ID: 1173583869

View in Genome Browser
Species Human (GRCh38)
Location 20:44166957-44166979
Sequence AGCAGTCCAAGATGAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583869_1173583874 6 Left 1173583869 20:44166957-44166979 CCCCTGCCTCATCTTGGACTGCT 0: 1
1: 0
2: 0
3: 29
4: 270
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583869_1173583875 7 Left 1173583869 20:44166957-44166979 CCCCTGCCTCATCTTGGACTGCT 0: 1
1: 0
2: 0
3: 29
4: 270
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583869_1173583876 8 Left 1173583869 20:44166957-44166979 CCCCTGCCTCATCTTGGACTGCT 0: 1
1: 0
2: 0
3: 29
4: 270
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583869 Original CRISPR AGCAGTCCAAGATGAGGCAG GGG (reversed) Intronic
900033463 1:387932-387954 AGCAGGCCCAGATGAGGGAAGGG + Intergenic
900054301 1:617821-617843 AGCAGGCCCAGATGAGGGAAGGG + Intergenic
900684999 1:3942670-3942692 AGAAGTCCAAGATGAAGGTGTGG - Intergenic
901223227 1:7595979-7596001 AGGAAGCCAAGAGGAGGCAGAGG - Intronic
901845499 1:11979789-11979811 AGCAGTCCCAGGAGAGGGAGAGG - Intergenic
902269978 1:15296783-15296805 AGCAGGACAAGGTGAGGGAGGGG + Exonic
903225845 1:21893956-21893978 AGAAGAACAGGATGAGGCAGAGG + Intronic
905386153 1:37605767-37605789 AGTCCTCCAAGATGAGACAGTGG + Intergenic
905632200 1:39525072-39525094 AGAGGTCCAAGCTGAGCCAGGGG + Intronic
906319388 1:44807025-44807047 CACAGTCCAGGCTGAGGCAGAGG - Intergenic
907398741 1:54210973-54210995 AGGAGGCAAAGATGAGGCTGGGG - Intronic
907537592 1:55179186-55179208 AGCATTTCAAGAGGAGGGAGTGG - Intronic
907565147 1:55427363-55427385 AGCAGTACAAGAGGAGGAGGTGG - Intergenic
907823195 1:57990676-57990698 AGCAGTGTGAGAGGAGGCAGTGG + Intronic
908026168 1:59953806-59953828 AGCAGTGGAAGATGAGCCTGTGG + Intergenic
908596126 1:65690517-65690539 AGCAGTGGAAGAAGATGCAGGGG + Intergenic
909096784 1:71297254-71297276 AGCAGTGCCAAATGTGGCAGAGG + Intergenic
910251730 1:85204876-85204898 AGCAGGGCAAGTTGAGGCAGAGG + Intergenic
911121926 1:94304996-94305018 AGCAACCAGAGATGAGGCAGTGG + Intergenic
911272018 1:95813532-95813554 AGCTGTCCAAGATGAAACAATGG + Intergenic
912632605 1:111258895-111258917 AGGAATCCAAGATGAAGAAGTGG - Intergenic
913270612 1:117089479-117089501 AGGAGTTCAAGATTAGCCAGGGG + Intronic
915235303 1:154476056-154476078 AGCAGTCCAGGACGGTGCAGTGG + Intronic
916747232 1:167693936-167693958 AGCAGGCCATGATGGGACAGTGG + Intronic
917533171 1:175855208-175855230 TGAAATCCAAGATGAGGCATTGG + Intergenic
918071316 1:181135112-181135134 AGCAGCCCAGCATGAGGCTGAGG + Intergenic
918095807 1:181333158-181333180 AGCAATTCACGGTGAGGCAGTGG + Intergenic
920912752 1:210233286-210233308 AGCAGCCCTAGAGGAGGCGGCGG - Intronic
922255818 1:223892086-223892108 AGCAGGCCCAGATGAGGGAAGGG + Intergenic
