ID: 1173583871

View in Genome Browser
Species Human (GRCh38)
Location 20:44166959-44166981
Sequence TGAGCAGTCCAAGATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 634}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583871_1173583876 6 Left 1173583871 20:44166959-44166981 CCTGCCTCATCTTGGACTGCTCA 0: 1
1: 1
2: 2
3: 31
4: 634
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583871_1173583874 4 Left 1173583871 20:44166959-44166981 CCTGCCTCATCTTGGACTGCTCA 0: 1
1: 1
2: 2
3: 31
4: 634
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583871_1173583875 5 Left 1173583871 20:44166959-44166981 CCTGCCTCATCTTGGACTGCTCA 0: 1
1: 1
2: 2
3: 31
4: 634
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583871 Original CRISPR TGAGCAGTCCAAGATGAGGC AGG (reversed) Intronic
901104506 1:6744746-6744768 TCAGGAGTCCAAGATCAGCCTGG - Intergenic
901207523 1:7505509-7505531 TGTGCAGGCCCAGATGGGGCCGG + Intronic
901423629 1:9167102-9167124 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
902211565 1:14908329-14908351 TCAGGAGTTCAAGATGAGCCTGG + Intronic
903108854 1:21110502-21110524 TCAGGAGTTCAAGATCAGGCTGG - Intronic
903141289 1:21340627-21340649 TCAGCAGTCCAAGACCAGCCTGG + Intronic
903587375 1:24426502-24426524 TCAGCAGTTCAAGATCAGCCTGG - Intronic
904221262 1:28971391-28971413 TCAGGAGTTCAAGATGAGCCTGG - Intronic
904759450 1:32791590-32791612 TTAGGAGTTCAAGATGAGCCTGG + Intronic
905030509 1:34880261-34880283 TCAGGAGTTCAAGATGAGCCTGG - Intronic
905071243 1:35227369-35227391 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
906309310 1:44741778-44741800 TCAGCAGTTCAAGACCAGGCTGG + Intronic
906324233 1:44834330-44834352 TCAGCAGTTCAAGATCAGCCTGG - Intronic
906927091 1:50129291-50129313 GGAGCAGTCCAAGTGGAGGATGG + Intronic
906978510 1:50602709-50602731 TGAGGAGTTCAAGATCAGCCTGG - Intronic
906983500 1:50656999-50657021 TCAGGAGTTCAAGATGAGCCTGG + Intronic
907077145 1:51589296-51589318 TCAGCAGTTCAAGATCAGCCTGG - Intronic
907398743 1:54210975-54210997 GGAGGAGGCAAAGATGAGGCTGG - Intronic
909513344 1:76479480-76479502 TGAGAAGTCCAAGAGCATGCTGG + Intronic
909667755 1:78154490-78154512 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
910441987 1:87262395-87262417 TGAGAAGTCTAGGATGAGCCTGG - Intergenic
910579013 1:88800920-88800942 TGAGCAGTACAAGTTGAGATAGG - Intronic
912444500 1:109724835-109724857 TGAGGAGTCCAAGACTAGCCTGG + Intronic
912499008 1:110109627-110109649 TGAGGAGTCCAAGACCAGCCTGG - Intergenic
912797642 1:112702562-112702584 AGAGCTGGCCAAGATGAAGCAGG - Exonic
912950259 1:114115895-114115917 TGGACAGTCCCAGAGGAGGCTGG - Intronic
913000019 1:114571035-114571057 TAAGTACTCCAAGATCAGGCAGG - Intronic
913023617 1:114811988-114812010 TCAGCAGTTCAAGAACAGGCTGG - Intergenic
913589530 1:120310306-120310328 TGAGCAGTAGAAGAGGAGGCTGG + Intergenic
913618655 1:120588060-120588082 TGAGCAGTAGAAGAGGAGGCTGG - Intergenic
914571553 1:148922164-148922186 TGAGCAGTAGAAGAGGAGGCTGG + Intronic
914601279 1:149208098-149208120 TGAGCAGTAGAAGAGGAGGCTGG - Intergenic
914736313 1:150420614-150420636 TGAGCAGTTCAAGACCAGCCTGG + Intronic
915349591 1:155216122-155216144 TAAGGAGTTCAAGATGAGCCTGG - Intergenic
915414244 1:155728350-155728372 TCAGGAGTTCAAGATGAGCCTGG + Intronic
915748386 1:158182390-158182412 TGAGCATTCAAAGAAGAGGAAGG + Intronic
916147276 1:161750724-161750746 TGAGGAGTTCGAGATCAGGCTGG + Intronic
916375063 1:164144248-164144270 TCAGGAGTCCAAGATCAGCCTGG + Intergenic
916669937 1:167006843-167006865 TGAGGAGTTCAAGATCAGCCTGG - Intronic
917314177 1:173707540-173707562 TCAGCAGTTCAAGACCAGGCTGG - Intergenic
917349563 1:174062955-174062977 GGAGAAGTCCAACATGAGCCAGG - Intergenic
917448272 1:175125000-175125022 TGGGCAGTCAAAGAGGTGGCAGG + Intronic
917509920 1:175661531-175661553 GGAGCAGTACAACGTGAGGCAGG - Intronic
918307075 1:183256959-183256981 TCAGGAGTTCAAGATGAGTCTGG - Intronic
919314999 1:195960905-195960927 GGAGCAGTCAAAGATCAGACAGG + Intergenic
919321385 1:196044389-196044411 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
919714028 1:200756241-200756263 TCAGGAGTCCAAGATCAGTCTGG + Intronic
