAGGATGATGGAGGGGAGG - Intergenic
1122879512 14:104683843-104683865 AGACTCAGAAGAGGCAGGGGTGG - Intergenic
1123175396 14:106411836-106411858 AATCCAAGATGAGATTGGGGTGG + Intergenic
1124475362 15:30028462-30028484 AGGCCAAGAGCAGGCAGGTGGGG - Intergenic
1125382537 15:39102764-39102786 AGTTCAAGATGAGGTTTGGGTGG - Intergenic
1127357889 15:58218475-58218497 AGTACTAGAGGAGGCAGGGAGGG - Intronic
1127978319 15:64015480-64015502 ACTCCAAGAAGAAACAGGGGTGG + Intronic
1128876966 15:71209722-71209744 AGTTCAAGATGAGGTTTGGGTGG - Intronic
1129432109 15:75506844-75506866 GGTCCATGAAGAGGCAGAGGAGG - Intronic
1129641936 15:77389073-77389095 AGTCCTAGCTGAGGCTGAGGTGG - Intronic
1130121354 15:81050438-81050460 AGCCCAAGATAAGGCTGGAGAGG + Intronic
1131265687 15:90913839-90913861 AGTCCAGAAAGAGGCAAGGGAGG - Intronic
1132196268 15:99916741-99916763 AGATCAAGGTGAGGCAGGGTTGG - Intergenic
1132274751 15:100555986-100556008 AGACGCAGATGAGGGAGGGGTGG + Intergenic
1132291949 15:100710128-100710150 AGGCGAAGATGAGGCAGTGGAGG + Intergenic
1132291955 15:100710175-100710197 AGGCGAAGATGAGGCAGTGGAGG + Intergenic
1133013836 16:2929829-2929851 CGACCAAGATGAGGATGGGGTGG + Exonic
1133020535 16:2964935-2964957 GGTCCCAGAAGAGGCACGGGCGG - Exonic
1133835353 16:9362756-9362778 AATTCAAGATGAGGCTTGGGTGG + Intergenic
1134340122 16:13337182-13337204 AATTCAAGATGAGACTGGGGTGG - Intergenic
1135433386 16:22406701-22406723 AGTCCCAGCTGAGGCTGAGGTGG + Intronic
1139387799 16:66585288-66585310 AGTCCCAGCTGAGGCTGAGGTGG + Intronic
1140067821 16:71625880-71625902 AGTGTAAGTTGAGCCAGGGGAGG + Intergenic
1140623359 16:76763228-76763250 AGTCCTAGATGAAGCTGGAGTGG - Intergenic
1140850608 16:78931797-78931819 AGTTCAAGATGAGACTTGGGTGG - Intronic
1141100923 16:81196984-81197006 AGTCCTCGATGAGGCAGGGCAGG - Intergenic
1141335190 16:83147805-83147827 AGACCAAGATGAGTGAGGTGAGG - Intronic
1141900327 16:86986861-86986883 ACTCCCAGATCAGGGAGGGGAGG + Intergenic
1142822907 17:2486131-2486153 AGTTCAAGGTGAAGCTGGGGAGG + Intronic
1143384798 17:6522627-6522649 CGTCCAGCATGAGGCAGGGGAGG + Intronic
1144556041 17:16283912-16283934 AGTTCATGATGAGGCAGATGCGG - Intronic
1144641181 17:16937791-16937813 AGACAAAGATGACGCAGAGGTGG + Intronic
1144873838 17:18386438-18386460 AGACAAAGATGACGCAGAGGTGG - Intronic
1144944438 17:18962572-18962594 AGTGAGAGATGAGGCAAGGGAGG + Intronic
1145158632 17:20559352-20559374 AGACAAAGATGACGCAGAGGTGG + Intergenic
1145255662 17:21320947-21320969 GGCCCAAGAGGAGGCAGTGGAGG - Intergenic
1145320952 17:21767001-21767023 GGCCCAAGAGGAGGCAGTGGAGG + Intergenic
1147159749 17:38563068-38563090 AGGCCAGGAAGAGGCCGGGGTGG - Intronic
1147744622 17:42687660-42687682 ATTCCCAGCTGAGGCAGAGGCGG + Intronic
1147885426 17:43680990-43681012 ATTGCAAGGTGAGGCAGGGCAGG - Intergenic
1147977265 17:44255063-44255085 ACTCCCAGAGGAGGCAGGGATGG + Intronic
1148644937 17:49214386-49214408 GGTCCCAGATCAGGCAGTGGGGG - Intronic