922505961 1:226125776-226125798 AGCAGCTCAAGCTCAGGCAGAGG + Intergenic
923334215 1:232952878-232952900 AGCCCTCCAAGATGAGTCATGGG - Intronic
923478434 1:234359270-234359292 AGACATCCAATATGAGGCAGTGG - Intergenic
924337018 1:242994951-242994973 AGCAGGCCCAGATGAGGGAAGGG + Intergenic
924653780 1:245954309-245954331 TGCAGATCAAGATGAGCCAGAGG + Intronic
1063448677 10:6136591-6136613 AGCAGTCCAAGGGGAGGCAAGGG + Intergenic
1064253034 10:13721524-13721546 AGCAGTCCAGGATAAAACAGAGG + Intronic
1066557392 10:36629245-36629267 AGCAGTCCAAATTGATGAAGAGG + Intergenic
1067668861 10:48301787-48301809 GGCAGCCCAAGCTAAGGCAGTGG + Intergenic
1067746682 10:48941464-48941486 AGAAGGCCGAGATGTGGCAGGGG + Intronic
1069618166 10:69819520-69819542 GTCAGTCCAATTTGAGGCAGAGG + Intronic
1069802107 10:71088185-71088207 AGGAGTTGAAGATGACGCAGAGG + Intergenic
1072316766 10:94211035-94211057 CGGAGTCCAAGAGGTGGCAGTGG - Intronic
1073096546 10:100983672-100983694 AGGAGGCCAGGATGAGGCAGAGG - Exonic
1076502305 10:130946846-130946868 AGAAGCCCAAGATGAGGAATGGG + Intergenic
1076524562 10:131103481-131103503 AGGAGTTCAAGATGAGCCTGGGG + Intronic
1077231890 11:1461418-1461440 AGCCGCCCCAGATGAGGCAAGGG - Exonic
1078179738 11:9001505-9001527 AGGAGTCCAAGAAAAGGGAGAGG - Intronic
1078239191 11:9514771-9514793 AGCAGTGGAAGATGAGCCTGGGG + Intronic
1078360272 11:10662592-10662614 AGCATTCCAAGCGGAGCCAGAGG - Intronic
1080214231 11:29823004-29823026 AGAAGTGCTAGATGAGCCAGAGG - Intergenic
1081452356 11:43183751-43183773 AGCAGTCCAAGATCAGGTATTGG - Intergenic
1082741808 11:56919045-56919067 TGCAGTCCAGGATGAGGCTGTGG + Intergenic
1083222967 11:61265327-61265349 AGGAGTCCATGGTGGGGCAGTGG + Intronic
1083318300 11:61829410-61829432 AGGAGTGCAAGATGAGGGAAGGG - Intronic
1083717726 11:64587918-64587940 AGCATTCCAAGAAGAGGTACAGG + Intergenic
1084213535 11:67634727-67634749 TGCACCCCAAGGTGAGGCAGGGG - Intronic
1084415910 11:69032892-69032914 AGCAGTCCACGGTGGGCCAGGGG - Intergenic
1084421555 11:69063072-69063094 CGCAGTCCAAGATGAGACTCCGG - Intronic
1085895991 11:80639931-80639953 AGCGATCCAAGATAAGACAGAGG - Intergenic
1086879327 11:92135166-92135188 AGCAGTACAAGATGTGACATTGG + Intergenic
1087101234 11:94367232-94367254 AGCATTACAGGATGAGGCACAGG + Intergenic
1088014869 11:105046096-105046118 AGCCATCCAAGATGAGTGAGTGG - Intronic
1088801398 11:113310627-113310649 AGCAGTGCAAGATGAAGCAAGGG - Intergenic
1089532378 11:119138884-119138906 TGAAGACCAAGATCAGGCAGGGG + Intergenic
1089627545 11:119761292-119761314 AGCAGGCAGAGATTAGGCAGGGG - Intergenic
1089832764 11:121343273-121343295 TGCAGTCCCAGCTGAGGCTGAGG - Intergenic
1089916755 11:122164598-122164620 ACATTTCCAAGATGAGGCAGAGG + Intergenic