919816906 1:201447114-201447136 TCAGGAGGCCAAGGTGAGGCAGG + Intergenic
920181777 1:204136498-204136520 TCAGGAGTTCAAGATGAGCCTGG + Intronic
920768792 1:208859693-208859715 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
922107938 1:222528395-222528417 TAAGGAGTTCAAGATGAGCCTGG + Intronic
922133136 1:222798899-222798921 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
922172489 1:223167458-223167480 TGAGCAGTTCAAGACCAGCCTGG - Intergenic
922329054 1:224557664-224557686 TCAGGAGTTCAAGATGAGCCTGG - Intronic
922663725 1:227451680-227451702 TGAGCAGTCCTGGATCATGCTGG + Intergenic
922785382 1:228279957-228279979 TGAGAAGTTTAAGATGAGCCTGG + Exonic
923189468 1:231606708-231606730 TCAGGAAACCAAGATGAGGCGGG - Intronic
923517430 1:234709496-234709518 AGAGCAGTCAAAGATGAGGCGGG + Intergenic
924701948 1:246463080-246463102 GGAGTGGTTCAAGATGAGGCAGG + Intronic
1062780467 10:200487-200509 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1063069655 10:2648437-2648459 TGAGGAGTCCAACAACAGGCAGG - Intergenic
1063216568 10:3930951-3930973 TGAGAAGTCCAAGATGTGAAGGG - Intergenic
1064046076 10:12016811-12016833 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1064377038 10:14806187-14806209 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
1064805245 10:19122933-19122955 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1065049034 10:21771705-21771727 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1065126076 10:22575726-22575748 TCAGGAGTCCAAGATCAGCCTGG + Intronic
1065349719 10:24784532-24784554 AGAGCAGTCCAGAATGATGCTGG - Intergenic
1065350289 10:24789531-24789553 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1065870586 10:29952900-29952922 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
1066344749 10:34573490-34573512 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1066650027 10:37645836-37645858 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1067364192 10:45609889-45609911 GAAACAGTGCAAGATGAGGCTGG + Intergenic
1067855688 10:49790909-49790931 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1068279347 10:54848574-54848596 TGAGAAGTCCAAGATGGAGGAGG - Intronic
1069384503 10:67872378-67872400 TCAGGAGTTCAAGACGAGGCTGG - Intergenic
1069410050 10:68143962-68143984 TGAGGAGTCCAAGAACAGCCTGG - Intronic
1069979653 10:72243282-72243304 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1070114678 10:73517005-73517027 TGAGCAGTTCCAGAGGATGCAGG - Exonic
1070701045 10:78601979-78602001 TGAGCAGTGCCAGGAGAGGCAGG - Intergenic
1070910781 10:80116029-80116051 TGAGGAGTTCAAGATCAGCCCGG - Intergenic
1071541619 10:86490003-86490025 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1073236934 10:102024599-102024621 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1074313480 10:112342311-112342333 TGAGGAGTTCAAGATAAGCCTGG + Intergenic
1074689461 10:115991312-115991334 TGGGAAGTCCAAGATGAAGGTGG + Intergenic
1074802605 10:117016614-117016636 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1075533162 10:123247307-123247329 TTAGAAGTCCAAGATCAGCCGGG - Intergenic
1075559814 10:123460342-123460364 TGAGCAAGCCAAGGAGAGGCAGG + Intergenic
1075754064 10:124796793-124796815 TGTACAGTCCATGATCAGGCAGG - Intergenic
1075989051 10:126817344-126817366 TGAGAAGTCCAAGATCAAGGTGG - Intergenic
1078065252 11:8074525-8074547 TGAGGAGTCCAAGACCAGCCTGG + Intronic
1078225723 11:9389964-9389986 TGAGGAGTTCAAGACCAGGCTGG - Intronic
1078634081 11:13032816-13032838 GGAGCAGTCCAAGTGGGGGCGGG + Intergenic
1079497713 11:21064499-21064521 TGAGTAGTCCAAGGTAAGACTGG + Intronic
1079759834 11:24314969-24314991 TCAGCAGTCCAAGACCAGCCTGG - Intergenic
1080619388 11:33974355-33974377 TGAGGAGTTCAAGATCAGACTGG + Intergenic
1081511836 11:43782469-43782491 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1081900695 11:46625471-46625493 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1081922638 11:46793320-46793342 TGAGTGGTTCAAGATGGGGCTGG + Intronic