1148779381 17:50112887-50112909 AGGCCAAGAAGAGCTAGGGGAGG - Exonic
1148872259 17:50665470-50665492 AGTCCAGAATCAGGCAGGGCTGG + Intronic
1149114905 17:53081543-53081565 AGTCAACGATGAAGCAGGAGAGG + Intergenic
1149568521 17:57655954-57655976 AATCTAAGAACAGGCAGGGGAGG - Intronic
1150027294 17:61689891-61689913 AGTCCCAGCTGAGGCTGAGGTGG + Intronic
1150043069 17:61884188-61884210 AGCCTTAGATGAGGCAGGGGAGG + Intronic
1150086646 17:62276928-62276950 AGTCCGAGATGGGGGAGTGGGGG - Intronic
1150178872 17:63092828-63092850 AGTTCAACATGAGATAGGGGCGG + Intronic
1151690995 17:75685218-75685240 AGTCCCAGATGGGGAAGGAGGGG - Intronic
1151851583 17:76693726-76693748 AGTCCCAGCTGAGGCTGAGGTGG + Intronic
1152779488 17:82219918-82219940 AGCTCAAGAGGAGGCAGGGGTGG + Intergenic
1153517598 18:5918700-5918722 ATTCCAGATTGAGGCAGGGGCGG - Intergenic
1153527929 18:6015288-6015310 AGTCCAAGAAGAAGAAGGGGCGG + Intronic
1153678401 18:7476786-7476808 AGCCCAAGATGAAGGAGGTGAGG - Intergenic
1154504264 18:15020185-15020207 AGTTCAAGATGAGGTTTGGGTGG + Intergenic
1154997394 18:21653781-21653803 AGTCCTAGCTGAGGCTGAGGTGG + Intronic
1157618791 18:49003385-49003407 AGTCTAGGAGGAGGCAGGGGAGG - Intergenic
1158571089 18:58597661-58597683 AGACTAAGATGAGCCAGTGGGGG - Intronic
1158935901 18:62364321-62364343 AGTGGAAGATGAGGCTGGAGAGG + Intronic
1159313595 18:66741204-66741226 AGTCTAAAGTGAGGCAGGTGAGG + Intergenic
1160388919 18:78515548-78515570 AGGCCAAGATGCGGCTGGGATGG + Intergenic
1160983464 19:1827141-1827163 AGTCCGAGCTGAGGCTGGGGAGG + Exonic
1161026502 19:2039667-2039689 AGTCCAAGCTGGCGCAGCGGCGG - Exonic
1162301844 19:9849021-9849043 AGGCCAGGATGAGGCAGGGCGGG - Intronic
1163050062 19:14676336-14676358 AGTAAAAGATGAGGATGGGGCGG - Intronic
1163726152 19:18924292-18924314 ACTCCATGATGAAGCAGGTGAGG + Exonic
1165256323 19:34578998-34579020 AGTCCCAGGTGAGGCTGAGGTGG - Intergenic
1165418496 19:35710418-35710440 AGCCCAGGAAGAGGAAGGGGGGG + Intronic
1165532550 19:36416598-36416620 AATACAAGATTAGGCAGGCGTGG + Intronic
1167095646 19:47373693-47373715 AGTTCAAGGTGAGGCTCGGGAGG + Exonic
1167321650 19:48800222-48800244 GGTCCATGTTGAGCCAGGGGCGG + Exonic
1167646088 19:50705864-50705886 AGCCCAAGGTGGGCCAGGGGTGG + Intronic
1168488254 19:56783665-56783687 AATACAAGAGGAGGCAGGGAGGG + Intronic
1168681214 19:58317285-58317307 AGTTCAAGAAGAGGCTGGGCTGG + Intergenic
925897585 2:8484935-8484957 AGTGGAAGAAGAGACAGGGGAGG + Intergenic
925957169 2:8978158-8978180 AGTGCGAGATGAGGCTGGAGAGG - Intronic
926508514 2:13745019-13745041 AGGGCAAGATGAAGCAGGGTGGG + Intergenic
927153319 2:20208000-20208022 AGCTCAAGATGGGGCAGGGATGG + Intronic
927222693 2:20728637-20728659 ATTGCAAGAGGAGGCAGGGGTGG + Intronic
927841933 2:26450273-26450295 AGTAGAGGAAGAGGCAGGGGTGG - Intronic
928027740 2:27753626-27753648 AATCCCAGATGAGCCAGGGAAGG - Intergenic
928462290 2:31485909-31485931 AGTCCAAGGTGAGCAGGGGGCGG - Intergenic