1090153352 11:124409013-124409035 AGAATTCCGAGATGAGCCAGTGG - Intergenic
1091483005 12:854158-854180 AGCAGTTCAAGATTAGCCTGGGG + Intronic
1092488976 12:8927402-8927424 AGAAGTGGAAGAGGAGGCAGTGG + Intronic
1093600855 12:21020512-21020534 AGCAATGCAAGATGAAGCTGTGG - Intronic
1094784525 12:33830958-33830980 TGCAGTCAAGAATGAGGCAGAGG - Intergenic
1095421885 12:42032452-42032474 AGAAGTCCAAGATTAGGGTGCGG - Intergenic
1096443856 12:51670485-51670507 AACAGTGGAAGATGAGGCTGGGG + Intronic
1096607322 12:52776197-52776219 AGCTGTCCATGCTGGGGCAGAGG - Intronic
1098063330 12:66585919-66585941 AGCAGTCTTTGAAGAGGCAGGGG - Intronic
1098459880 12:70720870-70720892 TGGAGTCGAAGATGAGGGAGTGG - Intronic
1098611527 12:72464355-72464377 AGAAGTCCAAGATACGGCACAGG + Intronic
1098625513 12:72660882-72660904 AGCCCTCTAAGGTGAGGCAGGGG + Intronic
1099871159 12:88350928-88350950 AGCACTGCAAGAACAGGCAGGGG - Intergenic
1100882963 12:99038762-99038784 AGCACTCCAGGCTGAGGGAGCGG - Intronic
1104112471 12:125716884-125716906 ATCATTCCAAGCTGAGGCAAGGG + Intergenic
1104394038 12:128415989-128416011 AGAAGCCCAAGAAAAGGCAGGGG + Intronic
1105326375 13:19373991-19374013 AGCCACCCAAGATGAGGCAAAGG - Intergenic
1105705665 13:22966184-22966206 AGAGGTCCAAGAACAGGCAGAGG + Intergenic
1105858568 13:24391169-24391191 AGAGGTCCAAGAACAGGCAGAGG + Intergenic
1111782436 13:92744933-92744955 TGCAGTACAAAATGAGGCAGTGG - Intronic
1112253885 13:97809781-97809803 AGGAGTCCAAGAAGAGGCTCAGG + Intergenic
1112473612 13:99711277-99711299 GGAGGTCCAAGATCAGGCAGTGG + Intronic
1112719696 13:102229563-102229585 AGCAGCCCATGTTGAGGTAGAGG - Intronic
1113095992 13:106664111-106664133 AGCAGTCCTTGTTGAGGAAGGGG - Intergenic
1114556767 14:23566700-23566722 GGCAGACCAGGAAGAGGCAGGGG + Intronic
1114617478 14:24075963-24075985 AGCAGCCCAAGTTGGGGCAGTGG - Intronic
1119824838 14:77649029-77649051 AGAAGTCTCAGATGAAGCAGAGG + Intergenic
1121709522 14:96027242-96027264 AGCAGTGGGACATGAGGCAGTGG + Intergenic
1122988477 14:105224844-105224866 AGCAGTCTAAGACTAGGGAGTGG - Intronic
1124793596 15:32753870-32753892 GGAAGTCCAAGATCAGGGAGGGG - Intergenic
1125773266 15:42186969-42186991 AGCAGTCCATGATGATCCACTGG + Intronic
1126591692 15:50346675-50346697 AGAAGTCCAAAATAAGGCACTGG + Intronic
1128605427 15:69033244-69033266 TGCAGTCGAAGTTGAGGCACTGG - Exonic
1128753780 15:70167162-70167184 AGCACTGAAAGATGAGGCTGGGG - Intergenic
1129328270 15:74813280-74813302 AGGGGTCCAAGGAGAGGCAGAGG - Intronic
1129653086 15:77505300-77505322 AGCTGCCCAAGCTGAGGCTGAGG - Intergenic
1132057489 15:98663232-98663254 AGCAGTCCCAGTTGATGGAGAGG + Intronic
1132397104 15:101482156-101482178 AGCAGTAGAAGGTGAGTCAGAGG + Intronic
