ID: 1173583870

View in Genome Browser
Species Human (GRCh38)
Location 20:44166958-44166980
Sequence GAGCAGTCCAAGATGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583870_1173583876 7 Left 1173583870 20:44166958-44166980 CCCTGCCTCATCTTGGACTGCTC 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583870_1173583875 6 Left 1173583870 20:44166958-44166980 CCCTGCCTCATCTTGGACTGCTC 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583870_1173583874 5 Left 1173583870 20:44166958-44166980 CCCTGCCTCATCTTGGACTGCTC 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583870 Original CRISPR GAGCAGTCCAAGATGAGGCA GGG (reversed) Intronic
900033462 1:387931-387953 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
900054300 1:617820-617842 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
901126841 1:6935433-6935455 GAGCAGACAGAGATGTGGCATGG - Intronic
902479694 1:16705013-16705035 AAGCAGGCCCAGCTGAGGCAGGG - Intergenic
904313463 1:29644493-29644515 GAGCAGGCTAAGAGGAGGCCAGG - Intergenic
905541889 1:38766472-38766494 GAGCAGGGCAGGAAGAGGCAAGG + Intergenic
905632199 1:39525071-39525093 GAGAGGTCCAAGCTGAGCCAGGG + Intronic
906457061 1:46006174-46006196 GAGCAGTCCAAGAATGGGGAAGG - Intronic
907103939 1:51863104-51863126 GAGAAGTTCAAAATGAGGCCAGG + Intronic
907398742 1:54210974-54210996 GAGGAGGCAAAGATGAGGCTGGG - Intronic
907803657 1:57796796-57796818 GATCAGACCAAGCTGAGGGAGGG - Intronic
908136796 1:61141382-61141404 GACCAGTCAAAGATGATGCCCGG - Intronic
908817355 1:68047900-68047922 GTGCAGCCCCAGAAGAGGCATGG + Intronic
908843567 1:68302291-68302313 GAGCTCTCCAAGAAGAGTCATGG + Intergenic
909821915 1:80074689-80074711 AAGTAGTCCAAGATAATGCAAGG - Intergenic
913000018 1:114571034-114571056 AAGTACTCCAAGATCAGGCAGGG - Intronic
913157661 1:116115837-116115859 AAGCAGCCCAAGATGGGACAAGG + Intronic
916683666 1:167126185-167126207 GAGCAGTGGAAGAAGGGGCAGGG + Exonic
917349562 1:174062954-174062976 GAGAAGTCCAACATGAGCCAGGG - Intergenic
919315000 1:195960906-195960928 GAGCAGTCAAAGATCAGACAGGG + Intergenic
922255817 1:223892085-223892107 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
923334216 1:232952879-232952901 AAGCCCTCCAAGATGAGTCATGG - Intronic
923517431 1:234709497-234709519 GAGCAGTCAAAGATGAGGCGGGG + Intergenic
924149907 1:241118880-241118902 GAGGACTCCAAAAGGAGGCAAGG + Intronic
924337017 1:242994950-242994972 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
924606259 1:245538183-245538205 GAGCAGTTTCAGATGAGTCATGG + Intronic
924701949 1:246463081-246463103 GAGTGGTTCAAGATGAGGCAGGG + Intronic
1063448676 10:6136590-6136612 TAGCAGTCCAAGGGGAGGCAAGG + Intergenic