1082200254 11:49358001-49358023 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1082649908 11:55776911-55776933 TCAGAAGTTCAAGATGAGTCTGG + Intergenic
1082687504 11:56259026-56259048 TGAGAAGTCCAAGATTAAGGTGG + Intergenic
1083431512 11:62615754-62615776 AGAGAAGCCCAAGATGAAGCAGG - Exonic
1083856991 11:65398083-65398105 TGAGGAGTTCAAGATCAGCCTGG - Intronic
1083891979 11:65600033-65600055 TGGGCAGTCCCAGTGGAGGCAGG + Intronic
1084126380 11:67101854-67101876 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1084905858 11:72346766-72346788 TCAGCAGTTCAAGATCAGTCTGG + Intronic
1085033122 11:73284508-73284530 TGAACAGTCCCAGCTGAGACGGG - Intronic
1085123156 11:73980321-73980343 TGAGAAGCCCAAGAGGAAGCTGG - Intronic
1086452342 11:86929431-86929453 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1087062275 11:93991868-93991890 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1087466757 11:98517569-98517591 TGATCAGTTCAAGATCAGCCTGG - Intergenic
1087670025 11:101095004-101095026 TGAGAAGTCCAAGATCAAGGTGG - Intronic
1087689539 11:101303717-101303739 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1088245878 11:107817638-107817660 AGAGTAGTTCAAGGTGAGGCTGG - Intronic
1088344438 11:108806876-108806898 TGAGTGGTACAAGATGAGGTTGG + Intronic
1088645017 11:111911117-111911139 TGAACAGCTCAGGATGAGGCAGG + Intronic
1089334703 11:117715210-117715232 GGAGCAGTGCATGCTGAGGCCGG - Intronic
1089417655 11:118305932-118305954 TGAGAAACCCAAGATGAAGCAGG - Intronic
1090017045 11:123095477-123095499 TTAGGAGTTCAAGATCAGGCTGG - Intronic
1090605535 11:128419665-128419687 TGAGTTGTACAAAATGAGGCTGG + Intergenic
1090778067 11:129982739-129982761 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1091383696 12:78532-78554 TGAGAAGGCCAAGATAAGGCTGG - Intronic
1091902153 12:4153087-4153109 TGAGGAGTCCAAGACCAGCCTGG - Intergenic
1092271605 12:7028351-7028373 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1092550945 12:9499075-9499097 TGAGGAGTTCAAGACCAGGCTGG - Intergenic
1093070581 12:14704137-14704159 TGAGCAATCCAAGAAGAAGGAGG + Intergenic
1093469006 12:19481310-19481332 TCAGCAGTTCAAGACGAGCCTGG - Intronic
1093486826 12:19661561-19661583 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1093611100 12:21158482-21158504 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1094371161 12:29739233-29739255 TGAGCAGTGGGAGATGAGGTTGG - Intronic
1094571279 12:31643630-31643652 TCAGCAGTTCAAGACCAGGCTGG - Intergenic
1094613999 12:32019908-32019930 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1095410268 12:41913804-41913826 AGTGCAGTGCAAGATGTGGCTGG + Intergenic
1095522290 12:43081970-43081992 TGGGAAGTCCAAGAAGGGGCTGG + Intergenic
1095764065 12:45874912-45874934 CTAGGAGTTCAAGATGAGGCTGG + Intronic
1096064255 12:48726811-48726833 TCAGCAGTTCAAGACCAGGCTGG + Intergenic
1096189695 12:49608279-49608301 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1096201008 12:49682995-49683017 TGAGGAATCTGAGATGAGGCGGG - Intronic
1096300573 12:50423963-50423985 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1096443854 12:51670483-51670505 GGAACAGTGGAAGATGAGGCTGG + Intronic
1096804044 12:54129508-54129530 TCCGCAGCCCAAGGTGAGGCGGG - Intergenic
1097175568 12:57140941-57140963 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1097239528 12:57565562-57565584 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1098226165 12:68327440-68327462 GGAGCAGACCAAGATGAGAAGGG + Intronic
1098428523 12:70393410-70393432 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1100572469 12:95856260-95856282 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1100892843 12:99145374-99145396 AGAGCAGTGAAAGATAAGGCTGG + Intronic
1102040052 12:109794806-109794828 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1102149986 12:110682406-110682428 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1102175258 12:110869216-110869238 TGAGAAGTTCTAGATGAGGAAGG - Intronic
1102303336 12:111786993-111787015 TCAGAAGTCCAAGAGGAGCCTGG + Intronic
1102328418 12:112009626-112009648 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1102637051 12:114333590-114333612 TGAGAAGACCAAGGTGAGGTGGG - Intergenic