928462610 2:31489235-31489257 AGGGCAAGCTGAAGCAGGGGGGG + Intergenic
928652151 2:33414529-33414551 AGCCCAAGATGAGGCTGAGAAGG - Intergenic
929026570 2:37610139-37610161 AGTCCAAGATGAGGTCTGAGGGG - Intergenic
930542767 2:52728213-52728235 AGTACAATAGGAGGCAGGGAGGG - Intergenic
931870115 2:66447064-66447086 AGTCAGGGATGAGGCAGGGAGGG + Intronic
932755512 2:74406019-74406041 AGATCAATATGAGGCAGGAGAGG + Intergenic
933400782 2:81794422-81794444 AGTTCAAGATGAGGTTTGGGTGG - Intergenic
933560191 2:83877855-83877877 AATCCTGGATGAGGCAGTGGAGG - Intergenic
933761325 2:85674201-85674223 AAGCCAAGAAGAGGCAGGGAAGG + Intergenic
936458117 2:112691051-112691073 AGTCCATGAGGTGGCAGTGGTGG - Intergenic
936463001 2:112725469-112725491 AGTCCAAGAAGCGTCAGGGCTGG + Exonic
937000053 2:118457576-118457598 AGGGCAAGCTGAAGCAGGGGGGG - Intergenic
937093222 2:119220411-119220433 AGTCAGAGCTGAGGCAGGGCAGG - Intergenic
938480203 2:131657027-131657049 AGTCCAGGGAGAGGCAGGGGTGG + Intergenic
938820713 2:134956554-134956576 AGTGCAAGATGAGGGAGGGAAGG + Exonic
939687996 2:145223472-145223494 AGTTCAAGATGAGGTTTGGGTGG - Intergenic
939962851 2:148581103-148581125 AGCCCCGGATGAAGCAGGGGAGG + Intergenic
941693590 2:168527554-168527576 AGTTTAAGATCAGGCAGTGGCGG + Intronic
946066916 2:216995878-216995900 AGTCCAAGTTTAGGGTGGGGAGG + Intergenic
946279589 2:218657205-218657227 AGTGGGAGATGAGTCAGGGGAGG - Intronic
947275875 2:228391216-228391238 AGGGCAAGCTGAAGCAGGGGGGG - Intergenic
947835541 2:233172249-233172271 AGTTTAAGTTGAGGCAGAGGAGG + Intronic
948098379 2:235354541-235354563 AGTCCAAGTGAAGCCAGGGGTGG - Intergenic
948175705 2:235940942-235940964 AGTCCAAGTGGTGGCAGGGGTGG + Intronic
1168754665 20:308087-308109 AGGCCCAGAGGAGGCAGGGCTGG - Intergenic
1168927849 20:1597858-1597880 AGTCCAAGACGATGGAGGAGAGG + Intronic
1169217893 20:3803978-3804000 AACCCAGGAGGAGGCAGGGGTGG - Intronic
1169440222 20:5627644-5627666 AGTGCAATATGAGGAAGAGGAGG + Intergenic
1169653934 20:7901173-7901195 AGTGCAAGATGAAGCAGCTGAGG + Intronic
1170472448 20:16681791-16681813 AGTCTGACATGAAGCAGGGGAGG + Intergenic
1171883758 20:30636749-30636771 AGTGAAAGATGAGGGTGGGGGGG - Intergenic
1172098874 20:32473948-32473970 AGTCCACGTGGAGGCCGGGGTGG + Intronic
1172622942 20:36331517-36331539 AGTCCAGGCTGAGGCTGGGTCGG - Intronic
1172811464 20:37651146-37651168 AGTCCAAGGTCAAGCAGGTGGGG + Intergenic
1173583868 20:44166954-44166976 AGTCCAAGATGAGGCAGGGGAGG - Intronic
1174954768 20:55085410-55085432 AAACCAAGATGAGGCTGGAGAGG + Intergenic
1175161710 20:57012721-57012743 AGACAAGGAAGAGGCAGGGGTGG + Intergenic
1175389874 20:58620294-58620316 TGCCCAGGATGAGGCTGGGGTGG + Intergenic
1175665231 20:60852947-60852969 AGGCCAAGAAGAGGGAGGAGGGG + Intergenic
1175835397 20:61990605-61990627 AGTCAAACCTGGGGCAGGGGAGG + Intronic
1177656848 21:24028120-24028142 AGTTCAGGATGGGGCAGGGATGG - Intergenic
1179299290 21:40091936-40091958 AATCCAAGATGAGACTTGGGTGG + Intronic