1063755560 10:9003085-9003107 GAAGAGGCCAAGGTGAGGCAGGG - Intergenic
1065349718 10:24784531-24784553 GAGCAGTCCAGAATGATGCTGGG - Intergenic
1069983430 10:72268069-72268091 GTGCAGTCCTGGAAGAGGCAGGG + Intergenic
1070114677 10:73517004-73517026 GAGCAGTTCCAGAGGATGCAGGG - Exonic
1071265996 10:83965518-83965540 GAGCTGGCCAAGATACGGCACGG - Intergenic
1072578637 10:96721343-96721365 GAGGAGTCCAAGAAGAGGGCAGG - Intergenic
1075643077 10:124079466-124079488 GAGCAGTCCAGGAGTAGACAAGG + Intronic
1076315833 10:129540863-129540885 GAGCACCCCGAGATGAGGGAAGG - Intronic
1076502304 10:130946845-130946867 TAGAAGCCCAAGATGAGGAATGG + Intergenic
1077231891 11:1461419-1461441 CAGCCGCCCCAGATGAGGCAAGG - Exonic
1079019602 11:16898535-16898557 GAGCATTTCAAGAAGAAGCAAGG + Intronic
1079955062 11:26852135-26852157 AAGCTGTCCAAGATTAGGAAAGG - Intergenic
1082031977 11:47611296-47611318 GAGCAGTCTGAGGTGAGGCATGG + Intergenic
1083318301 11:61829411-61829433 TAGGAGTGCAAGATGAGGGAAGG - Intronic
1084083987 11:66846350-66846372 CAGCAGTCCAAAGTGAGGAAGGG - Exonic
1085446850 11:76606474-76606496 GAGGAGTCCAAGGAGAGGCCAGG - Intergenic
1087091577 11:94278845-94278867 GAGCAGACCAAGAGGATGCCAGG + Intergenic
1087720071 11:101653112-101653134 GAGCTGTCCAAGAGGGAGCACGG - Intronic
1088645018 11:111911118-111911140 GAACAGCTCAGGATGAGGCAGGG + Intronic
1088657483 11:112014452-112014474 GAGTATTCCAAGAAGAGGGAAGG - Intronic
1088714842 11:112539896-112539918 GAGGAGTGCAGGAGGAGGCATGG + Intergenic
1088801399 11:113310628-113310650 AAGCAGTGCAAGATGAAGCAAGG - Intergenic
1089181915 11:116589124-116589146 GAGCAATCCAAGATGAGATTTGG + Intergenic
1089334702 11:117715209-117715231 GAGCAGTGCATGCTGAGGCCGGG - Intronic
1089627546 11:119761293-119761315 GAGCAGGCAGAGATTAGGCAGGG - Intergenic
1089638153 11:119829813-119829835 GAGCAGTGGAAGATGAGTCCAGG - Intergenic
1090016615 11:123091915-123091937 CAGGAGTCAAAAATGAGGCATGG - Intronic
1091383695 12:78531-78553 GAGAAGGCCAAGATAAGGCTGGG - Intronic
1091642697 12:2249681-2249703 GACCTGTCCAAGGTGAGGCCAGG + Intronic
1092146813 12:6220315-6220337 GAGCAGACAAGGAGGAGGCAGGG + Intronic
1095742097 12:45618857-45618879 CAACACTTCAAGATGAGGCATGG + Intergenic
1096443855 12:51670484-51670506 GAACAGTGGAAGATGAGGCTGGG + Intronic
1096818911 12:54218689-54218711 GAGCAGTCCAGGTGGAAGCAAGG - Intergenic
1098993071 12:77087476-77087498 GAGTAGCACAAGACGAGGCAGGG + Intergenic
1101734514 12:107453181-107453203 GAGCAGCATAAGATGAGGCCAGG + Intronic
1103333545 12:120171933-120171955 CAGGAGTTCAAGATCAGGCAGGG - Intronic
1103931573 12:124453510-124453532 GCGCAGGCAGAGATGAGGCATGG + Intronic