1133982480 16:10643510-10643532 TGCTGTCCAACATGAGGCCGAGG + Intronic
1135433385 16:22406698-22406720 AGCAGTCCCAGCTGAGGCTGAGG + Intronic
1136590873 16:31216945-31216967 AGAAGTTCAAGATGAAGCTGGGG - Exonic
1138004769 16:53322468-53322490 AGTAGTCCCAGCTGAGGCTGAGG + Intronic
1138132255 16:54490524-54490546 AGCGGTCCAGGCTGGGGCAGTGG + Intergenic
1139496364 16:67322123-67322145 AGCAATCCAAGATGATTCAATGG + Intronic
1139527261 16:67524686-67524708 AGACATCCCAGATGAGGCAGGGG - Intronic
1140464146 16:75165829-75165851 AGGAGTCCCAGCAGAGGCAGTGG - Intronic
1140861536 16:79022716-79022738 GGGAGGCCAAGAAGAGGCAGTGG + Intronic
1142264600 16:89057924-89057946 AGCTGTCCAGGAGGAGGCGGTGG - Intergenic
1142984741 17:3689049-3689071 ACCAGCCGAAGGTGAGGCAGAGG - Intronic
1143850226 17:9805667-9805689 AGCATTCCAAGATAAGGGAGTGG + Intronic
1144269555 17:13602517-13602539 AGAAGTCCAAGCTGCTGCAGAGG - Intergenic
1144523479 17:15969906-15969928 ATGAGCCCAAGATGAGGCAGGGG - Intronic
1144585403 17:16484606-16484628 AGCTGACCAAGATCCGGCAGAGG + Intronic
1144784045 17:17822154-17822176 AGCAGCCCAAGAGCATGCAGTGG + Intronic
1148151686 17:45400400-45400422 AGCAGTCAACCAGGAGGCAGGGG + Intronic
1149540058 17:57462015-57462037 AGAAGTCCAAGATAAGGGTGCGG + Intronic
1149739306 17:59029218-59029240 AGAAGTTCAAGATCAGCCAGGGG + Intronic
1150683504 17:67301962-67301984 AGGAGTCCAAGAAGTAGCAGTGG - Intergenic
1151036847 17:70810584-70810606 AGCAGTGCAATATCACGCAGTGG - Intergenic
1151794200 17:76332309-76332331 AGCAGAGCAAGATGAGGAAGAGG - Exonic
1151809527 17:76429769-76429791 AGCACTCCAGGAGCAGGCAGGGG + Intronic
1152588795 17:81200952-81200974 AGCAGACCAAGATAAGGAAACGG - Intronic
1152763609 17:82122763-82122785 AGAAGTCCTGGAGGAGGCAGGGG - Intronic
1155594922 18:27474640-27474662 ATCAGTCCAGGATCAGGCACTGG + Intergenic
1156712322 18:39961993-39962015 AGAACTCCAGAATGAGGCAGGGG + Intergenic
1157618792 18:49003388-49003410 AGGAGTCTAGGAGGAGGCAGGGG - Intergenic
1160402918 18:78624064-78624086 AGCACTGCAAAATGAGGCGGTGG + Intergenic
1160896152 19:1402826-1402848 AGCTGTGCAAGAGGTGGCAGGGG - Intergenic
1161159870 19:2755850-2755872 GGCAGTCCAACAGGAGGAAGTGG + Exonic
1161615595 19:5268523-5268545 AGGAGGCCAAGATGGGGCAAGGG + Intronic
1163544359 19:17932357-17932379 AGCAATCCAGGAAGAGGCACTGG + Intergenic
1164455585 19:28404022-28404044 AGCATTCCAGGAAGAGGCAGTGG - Intergenic
1166533005 19:43553620-43553642 CCCAGACAAAGATGAGGCAGAGG - Exonic
925021682 2:574742-574764 AGCAGTGCAAGGTGAGGCACGGG + Intergenic
926163685 2:10505152-10505174 AGGAGTCCAGGCTGAGGCACAGG - Intergenic
926499877 2:13641139-13641161 AGCAGGCCAAGGTGGGGCAAGGG - Intergenic
927151483 2:20198800-20198822 AGGAGAGCAAGGTGAGGCAGGGG + Intergenic