1103110520 12:118273603-118273625 TCAGCAGTTCAAGACCAGGCTGG + Intronic
1103441882 12:120969090-120969112 GGGGCTGTGCAAGATGAGGCTGG + Intergenic
1103487359 12:121292336-121292358 TTAGGAGTTCAAGATCAGGCTGG - Intronic
1103672587 12:122630269-122630291 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1103942105 12:124506754-124506776 TGAGGAGTCAGAGAGGAGGCTGG + Intronic
1104433847 12:128739937-128739959 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1104719164 12:131035081-131035103 AGAGAGGTTCAAGATGAGGCTGG - Intronic
1106000192 13:25715175-25715197 GGAGTAGTGCAAGATGAGGCTGG + Intronic
1106066366 13:26355402-26355424 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1106128072 13:26917089-26917111 TGAGAAGTCCAAGATCAAGGAGG + Intergenic
1106606281 13:31232138-31232160 TGAGCGGTGGAAGATGAAGCTGG - Intronic
1106936824 13:34731583-34731605 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1107043253 13:35970692-35970714 TGAGAAGTCCAAGATCAAGGTGG - Intronic
1107584007 13:41824227-41824249 TGAGAGGTGAAAGATGAGGCTGG + Intronic
1107798446 13:44079612-44079634 AGCGCAGTCCAGGAAGAGGCAGG + Intergenic
1107855445 13:44611103-44611125 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1108699140 13:52928948-52928970 TGAGCCGTGTGAGATGAGGCAGG + Intergenic
1109403905 13:61873066-61873088 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1110490231 13:76095265-76095287 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1110615302 13:77535024-77535046 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1111176429 13:84602258-84602280 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1111242351 13:85491849-85491871 TCAGGAGTCCAAGATCAGCCTGG - Intergenic
1112017185 13:95341004-95341026 TGAGGAGTTCAAGATGAGCCTGG - Intergenic
1112119677 13:96396102-96396124 TGAGGAGTTCAAGACGAGCCTGG + Intronic
1112915832 13:104549503-104549525 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1114070585 14:19102488-19102510 TCAGCAGTTAAAGATGAGCCCGG + Intergenic
1114091676 14:19297517-19297539 TCAGCAGTTAAAGATGAGCCCGG - Intergenic
1114278437 14:21168950-21168972 TGGGGAGTCCAAGATGAGTAGGG + Intergenic
1114284101 14:21223537-21223559 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1114933827 14:27507800-27507822 TGAGGAGTCCAAGAACAGCCTGG - Intergenic
1114973418 14:28063086-28063108 AGAGCAGTCCAAGATGAGGCTGG - Intergenic
1115263264 14:31474789-31474811 TGAGCACTCAAGGCTGAGGCTGG - Intergenic
1115560946 14:34582414-34582436 TCAGGAGTCCAAGACGAGCCTGG - Intronic
1116829448 14:49703550-49703572 TGAGGAGTCCAAGATCAACCTGG - Intronic
1117407917 14:55422458-55422480 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1117854714 14:60016413-60016435 CCAGGAGTTCAAGATGAGGCTGG - Intronic
1117967300 14:61219058-61219080 TAAACAGTCCAAGCTGTGGCTGG + Intronic
1118542486 14:66843335-66843357 TGGGCAGGGCAAGATCAGGCAGG - Intronic
1118987257 14:70767172-70767194 TCAGCAGTTCAAGACGAGACTGG + Intronic
1119055324 14:71413526-71413548 TGAGGAGTTCAAGATTAGCCTGG + Intronic
1119336874 14:73840709-73840731 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1120028630 14:79614604-79614626 TTAGCAGTGCAAGATGTGACAGG - Intronic
1120284218 14:82477066-82477088 TGAGGAGTCCAAGACCAGACTGG - Intergenic
1120860421 14:89250318-89250340 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1121095755 14:91217041-91217063 TGAGGAGCCCCAGAGGAGGCGGG - Intronic
1121376867 14:93419376-93419398 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1122159772 14:99774493-99774515 TGAGGAGTCCCAGAGGAGGAGGG - Intronic
1123758461 15:23415100-23415122 TCAGAAGCCCAAGTTGAGGCTGG + Intergenic
1124010680 15:25836156-25836178 TGAGGAGTTCAAGATCAGCCTGG - Intronic
1124843578 15:33267803-33267825 TCAGGAGTCCAAGATCAGCCTGG - Intergenic
1124888471 15:33709690-33709712 TGAGAAGTCCAAGATCAAGGAGG - Intronic
1125345058 15:38710923-38710945 TCAGCAGTTCAAGATGAGCCTGG - Intergenic
1126138968 15:45420780-45420802 TCAGGAGTTCAAGATGAGCCCGG + Intronic