1104112470 12:125716883-125716905 GATCATTCCAAGCTGAGGCAAGG + Intergenic
1104719163 12:131035080-131035102 GAGAGGTTCAAGATGAGGCTGGG - Intronic
1105593109 13:21812288-21812310 GTGCAGTGCATGATCAGGCAGGG + Intergenic
1107798447 13:44079613-44079635 GCGCAGTCCAGGAAGAGGCAGGG + Intergenic
1109737261 13:66503039-66503061 GAGCAGTCCAGGATGGGGGGAGG + Intronic
1112625280 13:101096961-101096983 GAGGAGGCCAAGAGGAGACATGG - Intronic
1114062876 14:19037016-19037038 CAGGAGTACACGATGAGGCAGGG + Intergenic
1114099383 14:19362981-19363003 CAGGAGTACACGATGAGGCAGGG - Intergenic
1114556766 14:23566699-23566721 GGGCAGACCAGGAAGAGGCAGGG + Intronic
1114994368 14:28329781-28329803 GAGGAATCCAAGATGATGGAAGG - Intergenic
1117854713 14:60016412-60016434 CAGGAGTTCAAGATGAGGCTGGG - Intronic
1119925515 14:78489821-78489843 GTGCTGTCCAAGATGAGGCATGG + Intronic
1121740940 14:96252061-96252083 GAGCAGGCCAAGAGGAGGAGAGG + Intronic
1121958004 14:98231536-98231558 GAGCAGTTCATGCTGCGGCAGGG - Intergenic
1122404272 14:101490615-101490637 GAGCAGTCAAGGAGGAGTCAAGG + Intergenic
1125201866 15:37107180-37107202 GAGCAGTCCATTGTGAGGTACGG - Intergenic
1125345057 15:38710922-38710944 CAGCAGTTCAAGATGAGCCTGGG - Intergenic
1126716477 15:51523706-51523728 GAGCAATCTAGGAAGAGGCAAGG + Intronic
1127762474 15:62152334-62152356 TAGCAGGTCAAGATCAGGCAAGG + Intergenic
1127865484 15:63029048-63029070 GAGCACTCCAGGAGGAGGAAAGG - Intergenic
1128214110 15:65922575-65922597 GCGCCCTCCAAGATGAGGGAAGG - Intronic
1128753781 15:70167163-70167185 GAGCACTGAAAGATGAGGCTGGG - Intergenic
1131007917 15:88993655-88993677 GAGCAGTTCAAGATCAGCCCGGG + Intergenic
1133262203 16:4558234-4558256 CAGCAGTCAAAGGTGAGCCAGGG - Intronic
1138226803 16:55302852-55302874 CAGCAGTCCAAGGTGAGAAAAGG - Intergenic
1139527262 16:67524687-67524709 GAGACATCCCAGATGAGGCAGGG - Intronic
1142708803 17:1712464-1712486 GAGCACCCCAAGAGGAGGGAGGG - Intergenic
1143315086 17:6026454-6026476 GAGAAGTCCAAGAAGATGCCGGG - Intronic
1143761180 17:9105234-9105256 GAGCAGACCAAGCTGACCCAAGG - Intronic
1144523480 17:15969907-15969929 AATGAGCCCAAGATGAGGCAGGG - Intronic
1144658403 17:17052615-17052637 AAGGAGTCCAAGTTGGGGCAAGG - Intronic
1146726547 17:35161069-35161091 GAGAAGACCAGAATGAGGCAGGG - Intronic
1150484424 17:65533808-65533830 GAGCAGACCTAGGTGGGGCAGGG - Intronic
1151327784 17:73389596-73389618 GGGGAGTCCAAGATCAGGCAAGG + Intronic
1152763610 17:82122764-82122786 GAGAAGTCCTGGAGGAGGCAGGG - Intronic
1156043617 18:32852985-32853007 TAGCAGTCCAAGACAGGGCAGGG + Intergenic
1156712321 18:39961992-39962014 GAGAACTCCAGAATGAGGCAGGG + Intergenic