927226060 2:20767232-20767254 AGCAGCCCAAGACAAGGCTGTGG + Intronic
929219627 2:39449804-39449826 TGTAGTCCCAGCTGAGGCAGAGG - Intergenic
930114987 2:47710702-47710724 AGGAGGCAAAGATGAAGCAGTGG + Intronic
930353832 2:50292122-50292144 AGCAATGCAAAAAGAGGCAGTGG - Intronic
932109725 2:68987005-68987027 TTCATTCCAACATGAGGCAGAGG + Intergenic
934675794 2:96248887-96248909 AGATGTACAAGATGAGGGAGAGG - Exonic
935518873 2:104078843-104078865 AGCAGCCCAAGTTGCGGCTGTGG - Intergenic
936450456 2:112630077-112630099 AGAAGTCCACAATGAGGCTGGGG + Intergenic
937404470 2:121614081-121614103 AGCACTCCAAGATGACAAAGGGG + Intronic
937835735 2:126468785-126468807 AGCACTTCAAGCAGAGGCAGTGG - Intergenic
940434720 2:153638084-153638106 GGCATTCCAAGAAGAGGGAGGGG + Intergenic
940612333 2:156006940-156006962 AGCAGTCCAAGCTGGGGCTGTGG - Intergenic
941283170 2:163578135-163578157 AGAAGTCCAAGATCAGGATGAGG + Intergenic
941352400 2:164452998-164453020 AGAAGCCCAAGATGACACAGAGG - Intergenic
942123910 2:172804527-172804549 AGCTGTTCAGGATGACGCAGTGG + Intronic
942297953 2:174535390-174535412 GCCAGTCCAGGAGGAGGCAGAGG + Intergenic
942683916 2:178510677-178510699 AGAAATCCAAGATAAGGCACTGG - Exonic
943574515 2:189615354-189615376 AGGAGTCCAAGACTAGCCAGGGG + Intergenic
945811382 2:214554049-214554071 AAGAGTCCAAGATGAGTTAGTGG - Intronic
947841062 2:233208337-233208359 GGCAGCCCAAGGTGGGGCAGAGG - Intergenic
947874959 2:233461762-233461784 AGCAGTGCAAGCAAAGGCAGCGG - Intronic
948888491 2:240895814-240895836 AGTAGTCCACGATGAAGCGGGGG + Exonic
1169708795 20:8537931-8537953 AGCAGTCTATGATGATGCAAAGG - Intronic
1173583869 20:44166957-44166979 AGCAGTCCAAGATGAGGCAGGGG - Intronic
1175965207 20:62656916-62656938 AGCTGACGAAGGTGAGGCAGAGG - Exonic
1177386297 21:20413338-20413360 AGCAGACAAAAATGAGGCAATGG - Intergenic
1178537665 21:33423783-33423805 AGGAGTTCAAGATGAGCCTGGGG + Intronic
1178949531 21:36974803-36974825 AGAAGTCCAAGATGAAGGTGTGG - Intronic
1181008447 22:20025970-20025992 AGAAGTCCAGGATGTGGCTGAGG + Intronic
1181141044 22:20805098-20805120 AGCAGTTCAACACGAGCCAGGGG - Exonic
1181351961 22:22265423-22265445 AGCAGTACAGGAAGAGGCAATGG + Intergenic
1182936651 22:34228989-34229011 AGCAGTCACTGCTGAGGCAGGGG + Intergenic
1184739683 22:46420751-46420773 ATCAGGGCAAGAAGAGGCAGGGG - Intronic
1185319787 22:50195252-50195274 GGCTCTCCAAGCTGAGGCAGGGG + Intronic
950123850 3:10499646-10499668 AGGAGACCAACATGTGGCAGAGG - Intronic
951333477 3:21393220-21393242 AGGTGTCAAAGATGAGGCAGGGG + Intergenic
952428563 3:33200242-33200264 GGAAGTCCAAGATAAGGCACTGG - Intronic
952722334 3:36546336-36546358 CGCAGTGTGAGATGAGGCAGAGG - Exonic
953930971 3:47005477-47005499 AGCAGTCAAAGCTGGGGGAGGGG - Exonic
954292560 3:49657496-49657518 AGCACTGGATGATGAGGCAGTGG - Exonic