1126231850 15:46336331-46336353 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
1126754110 15:51907839-51907861 TCACCAGTCCAGGAAGAGGCTGG + Intronic
1127803676 15:62499237-62499259 TCAGGAGTCCAAGATCAGCCTGG + Intronic
1128538950 15:68511654-68511676 TGAGCAGAGGAAGAGGAGGCTGG + Intergenic
1128753782 15:70167164-70167186 AGAGCACTGAAAGATGAGGCTGG - Intergenic
1128920773 15:71608010-71608032 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1129260326 15:74363441-74363463 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1130401859 15:83563845-83563867 TCAGCAGTTCAAGACCAGGCTGG - Intronic
1130415174 15:83686979-83687001 TGAGGAGTTCGAGATGAGTCTGG + Intronic
1130901143 15:88207605-88207627 TGAGAAGACAAAGAAGAGGCAGG - Intronic
1131007916 15:88993654-88993676 TGAGCAGTTCAAGATCAGCCCGG + Intergenic
1131186424 15:90278442-90278464 TGAGGAGTCCAAGACCAGCCTGG - Intronic
1131213073 15:90514307-90514329 TCAGCAGTTCAAGACCAGGCTGG - Intergenic
1131655655 15:94455547-94455569 CTTGCAGTCCAAGCTGAGGCAGG - Intronic
1132121130 15:99176399-99176421 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1132576939 16:668546-668568 TGAGTAGTCCACGATGTGGGTGG - Exonic
1132796992 16:1729513-1729535 TGAGAGGTCCAAGATGCAGCAGG + Exonic
1133110900 16:3547876-3547898 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1133198577 16:4188237-4188259 TGAGGAGTACAAGATCAGCCTGG + Intergenic
1133262204 16:4558235-4558257 TCAGCAGTCAAAGGTGAGCCAGG - Intronic
1133353454 16:5118443-5118465 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1133548082 16:6827610-6827632 TGAGCAGTGAAGGATGGGGCTGG - Intronic
1133940553 16:10305677-10305699 TCAGGAGTTCAAGATGAGCCAGG - Intergenic
1134240268 16:12500885-12500907 TGAGGGGACCAAGGTGAGGCGGG - Intronic
1134457878 16:14407781-14407803 TCAGAAGCCCAAGTTGAGGCCGG - Intergenic
1134490274 16:14690985-14691007 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1134495655 16:14730102-14730124 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1134501203 16:14770415-14770437 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1134579377 16:15358617-15358639 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1134654174 16:15934629-15934651 TGAGGAGTCCAAGACAAGCCTGG - Intergenic
1134669812 16:16046552-16046574 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1134675734 16:16089335-16089357 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1134699697 16:16255120-16255142 TCAGCAGTCCAAGACCAGCCTGG - Intronic
1134723205 16:16398934-16398956 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1134944223 16:18312936-18312958 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1135015711 16:18923432-18923454 TCAGGAGTCCAAGAACAGGCTGG + Intronic
1135018550 16:18944616-18944638 TGAAAAGTCTAAGATAAGGCGGG - Intergenic
1135374160 16:21930738-21930760 TCAGGAGTCCAAGAACAGGCCGG + Intergenic
1135437626 16:22439983-22440005 TCAGGAGTCCAAGAACAGGCCGG - Intergenic
1135611692 16:23873116-23873138 TCAGGAGTCCAAGACCAGGCTGG + Intronic
1135694807 16:24576165-24576187 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1135812965 16:25606448-25606470 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
1136165647 16:28451282-28451304 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1136197325 16:28663727-28663749 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1136213664 16:28777874-28777896 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1136244772 16:28968333-28968355 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1136258397 16:29057798-29057820 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1136320098 16:29478518-29478540 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1136332807 16:29592362-29592384 TCAGGAGTCCAAGAACAGGCCGG + Intergenic
1136434669 16:30217859-30217881 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1136447499 16:30332449-30332471 TCAGGAGTCCAAGAACAGGCCGG + Intergenic
1137596757 16:49728940-49728962 TCAGCAGTCCAAGACCAGCCTGG - Intronic
1137698086 16:50476071-50476093 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1139175161 16:64678467-64678489 TGAGGAGACCAAGACAAGGCTGG + Intergenic