1157973250 18:52295360-52295382 GAGCAGTGCAAGATGAGATTTGG + Intergenic
1158589796 18:58769536-58769558 GACCACTCCCAGATGAGCCATGG - Intergenic
1160052817 18:75452342-75452364 CAGGAGTCCTAGATGAGGCCAGG - Intergenic
1160896153 19:1402827-1402849 GAGCTGTGCAAGAGGTGGCAGGG - Intergenic
1161615594 19:5268522-5268544 CAGGAGGCCAAGATGGGGCAAGG + Intronic
1165147099 19:33737788-33737810 GAGAAGTCCAGGGTTAGGCAAGG - Intronic
1165806442 19:38583891-38583913 GAGCAGGGAGAGATGAGGCAGGG - Intronic
1166667736 19:44691289-44691311 CAGAAGTCCAAGATGAGCCTGGG + Intergenic
1202713730 1_KI270714v1_random:30919-30941 AAGCAGGCCCAGCTGAGGCAGGG - Intergenic
925021681 2:574741-574763 CAGCAGTGCAAGGTGAGGCACGG + Intergenic
926499878 2:13641140-13641162 CAGCAGGCCAAGGTGGGGCAAGG - Intergenic
928270419 2:29850286-29850308 GGGCAGTGCCAGATGAGGAATGG + Intronic
929435896 2:41928034-41928056 GAGAAGTGCAAGATGAGAGAAGG - Intergenic
929933808 2:46278560-46278582 ATGCAGACCAATATGAGGCAAGG - Intergenic
931604492 2:64039099-64039121 GAGGAAACCAAGATGATGCAGGG + Intergenic
931723430 2:65084395-65084417 GAGCAGTCCAGGCTCAGGGAAGG + Exonic
933442620 2:82333237-82333259 AAGCAGTTCAAAATGAGGAAGGG + Intergenic
934682133 2:96291740-96291762 GAGCAGTGCAAGGTGAGGAGGGG - Exonic
937093223 2:119220415-119220437 CAGCAGTCAGAGCTGAGGCAGGG - Intergenic
937404469 2:121614080-121614102 GAGCACTCCAAGATGACAAAGGG + Intronic
940434719 2:153638083-153638105 GGGCATTCCAAGAAGAGGGAGGG + Intergenic
942977277 2:182033187-182033209 GAGCAGAGCAAGATGTGGCAAGG - Intronic
943923246 2:193738034-193738056 GTGCAGTCCAAGAGTAGGGAAGG - Intergenic
945475461 2:210276869-210276891 GAGTAGTGAAAGATGAGGCTTGG + Intergenic
946127958 2:217580985-217581007 GAGGGGCCTAAGATGAGGCAAGG + Intronic
946171637 2:217899185-217899207 GGGCAGCCAAGGATGAGGCATGG + Intronic
947532423 2:230920364-230920386 GAGCATTTCAAGATGGGGCTGGG + Intronic
947709118 2:232300629-232300651 GAGCAGTCTATGATGTGGAAAGG - Intronic
947784830 2:232807604-232807626 GAGCAGCCCAAGAGGAAGAAGGG - Intronic
947963180 2:234257211-234257233 GAGCAATTCAGGATGAGGAAAGG + Intergenic
948138541 2:235655914-235655936 GGGCAGTGCAGGATGTGGCAAGG + Intronic
948506818 2:238434015-238434037 GAGAAACCCAAGATGGGGCAGGG - Intronic
948888490 2:240895813-240895835 GAGTAGTCCACGATGAAGCGGGG + Exonic
1168754666 20:308091-308113 GAGGAGGCCCAGAGGAGGCAGGG - Intergenic
1170477807 20:16733671-16733693 GAGCAGTCCCAGATGAGAACAGG + Intronic
1170510188 20:17068370-17068392 GAGAAGACCCAGAGGAGGCAGGG + Intergenic
1172213300 20:33216041-33216063 GTGCGGTCCAAGAGGATGCAGGG + Intergenic