954439519 3:50514105-50514127 AGGAGTCCAATAAGGGGCAGGGG - Intergenic
954857971 3:53663164-53663186 AGCAGCACAGGAGGAGGCAGGGG - Intronic
954885627 3:53870770-53870792 AGCAGTCACAGATGGGGTAGAGG - Intronic
955343216 3:58141753-58141775 TGCAGTTCAAGATGGAGCAGTGG + Intronic
955514977 3:59717463-59717485 AGCAGCCCCAGACCAGGCAGAGG + Intergenic
956158674 3:66325094-66325116 AGGAGACCAAGATAAGGCAAGGG - Intronic
957691872 3:83581174-83581196 AGCAGTCCAAGGTCAGGGAGGGG + Intergenic
959817451 3:110691608-110691630 AGAAATTTAAGATGAGGCAGAGG - Intergenic
962066323 3:131984966-131984988 AGCAGCCCAATATAAGACAGAGG - Intronic
962119856 3:132549958-132549980 CACAATCCAAGATGAGGCATTGG - Intergenic
962317393 3:134367408-134367430 GGTAGTCCAAGGAGAGGCAGAGG - Intronic
964197280 3:154079374-154079396 AGGATTCCAGGATGAGGCAGTGG + Intergenic
964413810 3:156427010-156427032 AGGAGTTGATGATGAGGCAGTGG + Intronic
967293328 3:187942868-187942890 AGCAGTGCAGGGTGAGGCAGCGG - Intergenic
967978357 3:195048145-195048167 AGCAGTGCAACAGGATGCAGAGG - Intergenic
968518274 4:1023835-1023857 AGCCCTCCAAGATGAGGCGCCGG + Exonic
968894456 4:3390563-3390585 AGCAGCCCAGGAGGAGGCGGCGG - Intronic
969125745 4:4946513-4946535 AGAAGTCCAAGATCAGGGTGTGG - Intergenic
970172464 4:13303491-13303513 AGAAGTCCAAGAGGGGCCAGAGG - Intergenic
971854812 4:32029669-32029691 AGGAGGCTAAGCTGAGGCAGAGG - Intergenic
972175118 4:36394689-36394711 AGAAGTCCAAGATCAAGCATTGG + Intergenic
976483607 4:85573844-85573866 AGAAGGCAAGGATGAGGCAGAGG - Intronic
977246630 4:94639234-94639256 AGCAGTGTAAGATGAGGTTGTGG + Intronic
977565937 4:98580598-98580620 TGAAGTCCAAGATGAGGAACAGG + Intronic
978330733 4:107610353-107610375 AGCAGTGAGAAATGAGGCAGAGG - Intronic
979240103 4:118440353-118440375 AGCAGGCCCAGATGAGGGAAGGG - Intergenic
981035260 4:140162374-140162396 AGCAGTTCAAGCTAAGGCATAGG + Intergenic
982390919 4:154863039-154863061 AGCAGTCCAAGCTGTACCAGTGG + Intergenic
985497853 5:219639-219661 AAAAGCCCAAGATGCGGCAGGGG - Intronic
985766492 5:1782344-1782366 GGGAGTACCAGATGAGGCAGGGG - Intergenic
985992465 5:3574863-3574885 GCCAGTCCCACATGAGGCAGTGG - Intergenic
986775660 5:11011727-11011749 AGCAGTCCACGGAGAGGCAAGGG + Intronic
987353822 5:17044857-17044879 AGTAGTAGCAGATGAGGCAGAGG - Intergenic
988430352 5:31111681-31111703 AGCAGTGCAAGATGATGTATGGG + Intergenic
989246841 5:39264616-39264638 AGCATTTCAAGCTGAGGAAGTGG - Intronic
990601059 5:57359102-57359124 AGCACTAAAAGATGAGGAAGAGG + Intergenic
991561282 5:67956081-67956103 GGCAGGGCAGGATGAGGCAGAGG + Intergenic
996183735 5:120451480-120451502 AGCCGTCCAAGCTGTGGCTGCGG - Intergenic
996405848 5:123101334-123101356 AGCAGCCCAAAATGAGGACGTGG + Intronic