1139416546 16:66815870-66815892 TCAGGAGTCCAAGACGAGCCTGG - Intronic
1139486188 16:67257817-67257839 AGAGCAGAGCATGATGAGGCTGG - Intronic
1140284257 16:73586177-73586199 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1140446559 16:75033644-75033666 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1140740745 16:77939013-77939035 TGAGCAGTCCAGGTTGATGCAGG - Intronic
1140902840 16:79385689-79385711 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1142405816 16:89889029-89889051 TGGGCAGCCCCAGATGAGGATGG + Intronic
1142746135 17:1959430-1959452 AGAGCAGACCAAGAAGAAGCAGG - Intronic
1142933742 17:3310264-3310286 TGAGCAGTGTTAGATGGGGCCGG - Intergenic
1142942454 17:3393259-3393281 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1143315087 17:6026455-6026477 AGAGAAGTCCAAGAAGATGCCGG - Intronic
1143408191 17:6691914-6691936 GGAGAAGTAGAAGATGAGGCTGG - Intronic
1143898966 17:10158843-10158865 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1145242010 17:21245630-21245652 ACAGCAGGCCAAGATGACGCTGG + Intronic
1145932555 17:28696385-28696407 TGAGGAGTTCAAGACGAGCCTGG + Intronic
1146010932 17:29193914-29193936 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1146887290 17:36480896-36480918 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1147264896 17:39228666-39228688 TCAGGAGTTCAAAATGAGGCTGG - Intergenic
1147857069 17:43489212-43489234 TTAGGAGTTCAAGATGAGCCTGG - Intronic
1148006522 17:44435624-44435646 TGAGGAGTTCAAGATCAGCCTGG - Intronic
1148498711 17:48072218-48072240 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1148639825 17:49178882-49178904 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1148860497 17:50601985-50602007 GGAGCAGCCCAAGACTAGGCGGG + Intronic
1149220053 17:54406691-54406713 TGAGTATTCCAAGATGGGGTGGG + Intergenic
1149259721 17:54865499-54865521 TGAGCCGTCAAAGAGGAGGGAGG + Intergenic
1149933550 17:60780510-60780532 TCAGCAGTCCAAGATCAGCCTGG - Intronic
1150173032 17:63020135-63020157 TGAGGAGTTCAAGACGAGCCTGG - Intronic
1150438269 17:65170820-65170842 CCAGTAGTCAAAGATGAGGCAGG + Intronic
1150484425 17:65533809-65533831 TGAGCAGACCTAGGTGGGGCAGG - Intronic
1151597149 17:75085379-75085401 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1152121367 17:78420553-78420575 TGAGGAGTCAAAGATGAGCCAGG + Intronic
1152127980 17:78458868-78458890 TCAGCAGTGCAAGAGGATGCAGG - Intronic
1152230042 17:79109839-79109861 GGAGCAGCCGAGGATGAGGCGGG + Intronic
1203168937 17_GL000205v2_random:128927-128949 TCAGAAGTTCAAGATGAGCCTGG + Intergenic
1153875699 18:9368601-9368623 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1154170100 18:12045305-12045327 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1155162219 18:23205401-23205423 TGAGCAGTTCAAGACCAGCCTGG - Intronic
1155294424 18:24372064-24372086 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1156043616 18:32852984-32853006 TTAGCAGTCCAAGACAGGGCAGG + Intergenic
1156504737 18:37582618-37582640 TGAAAAGTCTAAGATGAGGGTGG - Intergenic
1156712320 18:39961991-39962013 TGAGAACTCCAGAATGAGGCAGG + Intergenic
1157251752 18:46101683-46101705 TCAGGAGTTCAAGATGAGTCTGG + Intronic
1157399552 18:47376173-47376195 TGAGGAGTTCAAGATCAGACTGG - Intergenic
1157742394 18:50105115-50105137 GAATCAGACCAAGATGAGGCTGG + Intronic
1160081820 18:75735160-75735182 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
1160375877 18:78411136-78411158 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1160997393 19:1889415-1889437 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
1161510294 19:4666854-4666876 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1161864774 19:6825813-6825835 TGAGGAGTTCAAGACCAGGCTGG + Intronic
1162289218 19:9766208-9766230 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1162720743 19:12661051-12661073 TAAGAAGTCCAGCATGAGGCCGG - Intronic
1162915097 19:13870443-13870465 TGAGAAGTCCTAGCAGAGGCAGG - Intronic
1163541429 19:17913253-17913275 TGAGCAGTTCAAGACCAGCCTGG - Intergenic