1179553881 21:42160314-42160336 AGTAGAAGAAGAGGCAGAGGAGG - Intergenic
1179590223 21:42403228-42403250 TTTCCAAAATGAGGCGGGGGTGG - Intergenic
1179647873 21:42786224-42786246 AGGCCAAGGCGAGGCAGGTGGGG + Intergenic
1180481354 22:15759568-15759590 AGTCCAGGGTTAGGCAGGGGTGG + Intergenic
1180783827 22:18536063-18536085 TGTGCAAGATGTGGCAGGCGAGG - Intergenic
1181008448 22:20025973-20025995 AGTCCAGGATGTGGCTGAGGTGG + Intronic
1181038936 22:20182889-20182911 AGGACAAGGGGAGGCAGGGGTGG + Intergenic
1181127396 22:20710112-20710134 TGTGCAAGATGTGGCAGGCGAGG - Intronic
1181240727 22:21475415-21475437 TGTGCAAGATGTGGCAGGCGAGG - Intergenic
1181421644 22:22803403-22803425 AGTCCTTGAAGAGGAAGGGGAGG - Intronic
1182502006 22:30754699-30754721 ACCCCAAGATGAGGCCGGCGGGG - Intronic
1183051490 22:35265508-35265530 AGGCCAGGAAGTGGCAGGGGAGG - Exonic
1183501362 22:38181551-38181573 AGTTCGAGATGAGACACGGGCGG + Intronic
1183756801 22:39774708-39774730 AGCACAAGATGAGGCAAGAGAGG - Intronic
1183860377 22:40665571-40665593 AGTCCAACATTAGGCAGAAGTGG - Intergenic
1184119338 22:42440166-42440188 AGGGCAAGATGAGGAAGAGGTGG + Intergenic
1184460120 22:44633180-44633202 AGTGAGAGATGAGGCAGGAGAGG - Intergenic
1184788260 22:46682444-46682466 GGTACAAAATGAGTCAGGGGAGG + Intergenic
949426588 3:3923636-3923658 AGAGCATGATGAGGGAGGGGTGG - Intronic
951370040 3:21834705-21834727 AGTCCAAGATGAGATTTGGGTGG - Intronic
952192705 3:31041159-31041181 AGTGCAAAAAGAGGCAGGAGAGG + Intergenic
953910917 3:46892688-46892710 GGACCCAGAGGAGGCAGGGGAGG - Intronic
954439518 3:50514102-50514124 AGTCCAATAAGGGGCAGGGGAGG - Intergenic
954984482 3:54777647-54777669 AGCCCAAGATGAAGCAAGGCTGG + Intronic
955277140 3:57557035-57557057 AGTCCAAGAAGAAGAAGGTGAGG - Exonic
955343219 3:58141756-58141778 AGTTCAAGATGGAGCAGTGGGGG + Intronic
955967242 3:64401145-64401167 AGTCAAAGGTGAGGAAGGAGTGG - Intronic
956112263 3:65881420-65881442 AGTCCAAGACTAGGCTGGGCAGG + Intronic
956181738 3:66523830-66523852 AGTTCATGATGAGGGTGGGGTGG - Intergenic
957332651 3:78786516-78786538 AGTTCAAGATGAGATTGGGGTGG - Intronic
957674912 3:83354263-83354285 AGTCCAAAAAGAGTCAGGGAAGG + Intergenic
957837214 3:85611480-85611502 AGTTCAACTTGAGGCAGGGGTGG - Intronic
959097455 3:101971394-101971416 AGGGCAAGATGAAGCAGGGCAGG - Intergenic
959817450 3:110691605-110691627 AATTTAAGATGAGGCAGAGGTGG - Intergenic
961650156 3:128413173-128413195 AGTCCGAGCTGAGGCCTGGGAGG + Intergenic
961987615 3:131154320-131154342 GGACCAAGATGAGGCAAGTGAGG + Intronic
962500029 3:135981836-135981858 AGTACAAGATGAGGTCAGGGAGG + Intronic
962580194 3:136791146-136791168 AGCACAAGATGAGGCTGGAGAGG - Intergenic
962709997 3:138078211-138078233 AGTCCAAGGTGAGTCAGGGAAGG + Intronic
963773668 3:149416307-149416329 TGGACAAGATGAGGCAGGAGAGG + Intergenic
965230294 3:166042125-166042147 AGTACAAAATGAGCCAGGTGTGG + Intergenic
965955500 3:174364203-174364225 AGAACCTGATGAGGCAGGGGTGG - Intergenic