1172292711 20:33787911-33787933 GAGGAGTCAAGGATGAGGCACGG - Intronic
1173583870 20:44166958-44166980 GAGCAGTCCAAGATGAGGCAGGG - Intronic
1174582218 20:51579971-51579993 GACAAGTCCGAGATGGGGCATGG - Intergenic
1174710258 20:52697053-52697075 GATAAGTCCAAGATGGGACAGGG + Intergenic
1175784297 20:61702587-61702609 GAGCCGTCAAAGTTGAAGCAAGG + Intronic
1179618806 21:42599037-42599059 GGGCAGTCAGGGATGAGGCATGG - Intergenic
1180481370 22:15759643-15759665 CAGGAGTACACGATGAGGCAGGG + Intergenic
1181141045 22:20805099-20805121 GAGCAGTTCAACACGAGCCAGGG - Exonic
1182936650 22:34228988-34229010 GAGCAGTCACTGCTGAGGCAGGG + Intergenic
1183066164 22:35364521-35364543 CAGGAGTTCAAGATGAGCCATGG + Intergenic
1184279349 22:43428232-43428254 GAGCAGTCCAGGATGGGGTGGGG - Intronic
950087895 3:10273545-10273567 TAGGAGTTCAAGATGAGCCAAGG + Intronic
951333476 3:21393219-21393241 AAGGTGTCAAAGATGAGGCAGGG + Intergenic
953930972 3:47005478-47005500 GAGCAGTCAAAGCTGGGGGAGGG - Exonic
954320475 3:49829232-49829254 GAGCTGTCAAGGAAGAGGCATGG + Intronic
954984481 3:54777643-54777665 AGGCAGCCCAAGATGAAGCAAGG + Intronic
955146451 3:56324894-56324916 GAGCATTCCAAGCAGAGGGAAGG - Intronic
956158675 3:66325095-66325117 AAGGAGACCAAGATAAGGCAAGG - Intronic
956727193 3:72165575-72165597 GAGCAGTCAAAGACAAGACAGGG - Intergenic
957521500 3:81324305-81324327 GTGCAATCCAAGTTGATGCAGGG + Intergenic
957691871 3:83581173-83581195 AAGCAGTCCAAGGTCAGGGAGGG + Intergenic
960812030 3:121634838-121634860 CAGGAGTTCAAGATGAGGCTGGG - Intronic
962448122 3:135486917-135486939 CAGCAGTTCAAGATCAGGCTGGG + Intergenic
962709996 3:138078207-138078229 GAGCAGTCCAAGGTGAGTCAGGG + Intronic
963929131 3:150983717-150983739 GACCAGTCCAAGATGTGCCAGGG + Intergenic
964728704 3:159842593-159842615 GCGGAGTCCAAGAGGAAGCAGGG - Intronic
966327933 3:178777955-178777977 GAGCTGTCCACGATGAATCATGG - Intronic
967485913 3:190030361-190030383 CAGCAGTTCAAGATGAGCCTGGG + Intronic
970156199 4:13143992-13144014 GAGGAGACCAGGATCAGGCAAGG + Intergenic
973932385 4:55806175-55806197 CAGCAGTTCAAGATGAGCCTGGG + Intergenic
978388416 4:108199860-108199882 GAGCAGAGCAAGATAAGGCCAGG + Intergenic
979240104 4:118440354-118440376 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
981388848 4:144163807-144163829 GAACAGACCAAGCTGAGGAAAGG - Intergenic
984995307 4:185425322-185425344 GAGCTATCCAAGTGGAGGCACGG + Intronic
985267846 4:188166572-188166594 GAGCAGTGGAACCTGAGGCAAGG - Intergenic
985766493 5:1782345-1782367 GGGGAGTACCAGATGAGGCAGGG - Intergenic
986706800 5:10459566-10459588 GAGCAGGCCATGGAGAGGCAGGG - Intronic
986775659 5:11011726-11011748 AAGCAGTCCACGGAGAGGCAAGG + Intronic