997745626 5:136297804-136297826 AGCAGTCCATGATGTGATAGTGG - Intronic
998422337 5:141999080-141999102 AGAAGCCCAAGATGACCCAGGGG + Intronic
998456004 5:142273827-142273849 AACAGTACAAGATCAGTCAGTGG + Intergenic
1000209859 5:159099088-159099110 AACAGTCACAGACGAGGCAGGGG + Intronic
1002365207 5:178704481-178704503 GGAAGTCCAAGAGGAGGCTGTGG - Intergenic
1002740357 5:181430936-181430958 AGCAGGCCCAGATGAGGGAAGGG - Intergenic
1002789589 6:427543-427565 ATGAGTCCTAGGTGAGGCAGGGG + Intergenic
1003472556 6:6450814-6450836 AGCAGTCCAAGATGGGGCTAGGG - Intergenic
1004678779 6:17871646-17871668 AGGAGTCCCAGAAGAGACAGTGG + Intronic
1006318535 6:33305148-33305170 AGCAGCCCAAGAAGGGGCCGTGG - Exonic
1006630294 6:35425988-35426010 AGCACGCCCAGATGATGCAGCGG + Exonic
1007595176 6:43046721-43046743 AGCAGGCCCAGATGGGGCAGAGG + Intronic
1007817564 6:44535254-44535276 AGAAGTCCAAGATCAGGGTGTGG - Intergenic
1008548584 6:52605472-52605494 AGCAGACTAAGATGATTCAGTGG + Intergenic
1011832151 6:91387162-91387184 AGCAGTACAAAAACAGGCAGGGG + Intergenic
1012863321 6:104588261-104588283 AGTAGTCCTAGCTGAGGCTGAGG + Intergenic
1013196370 6:107848332-107848354 GGGACTCCAAGAAGAGGCAGCGG + Intergenic
1015490624 6:133821418-133821440 AGCAGTCCAGGCTGATGCAGTGG + Intergenic
1016717962 6:147255719-147255741 AGGAGTTCAAGATGAGCCCGGGG - Intronic
1018035276 6:159876224-159876246 AGCAGTGCAGGCTGGGGCAGGGG - Intergenic
1019234267 6:170596681-170596703 AGCAGTACCAGCTGTGGCAGGGG + Intergenic
1019245468 6:170706540-170706562 AGCAGGCCCAGATGAGGGAAGGG - Intergenic
1019308200 7:346419-346441 AACAGACCAACAGGAGGCAGAGG - Intergenic
1021536848 7:21715025-21715047 AGTATCCCAAGATGAGACAGTGG - Intronic
1022351416 7:29569299-29569321 AGCAGTCCTAAATTATGCAGTGG + Intergenic
1023393079 7:39729161-39729183 AGAAGTCCCAGATTAGGCACTGG + Intergenic
1025227952 7:57180112-57180134 AGCAGTGCAGGAGGAGGCTGCGG + Intergenic
1026242258 7:68586587-68586609 AGCAGTCAATGAAGAGGCCGGGG + Intergenic
1026312225 7:69196410-69196432 TGAAGTCCAAGAGAAGGCAGAGG - Intergenic
1027437628 7:78181487-78181509 TGCAGCTCAAGAGGAGGCAGTGG + Intronic
1029013001 7:97282444-97282466 ACCACTCCCAGATGAAGCAGTGG + Intergenic
1029834672 7:103296839-103296861 AGGAGTCCAAGAAGGTGCAGAGG + Intergenic
1030867927 7:114722104-114722126 AGCAATCCAAGAGGAGGAGGAGG + Intergenic
1032450154 7:132023779-132023801 AGCAGTCCCTGATCAGGCAGAGG + Intergenic
1032949528 7:136891627-136891649 AGCAGTTCAAGATGAGACTGGGG - Intronic
1033361821 7:140643385-140643407 AGAAGTCAAAGATGAGGGAGTGG - Intronic
1035117792 7:156539345-156539367 AGCATTCCATGTTGATGCAGTGG - Intergenic
1035344861 7:158191278-158191300 TGGAGTCCAAGAGGATGCAGAGG + Intronic
1035502657 8:101665-101687 AGCAGGCCCAGATGAGGGAAGGG + Intergenic