966823293 3:183942193-183942215 AGTCCAAAATTAGCCAGGTGTGG - Intronic
968615635 4:1576657-1576679 AGTCGAAGAGGCGGCAGCGGTGG + Intergenic
969454585 4:7294196-7294218 AGCCCATGATGAGGCAGTGCCGG + Intronic
969650568 4:8465405-8465427 AGTCAAAGAAGCAGCAGGGGAGG - Exonic
970815432 4:20150629-20150651 AGTCCAAGATGAGATTTGGGTGG + Intergenic
970847020 4:20552523-20552545 AGTCCTTGATGTGACAGGGGAGG - Intronic
971520777 4:27547564-27547586 AGTCCAAGATTAGGCACCAGTGG + Intergenic
972006347 4:34112881-34112903 GGTGGAAGAGGAGGCAGGGGAGG + Intergenic
972337261 4:38118320-38118342 AGTCTAAGATTAGTCAGGGGTGG + Intronic
973367416 4:49219019-49219041 AGTGAAAGATGAGGGTGGGGGGG - Intergenic
974149223 4:57984264-57984286 TGTCCCAGATGGGGCAGGAGGGG + Intergenic
975753622 4:77550312-77550334 AGTGTAAGATGAAGCAGGGTGGG - Intronic
976750601 4:88448295-88448317 AGTTCAAGATGAGATATGGGTGG + Intergenic
976805133 4:89037673-89037695 AATTCAAGATGAGACATGGGTGG - Intronic
976837117 4:89387237-89387259 AGACCAAAATGAGGCAGCAGTGG + Intergenic
977154391 4:93554954-93554976 AGTGCAAGCTGAAGCAGGGTTGG + Intronic
977339971 4:95745166-95745188 AATTCAAGATGAGACATGGGTGG - Intergenic
978046118 4:104129974-104129996 ATTCCAAGATAAGGCAGGTTTGG + Intergenic
978277231 4:106966917-106966939 AGTTCAAGATGAGACTTGGGTGG + Intronic
980004335 4:127524136-127524158 AGTACAGGGTGAGGCAGTGGAGG + Intergenic
980984723 4:139684336-139684358 AATTCAAGATGAGACTGGGGTGG + Intronic
981470779 4:145132112-145132134 AATCCCAGCTGAGGCAGGAGAGG - Intronic
982940691 4:161550084-161550106 AGAGAAAAATGAGGCAGGGGAGG + Intronic
984975628 4:185227902-185227924 AGTCCAAGCGCAGGCAAGGGAGG + Intronic
985714497 5:1447765-1447787 AGTCGGGGTTGAGGCAGGGGTGG - Intergenic
985747361 5:1654862-1654884 AGAGCAAGGTGGGGCAGGGGTGG + Intergenic
986128641 5:4906924-4906946 AGTCCAGGATGAAGAAGGGGAGG - Intergenic
987155881 5:15089351-15089373 AGACCAGGATGAGGCAGGCAGGG + Intergenic
987196472 5:15531810-15531832 TGTCCTAGAAAAGGCAGGGGAGG - Intronic
987252874 5:16118395-16118417 GTTCCAATAAGAGGCAGGGGGGG + Intronic
988118053 5:26921649-26921671 ACTCAAAGATGAGGCAGAGCAGG - Intronic
988927491 5:36004264-36004286 AGGACAACTTGAGGCAGGGGTGG - Intergenic
990428985 5:55716464-55716486 AATTCAAGATGAGGTATGGGTGG - Intronic
993567053 5:89489216-89489238 AATCCAAGATGAGATATGGGTGG + Intergenic
993762158 5:91808855-91808877 AATCCAAAAGGAGGCAGGAGAGG + Intergenic
994094696 5:95838497-95838519 AGGGCAAGCTGAGGAAGGGGTGG + Intergenic
994153252 5:96474039-96474061 AGGCTGAGATGAAGCAGGGGAGG + Intergenic
994296077 5:98089839-98089861 AGTTCAAGATGAGATATGGGTGG + Intergenic
994520914 5:100833848-100833870 AGTGCAAGATGAGTGAGGAGTGG - Intronic
995569368 5:113463193-113463215 AGGGCAAGATGAGGTAGGAGAGG + Intronic
995931705 5:117454600-117454622 ATTTCAAGATGAGACATGGGTGG - Intergenic
996237030 5:121142738-121142760 AATTCAAGATGAGGTATGGGTGG + Intergenic
996859056 5:128044069-128044091 AGGGCAAGATGAAGCAGGGCAGG + Intergenic