1163687787 19:18721936-18721958 TGGGCAGACCCAGAGGAGGCTGG - Intronic
1163911194 19:20195079-20195101 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1163971584 19:20801552-20801574 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1163973033 19:20818755-20818777 TCAGCTGTTCAAGATGAGCCTGG - Intronic
1164012444 19:21215755-21215777 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
1165225121 19:34349342-34349364 TGATCTGCACAAGATGAGGCCGG - Intronic
1165251969 19:34546144-34546166 TGAGAAGTCCAAGATCAAGGGGG - Intergenic
1166159826 19:40944190-40944212 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1166168774 19:41012157-41012179 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1166667735 19:44691288-44691310 TCAGAAGTCCAAGATGAGCCTGG + Intergenic
1166973005 19:46582930-46582952 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1167065898 19:47185809-47185831 TCAGTAGTTCAAGATCAGGCTGG - Intronic
1168040123 19:53751835-53751857 TCAGGAGTTCAAGATGAGCCCGG - Intergenic
1168236096 19:55063911-55063933 TGAGCAGTGCAAGGGGAAGCAGG - Intronic
1168619880 19:57869733-57869755 TCAGGAGTCCAAGATCAGCCTGG + Intronic
1168659082 19:58152318-58152340 TCAGGAGTTCAAGATGAGCCTGG + Intronic
925375739 2:3383614-3383636 TCAGGAGTTCAAGATGAGCCTGG - Intronic
925554844 2:5119851-5119873 TCAGAAGTCCAAGATCAGTCGGG - Intergenic
925966395 2:9071037-9071059 TGAGCAGTCCAAGATTAGCAAGG + Intergenic
926115658 2:10211519-10211541 TCAGGAGTCCAAGATCAGCCTGG + Exonic
926307467 2:11648809-11648831 TGGGCACTCCAAAATGAGGGAGG - Intergenic
926719042 2:15945207-15945229 TGAGGAGTTCAAGATCAGCCTGG - Intronic
926856590 2:17262960-17262982 TGTGCATTCCATGCTGAGGCAGG - Intergenic
928541680 2:32291323-32291345 TTAGAAGTTCAAGATGAGCCTGG + Intronic
928554368 2:32408175-32408197 TCAGGAGTTCAAGATGAGCCTGG - Intronic
928710185 2:33996046-33996068 TCAGGAGTTCAAGATTAGGCTGG + Intergenic
928771494 2:34707289-34707311 TGAGAAGTCCAAGATGAAGGTGG - Intergenic
929849183 2:45567398-45567420 TCAGGAGTTCAAGATGAGCCTGG + Intronic
929970755 2:46573271-46573293 TCAGGAGTCCAAGATCAGCCTGG - Intronic
933109255 2:78376329-78376351 TGAGGAGTTCAAGATCAGCCTGG - Intergenic
934682134 2:96291741-96291763 TGAGCAGTGCAAGGTGAGGAGGG - Exonic
935284539 2:101552458-101552480 TGAGCAGTTCAAGACCAGCCTGG + Intergenic
935571859 2:104670424-104670446 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
936236981 2:110750892-110750914 TGAGGAGTTCAAGATCAGCCTGG - Intronic
936386567 2:112034940-112034962 TGAGCAGTTCAAGGGGATGCAGG + Intergenic
937275593 2:120681943-120681965 TGAGATGTCCAAGATGGGTCTGG - Intergenic
937551371 2:123096176-123096198 GGTGAAGCCCAAGATGAGGCTGG - Intergenic
937671792 2:124545880-124545902 TCAGGAGTTCAAGATTAGGCTGG + Intronic
938780507 2:134580700-134580722 TCAGCAGTTCAAGATCAGCCTGG + Intronic
938839606 2:135147134-135147156 TCAGGAGTCCAAGACGAGCCTGG + Intronic
938917016 2:135952029-135952051 TGAGGAGTTCAAGACCAGGCTGG + Intronic
940763498 2:157764415-157764437 TCAGGAGTTCAAGATGAGCCTGG - Intronic
942343559 2:174976446-174976468 TCAGGAGTTCAAGATCAGGCTGG - Intronic
943017103 2:182527255-182527277 TCAGCAGTTCAAGATTAGCCTGG + Intergenic
943245044 2:185436038-185436060 TGAGAAGTTCAAGATCAGCCTGG - Intergenic
944485494 2:200200783-200200805 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
944576398 2:201095142-201095164 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
945231682 2:207596640-207596662 TCAGGAGTCCAAGATCAGCCTGG - Intronic
946367566 2:219258632-219258654 TCAGAAGTCCAAAATGAGCCAGG - Intronic
947171630 2:227318468-227318490 TCAGGAGTCCAAGACCAGGCTGG + Intergenic
947532422 2:230920363-230920385 TGAGCATTTCAAGATGGGGCTGG + Intronic
948888489 2:240895812-240895834 GGAGTAGTCCACGATGAAGCGGG + Exonic
948911517 2:241006845-241006867 AGAGAAGTGCAAGATGAGCCTGG + Intronic
1169086481 20:2828072-2828094 TCAGGAGTCCAAGATCAGCCTGG + Intergenic
1169222566 20:3834006-3834028 TCAGGAGTCCAAGACAAGGCTGG + Intergenic
1169373988 20:5051326-5051348 TGAGGAGTTCAAGACCAGGCTGG - Intergenic