987075008 5:14373045-14373067 GAGAAGTACAGGGTGAGGCAGGG + Intronic
987824014 5:23004940-23004962 GAAATGTCCAAGATGAGGTATGG - Intergenic
988391871 5:30644421-30644443 GATCATTCCAAGAAGAGACATGG + Intergenic
988430351 5:31111680-31111702 GAGCAGTGCAAGATGATGTATGG + Intergenic
988499937 5:31776174-31776196 GAGGAGTCCAAGATGACCTAGGG - Intronic
991413649 5:66369334-66369356 GAGGAGTCAAAGCTGAGCCATGG - Intergenic
993043114 5:82837612-82837634 GAGGAGTCAAAGATCAGGGAAGG + Intergenic
994898957 5:105745487-105745509 GGGAAGTCCATGGTGAGGCAGGG - Intergenic
995376211 5:111477120-111477142 GAGCAGCCTAAGGTGAGACAGGG - Intronic
998978220 5:147671667-147671689 GAGAAGTCCAAGGTGAGCGAGGG - Exonic
999479554 5:151934815-151934837 GAGCAGTCCTGTATCAGGCATGG - Intergenic
1000790533 5:165601613-165601635 GGGCAGTCCAGGAGGAAGCAGGG - Intergenic
1002049473 5:176561993-176562015 GAGCATTCCAAAAAGAGGGACGG + Intronic
1002740358 5:181430937-181430959 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1003415644 6:5905602-5905624 GAGCAGTCCATGAGGAGGAGGGG - Intergenic
1003472557 6:6450815-6450837 GAGCAGTCCAAGATGGGGCTAGG - Intergenic
1005717963 6:28569599-28569621 GAGGAGTCAAAGATGGGTCAAGG - Intergenic
1007399262 6:41594599-41594621 GAACTTTCCAAGATGTGGCAGGG + Intronic
1007479474 6:42140932-42140954 GAGCAGGGCAAGTGGAGGCATGG - Intronic
1007495263 6:42255833-42255855 CAGAAGTCCAGGATGAGGCTGGG + Intronic
1007522244 6:42459923-42459945 CAGCAGCTCAAGATGAGCCAGGG - Intergenic
1007809051 6:44473556-44473578 GAGCAGCCCAGCATGAGGTACGG + Intergenic
1011092190 6:83616138-83616160 GAGCAGTTCAAGATAAAGAAAGG + Intronic
1011287387 6:85739397-85739419 GGGTAGCCCAAGATCAGGCATGG + Intergenic
1012593570 6:101013761-101013783 GATCAGTCAATTATGAGGCATGG - Intergenic
1014067091 6:117139639-117139661 GATCAGTCCAACATGTGGGATGG - Intergenic
1015593807 6:134847112-134847134 GAGCAGTGCAAGATAAGGTAAGG + Intergenic
1015657902 6:135540540-135540562 GAGGATTCCAAGATGATCCAAGG - Intergenic
1018035277 6:159876225-159876247 GAGCAGTGCAGGCTGGGGCAGGG - Intergenic
1019245469 6:170706541-170706563 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1021589083 7:22241409-22241431 GGGCAGTCCAAGATAAGTCCAGG + Intronic
1025284702 7:57652066-57652088 GTGCAGTCGAAGATGCGTCAGGG - Intergenic
1026505625 7:70980274-70980296 CAGCAGTTCAAGTTGAGGCTGGG - Intergenic
1028224080 7:88229539-88229561 TAGCTTTCCAAGATGGGGCAGGG - Intergenic
1029423963 7:100485363-100485385 GAGGAGGCCAAGAGGAGGTAAGG + Exonic
1031988097 7:128176812-128176834 GAGCAGTACAGGATGATGAAGGG + Intergenic
1032592998 7:133210165-133210187 AAGAAGTCCAAGATGATGCTGGG - Intergenic