997586533 5:135046998-135047020 AATCCAACAGGAGGCAAGGGAGG - Intronic
997743556 5:136278898-136278920 AGTGGAAGACGAGTCAGGGGAGG - Intronic
998146697 5:139733337-139733359 AGACCACGCTGAGGCAGCGGAGG - Intergenic
998483916 5:142485446-142485468 AGTCCAAGAGGAGGTGGTGGAGG - Intergenic
999244259 5:150144890-150144912 AGGCCCAGATGGGGCCGGGGTGG - Intronic
999288259 5:150407017-150407039 AGACCCAGATGAGGAAGGGCTGG + Intronic
999806526 5:155086498-155086520 AGTGCAAGATTAGGCAGAGCTGG + Intergenic
1000946974 5:167435241-167435263 AGTTCAAGATGAGACTTGGGTGG - Intronic
1001805161 5:174578091-174578113 AGTCCCAGAGGAGGCTGAGGTGG + Intergenic
1002106752 5:176883062-176883084 AGGCCAAGATCAGGAAGGAGTGG - Intronic
1002690140 5:181044775-181044797 GGTCATAGATGAGGAAGGGGTGG + Intronic
1002809966 6:618646-618668 TGTCCAAGATGAGGAAAGGTTGG - Intronic
1002820907 6:723878-723900 AGTCCAGGCTGAGACAGGGAGGG - Intergenic
1003472555 6:6450811-6450833 AGTCCAAGATGGGGCTAGGGTGG - Intergenic
1005444568 6:25908504-25908526 AAACCAAGATGAGGCAAGTGAGG - Intergenic
1005833165 6:29687170-29687192 AGCCCAAGGAGACGCAGGGGAGG + Intergenic
1006461966 6:34164721-34164743 AATACAAAATGAGGCAGGCGTGG + Intergenic
1008051890 6:46908668-46908690 AGTCTCAGCAGAGGCAGGGGTGG - Intronic
1008451910 6:51661597-51661619 AGTCCAAGTTGAGGATGGTGAGG + Intronic
1009950791 6:70393554-70393576 AGTTCAAGATGAGGTTTGGGTGG - Intergenic
1010255189 6:73749352-73749374 AGTCCAAGATAGGGCTGGAGGGG + Intronic
1011129877 6:84041999-84042021 AGTTCAAGATGAGACGGGTGGGG - Intronic
1011774918 6:90718899-90718921 AGTCCAAGATGAATCAGAGCAGG - Intergenic
1012032775 6:94093786-94093808 TGTGGAAGGTGAGGCAGGGGAGG - Intergenic
1012863322 6:104588264-104588286 AGTCCTAGCTGAGGCTGAGGTGG + Intergenic
1013164121 6:107574688-107574710 GGACCAAGATGAGGCAAGGATGG - Intronic
1015555891 6:134460957-134460979 AGGTCCAGATGAGGCATGGGAGG + Intergenic
1016923659 6:149318446-149318468 AGTTAAAGATGACTCAGGGGCGG + Intronic
1017119103 6:151007117-151007139 AGACCAAGAGGAGGAAGGAGAGG - Intronic
1017635319 6:156437392-156437414 AGTGCAAGAAGGGGCAGGAGGGG - Intergenic
1017948950 6:159119305-159119327 AGTCCAAGATGAGATTTGGGTGG + Intergenic
1019404661 7:877178-877200 AGACCAAGGTGGGGCGGGGGAGG - Intronic
1019604614 7:1902166-1902188 ATTCCAGGAGGAGGCAGGTGTGG - Intronic
1020262282 7:6537022-6537044 AGTCCGGGAAGAGGGAGGGGAGG + Intronic
1023488874 7:40715848-40715870 GGTCCAAGAGGAAACAGGGGAGG - Intronic
1024337140 7:48220595-48220617 TGTCCAGGATGGGGCAGGGCTGG + Intronic
1025004350 7:55343198-55343220 AGTCCCAGCTGAGGCTGGGAGGG - Intergenic
1025806541 7:64838652-64838674 AATCCTGGATGAGGCAGCGGAGG - Intergenic
1026455927 7:70572436-70572458 AGTCTAAGAGAAGGCAGGGATGG + Intronic
1027442542 7:78235399-78235421 AGTTCAAGATGAGACTTGGGTGG - Intronic
1028116447 7:87002904-87002926 AGTCCAGGATGTAGCATGGGAGG - Intronic
1028224078 7:88229535-88229557 TTTCCAAGATGGGGCAGGGTGGG - Intergenic