1038919662 8:32068701-32068723 ACCAGGCCAAGGTGAGGCATGGG + Intronic
1039460344 8:37738235-37738257 AGTAGTCCAAGATGATGCCATGG + Intronic
1039839665 8:41284738-41284760 AGCATTCTTAGGTGAGGCAGAGG + Intronic
1041026377 8:53690893-53690915 AGAAGTCCAAGACCAGGCACTGG - Intergenic
1043627576 8:82281891-82281913 GGAAGTCCAAGATGAAGCAAGGG + Intergenic
1044091519 8:88008279-88008301 AGAAGACCAAGATCAGGCACTGG + Intergenic
1045030093 8:98127010-98127032 AAAAGTCCAAGATGAAGGAGCGG + Intronic
1046034952 8:108829563-108829585 GGCATTCAAAGATGAGGCAGGGG + Intergenic
1046476967 8:114758013-114758035 TGCAGTCCCAGAGGAGGCTGAGG + Intergenic
1048470225 8:134698397-134698419 AGCATGCCCAGAAGAGGCAGCGG + Intronic
1049335051 8:142079854-142079876 AGGAGTACAAAATGAGGCAGAGG - Intergenic
1052266120 9:26575742-26575764 TGCAGTCCAGGATGAAGGAGTGG + Intergenic
1053412507 9:37924913-37924935 AGCAGAGGAAGATGAGGCTGTGG - Intronic
1054884279 9:70178863-70178885 AGCATTCCAGGATGAGGGAATGG + Intronic
1054944612 9:70782933-70782955 TGCTGTCAAAGATGAGGAAGGGG + Intronic
1055958067 9:81792896-81792918 AGCAGTACTGGGTGAGGCAGAGG - Intergenic
1056644283 9:88397334-88397356 AACAGTACAAGATGAGGCTGAGG - Intronic
1057078821 9:92156542-92156564 AGGAGTTCAAGATGAGCCTGGGG + Intergenic
1058214235 9:102213410-102213432 AGCTGTACAAGATTAGGCTGAGG + Intergenic
1058414783 9:104776232-104776254 AGCATTCCAGGCAGAGGCAGTGG - Intronic
1058562330 9:106243196-106243218 AGCAGTCTCTGATGAGACAGGGG - Intergenic
1060011482 9:120046620-120046642 AGCAGCAGCAGATGAGGCAGAGG + Intergenic
1061393163 9:130328745-130328767 AACAGGCCAAGAGGAGCCAGTGG - Intronic
1062071878 9:134560128-134560150 TGCACTCCGAGATGAGGGAGAGG + Intergenic
1203605666 Un_KI270748v1:55744-55766 AGCAGGCCCAGATGAGGGAAGGG - Intergenic
1187077254 X:15947479-15947501 AGGAGAGCAAGATGAGGCAGGGG - Intergenic
1189217637 X:39340608-39340630 AGGCGTCCAAGATGAGCCATTGG - Intergenic
1189895164 X:45647918-45647940 AGAAGTCCAAACTGAGACAGGGG - Intergenic
1190732568 X:53234981-53235003 AGCAGATGAAGAGGAGGCAGAGG + Exonic
1191860693 X:65664718-65664740 AGAAGTCCAAGCAGGGGCAGGGG - Intronic
1194793035 X:98174462-98174484 ACTAGTCCAAGATTAGGCAAAGG - Intergenic
1196856565 X:119990674-119990696 AGGAGTCGAAATTGAGGCAGGGG - Intergenic
1197028705 X:121787716-121787738 AGCATTCCAAGCTGAGGGAAAGG + Intergenic
1197741532 X:129898437-129898459 AGGAGTGAAAGAGGAGGCAGGGG + Intergenic
1199968887 X:152844066-152844088 GGCAGCCCAAGAGGAGGCATAGG + Intronic
1200232409 X:154450569-154450591 AGCAGTCACTGATGTGGCAGGGG - Exonic
1202387844 Y:24342182-24342204 AGCAGGCCCAGATGAGGGAAGGG - Intergenic
1202482943 Y:25327946-25327968 AGCAGGCCCAGATGAGGGAAGGG + Intergenic