1032927147 7:136620081-136620103 GAGCAGTTCAAGATGAGATTTGG + Intergenic
1032949529 7:136891628-136891650 CAGCAGTTCAAGATGAGACTGGG - Intronic
1033318081 7:140315117-140315139 GAGCAATGCAAGATGAAGAATGG - Intronic
1033598469 7:142872498-142872520 GAGAAGTCAGAGATGAGGCTGGG + Intronic
1035502656 8:101664-101686 CAGCAGGCCCAGATGAGGGAAGG + Intergenic
1038575078 8:28698199-28698221 GAGAAGTCAAAGATGATGCCAGG + Intronic
1038919661 8:32068700-32068722 AACCAGGCCAAGGTGAGGCATGG + Intronic
1039900603 8:41749591-41749613 AAGAAGTCCAAGATGAGGCCAGG - Intronic
1039900647 8:41749905-41749927 AAGAAGTCCAAGATGAGGCTGGG - Intronic
1041810228 8:61900735-61900757 GAGCAGACCAAGGCTAGGCATGG + Intergenic
1043627575 8:82281890-82281912 GGGAAGTCCAAGATGAAGCAAGG + Intergenic
1043882241 8:85557628-85557650 CAGGAGTTCAAGATGAGGCTGGG + Intergenic
1045714131 8:105021685-105021707 GAGAAGTCCAAGATCAAGGAAGG - Intronic
1046034951 8:108829562-108829584 TGGCATTCAAAGATGAGGCAGGG + Intergenic
1046939847 8:119920543-119920565 GAGCATTCTAAGCAGAGGCATGG + Intronic
1048297125 8:133222616-133222638 GAGCAGAATAAGAGGAGGCATGG + Intronic
1049414079 8:142487539-142487561 ATGCAGCCCAAGATGCGGCAGGG - Intronic
1049825168 8:144663067-144663089 GAGCAGTCCAAGATGGATAATGG - Intergenic
1055842254 9:80519347-80519369 AGGCAATCCAAGATGAGGAATGG - Intergenic
1058064736 9:100536304-100536326 GAGCCCTACAATATGAGGCAAGG - Intronic
1058656024 9:107221230-107221252 GAGAAGTGTTAGATGAGGCAGGG + Intergenic
1060192969 9:121604512-121604534 GAGCAGAGAAAGAAGAGGCAGGG - Intronic
1061776777 9:132970961-132970983 GAGCAGTCTTAGTTGCGGCAGGG - Intronic
1203605667 Un_KI270748v1:55745-55767 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1186885963 X:13914045-13914067 AAGAAATCCATGATGAGGCAGGG - Intronic
1187077255 X:15947480-15947502 GAGGAGAGCAAGATGAGGCAGGG - Intergenic
1188498295 X:30800902-30800924 AGGCAGGGCAAGATGAGGCATGG - Intergenic
1189260627 X:39676108-39676130 GAGCAGTCAAAGTTGAAGAAAGG - Intergenic
1189895165 X:45647919-45647941 GAGAAGTCCAAACTGAGACAGGG - Intergenic
1190333726 X:49250516-49250538 CTGCAGTCTAAGCTGAGGCATGG + Exonic
1192259134 X:69493522-69493544 GAGAAGTCCAAAAAGAGGAAAGG + Intergenic
1192814536 X:74577148-74577170 AAGCAGTACAAGTTAAGGCAGGG - Intergenic
1194972748 X:100362269-100362291 GAGCCGACCAGGATGAGGAAAGG - Intronic
1199412680 X:147543002-147543024 GAGCATTCCAGGCAGAGGCAAGG + Intergenic
1201610515 Y:15837965-15837987 GAGGAGTCCAAGATCAGTCTTGG + Intergenic
1202387845 Y:24342183-24342205 CAGCAGGCCCAGATGAGGGAAGG - Intergenic
1202482942 Y:25327945-25327967 CAGCAGGCCCAGATGAGGGAAGG + Intergenic