1028830505 7:95322677-95322699 AGCCCAAGTTGGGGTAGGGGAGG + Intronic
1029458205 7:100681607-100681629 AGCACAGGAAGAGGCAGGGGCGG - Exonic
1029477312 7:100792612-100792634 AGCCCGAGATGAGGCAATGGTGG - Intronic
1029646536 7:101860315-101860337 ATTCCAGGAGTAGGCAGGGGCGG - Intronic
1030722479 7:112885594-112885616 AGTCCAGGCTGAGGCTGAGGTGG - Intronic
1030881514 7:114886203-114886225 ATCCCCAGATGATGCAGGGGAGG + Intergenic
1032949527 7:136891624-136891646 AGTTCAAGATGAGACTGGGGAGG - Intronic
1033031075 7:137827355-137827377 AGTGGAAGATAAGGCAGGGAAGG - Intronic
1033222859 7:139540228-139540250 CGCCAAAGCTGAGGCAGGGGAGG + Intronic
1034412025 7:150946888-150946910 AGTCCAAGGTGAGGGTGGGGAGG + Exonic
1034734070 7:153412646-153412668 AATCCTGGATGAGGCAGCGGAGG - Intergenic
1035254045 7:157614830-157614852 GGTCCAGGATGTGGCAGGGCTGG - Intronic
1035452283 7:158985186-158985208 AATTCAAGATGAGGTTGGGGTGG + Intergenic
1035486073 7:159227007-159227029 AGTCCAGGATGAGGGATGGAGGG - Intergenic
1035608520 8:945534-945556 AGACAAAGATGGGGCAGGGAGGG - Intergenic
1036387579 8:8295499-8295521 AGGCCAAGGTGAGGCTGTGGGGG - Intergenic
1036611328 8:10352435-10352457 AGTTGAAGAGGAGGCAGGGAGGG + Intronic
1036772689 8:11589993-11590015 ACTACAGGATGAGGCAGTGGGGG - Intergenic
1037333744 8:17771267-17771289 GGTCAATGATGAGGAAGGGGAGG + Intronic
1037514774 8:19619475-19619497 AGTCCATGATGTGGCTGGGCTGG + Intronic
1037759639 8:21733348-21733370 AGCCCAAGATCAGGGAGAGGAGG + Intronic
1038237931 8:25779241-25779263 AGTTCAAGATGAGACATAGGTGG + Intergenic
1038546309 8:28428133-28428155 CGTCCAAGATCTGGCAGGGTTGG - Intronic
1038617108 8:29105073-29105095 ATTCGAGGCTGAGGCAGGGGAGG - Intronic
1039836405 8:41259610-41259632 ACTCCAAAAGGAGGAAGGGGTGG + Intergenic
1041468259 8:58179897-58179919 AGTCCAAGTTGTGGCAGGAATGG + Intronic
1041499421 8:58523776-58523798 AATTCAAGATGAGCCAGTGGTGG - Intergenic
1042143858 8:65707066-65707088 AGTGCAGGGGGAGGCAGGGGCGG - Exonic
1043275691 8:78389382-78389404 AGTCCAAGATGAGATTTGGGTGG + Intergenic
1043345934 8:79297522-79297544 AGTTCAAGATGAGATTGGGGTGG - Intergenic
1044816116 8:96115165-96115187 ACTCCAAGATGGAGCAGGAGAGG - Intergenic
1046281647 8:112041057-112041079 TGTAAAAGATGAGGCAGGAGAGG + Intergenic
1046773450 8:118139059-118139081 AGACCAAGTGGAGGCAGAGGTGG + Intergenic
1046983367 8:120360936-120360958 AGTTGCAGAGGAGGCAGGGGTGG - Intronic
1048280412 8:133101533-133101555 AGCCCCAGATGGGGCAGGAGGGG - Intronic
1049023156 8:139971264-139971286 AGTCCAGGGTGAGGCTGGAGGGG - Intronic
1049198152 8:141326580-141326602 AGTCGAGGAGGAGGCAGAGGAGG + Intergenic
1049387058 8:142348424-142348446 AGTCCAAGAGGAAGCACGGCTGG + Intronic
1049408451 8:142461938-142461960 AGCGCAAGGTGAGGCTGGGGAGG + Intronic
1050221045 9:3390539-3390561 AATTCAAGATGAGGCTTGGGTGG - Intronic
1050722291 9:8604496-8604518 AGTCCAAGATGAGGCCAGCAAGG + Intronic
1051465230 9:17369039-17369061 AATTCAAGATGAGTCTGGGGTGG - Intronic
1052266121 9:26575745-26575767 AGTCCAGGATGAAGGAGTGGTGG + Intergenic
1052978905 9:34432805-34432827 ACTCAAAAATGGGGCAGGGGCGG + Intronic
1055041268 9:71875913-71875935 TGCACAAGATGAGGCAGTGGTGG + Intronic
1055202735 9:73686047-73686069 AGTCCCAGATGAGGAGGGTGAGG + Intergenic
1055205467 9:73724115-73724137 AGTGAAAGAGGAGGCAGGAGAGG - Intergenic
1057475546 9:95398069-95398091 AGGCCAGGAAGAGGCAGTGGTGG + Intergenic
1057804635 9:98211452-98211474 AGTTCAAGGTGAGGTAGGGTTGG - Intronic
1058302863 9:103398325-103398347 AGGACAATATGAGGCAGGGTTGG + Intergenic
1058528630 9:105884964-105884986 TGTCCAACATGAGGGAGTGGTGG - Intergenic
1059363475 9:113766779-113766801 AGTTCAAGATGAGGTTTGGGTGG - Intergenic
1060676466 9:125519779-125519801 AATCCATGAGGAGGCTGGGGCGG - Intronic
1061151828 9:128833193-128833215 AGGCCAAGATGAGCCAGGGAAGG + Exonic
1061194831 9:129102126-129102148 AGGCCAGGAGGAGGCAGGTGTGG - Intronic
1061494162 9:130962224-130962246 AGGCCAAGATGAAGCATGAGAGG + Intergenic
1061936822 9:133862421-133862443 AGTCCCTGAGGAGGCAGGTGCGG + Intronic
1062359778 9:136182246-136182268 TGCCCCAGATGAGGCAGGGCCGG - Intergenic
1062474028 9:136718851-136718873 AGGCCCAGATGTGGCAGTGGAGG + Intronic
1062600483 9:137316761-137316783 AGTCTAAGAGGAGGCCGCGGTGG + Intronic
1186688150 X:11947114-11947136 AATCCAACTTGTGGCAGGGGTGG - Intergenic
1188402161 X:29758884-29758906 AGCCCAAGAGGAAGCATGGGTGG - Intronic
1189052934 X:37665384-37665406 GGCCCAAGATGAAGCAGGGAGGG - Intronic
1189217636 X:39340605-39340627 CGTCCAAGATGAGCCATTGGAGG - Intergenic
1189744000 X:44151087-44151109 AGTCTAGGAAGAGGCAGGGAAGG + Intronic
1190730341 X:53221733-53221755 GGTACAGGAAGAGGCAGGGGAGG + Intronic
1191674443 X:63779567-63779589 AATTCAAGATGAGACTGGGGTGG + Intronic
1192440737 X:71171570-71171592 AGTCCAAGGTGAGGGCAGGGTGG - Intergenic
1194498493 X:94649806-94649828 AGGCCAAGTTAAGGCAGAGGTGG + Intergenic
1194793034 X:98174459-98174481 AGTCCAAGATTAGGCAAAGGTGG - Intergenic
1194875919 X:99187630-99187652 AATCCAAGATGAGATATGGGTGG - Intergenic
1195762476 X:108261710-108261732 GGATCAAGAGGAGGCAGGGGAGG + Intronic
1196102795 X:111865223-111865245 AGTTCAAGACCAGGCTGGGGGGG - Intronic
1196767031 X:119255731-119255753 AGTACAAAATGAGCCAGGTGTGG - Intergenic
1197741533 X:129898440-129898462 AGTGAAAGAGGAGGCAGGGGTGG + Intergenic
1198188607 X:134281025-134281047 AATCCAAGATGAGATATGGGTGG - Intergenic
1199185630 X:144911860-144911882 AGTTCAAGATGAGATATGGGTGG + Intergenic
1199627944 X:149757951-149757973 AGTCTAAGATGGGGGCGGGGTGG + Intergenic
1199628709 X:149761839-149761861 AGTCTAAGATGGGGGCGGGGTGG + Intergenic
1199685427 X:150260970-150260992 AGCCCAAGAGGAGGCCTGGGAGG + Intergenic
1199929654 X:152505770-152505792 AGTTCAAGATGAGACTTGGGAGG + Intergenic
1201770147 Y:17611204-17611226 AATCCTGGATGAGGCAGTGGAGG + Intergenic
1201831407 Y:18294783-18294805 AATCCTGGATGAGGCAGTGGAGG - Intergenic