1169563032 20:6822602-6822624 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1170510187 20:17068369-17068391 TGAGAAGACCCAGAGGAGGCAGG + Intergenic
1170823241 20:19771875-19771897 TGAGGAGGGCAAGAGGAGGCAGG - Intergenic
1171316887 20:24203159-24203181 GGAGCAGTTCAAGATGAGGGTGG - Intergenic
1171541038 20:25956599-25956621 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1171800024 20:29603709-29603731 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1173151887 20:40573601-40573623 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1173560170 20:43998967-43998989 TCAGGAGTCCAAGATGAGCCTGG - Intronic
1173583871 20:44166959-44166981 TGAGCAGTCCAAGATGAGGCAGG - Intronic
1174196836 20:48778362-48778384 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1175155054 20:56965512-56965534 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1175373004 20:58505272-58505294 TCAGAAGTTCAAGATGAGCCTGG - Intronic
1175994579 20:62806331-62806353 TCAGGAGTCCAAGATTAGCCTGG + Intronic
1176281458 20:64316188-64316210 TGGGAAGGCCAAGATAAGGCTGG + Intergenic
1176332989 21:5566810-5566832 TCAGAAGTTCAAGATGAGCCTGG - Intergenic
1176394768 21:6254142-6254164 TCAGAAGTTCAAGATGAGCCTGG + Intergenic
1176402817 21:6330227-6330249 TCAGAAGTTCAAGATGAGCCTGG - Intergenic
1176434340 21:6658877-6658899 TCAGAAGTTCAAGATGAGCCTGG + Intergenic
1176442389 21:6734963-6734985 TCAGAAGTTCAAGATGAGCCTGG - Intergenic
1176458602 21:6985947-6985969 TCAGAAGTTCAAGATGAGCCTGG + Intergenic
1176466651 21:7062032-7062054 TCAGAAGTTCAAGATGAGCCTGG - Intronic
1176490212 21:7443810-7443832 TCAGAAGTTCAAGATGAGCCTGG - Intergenic
1177028774 21:15955527-15955549 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
1177373626 21:20239362-20239384 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
1177490952 21:21825366-21825388 TGAGGAGTTCAAGATCAGCCTGG - Intergenic
1177781157 21:25623677-25623699 TCAGCAGGACAAGGTGAGGCTGG - Intergenic
1177818967 21:26010598-26010620 TCAGCAGTTCAAGATCAGCCTGG + Intronic
1178428708 21:32500358-32500380 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1178537663 21:33423781-33423803 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1178670750 21:34589739-34589761 TGAGCTGTCCCAGCTCAGGCAGG - Intronic
1180489055 22:15824954-15824976 TCAGCAGTTAAAGATGAGCCCGG + Intergenic
1180685571 22:17664056-17664078 TCAGGAGTCCAAGACCAGGCTGG - Intronic
1180781847 22:18524890-18524912 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1180991710 22:19941204-19941226 TGAGCACTCGAAGCAGAGGCTGG - Intronic
1181082464 22:20424351-20424373 TGACCAGTCCAGAATGGGGCAGG + Intergenic
1181238733 22:21464234-21464256 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1181953651 22:26572556-26572578 TAAGCAGCCCAAGATAAGGTGGG - Intronic
1182340199 22:29614230-29614252 TCAGGAGTTCAAGACGAGGCTGG + Intronic
1182381252 22:29890305-29890327 TCAGCAGTTCAAGACCAGGCTGG + Intronic
1182555627 22:31127047-31127069 TGAGCAGGCCCAGAAGAGGATGG + Intronic
1183869892 22:40733420-40733442 TGAGCAGTTCAAGACCAGCCTGG - Intergenic
1183887346 22:40895542-40895564 TCAGCAGTTCAAGATTAGCCTGG - Intronic
1183999194 22:41659893-41659915 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1184279350 22:43428233-43428255 AGAGCAGTCCAGGATGGGGTGGG - Intronic
1184548720 22:45192012-45192034 TGAGGAGTCCGAGAAGAGGTGGG - Intronic
1184686860 22:46100151-46100173 TGATCCGTGGAAGATGAGGCTGG + Intronic
1184832508 22:46997797-46997819 TGAGCAGGCCAGGATGCTGCCGG - Intronic
1185187480 22:49410732-49410754 TGAGGAGTTCAAGATCAGCCTGG - Intergenic
1185245807 22:49772054-49772076 TGAGCAGCCCAGGAAGTGGCTGG + Intergenic
950997997 3:17525338-17525360 TCAGGAGTTCAAGATCAGGCTGG - Intronic
951465222 3:22993346-22993368 TCAGGAGTCCAAGATGAGTCTGG - Intergenic
951540088 3:23774104-23774126 TGAGGAGTTCAAGACCAGGCTGG + Intergenic
952042183 3:29274335-29274357 TGAGCAGTCCAACATCATGGTGG + Intergenic
952111667 3:30130793-30130815 GGAGCAGTCAAAGATGAATCAGG - Intergenic
952269902 3:31820383-31820405 TCAGGAGTCCAAGATCAGCCTGG + Intronic
952279239 3:31907415-31907437 TCAGCAGTTCAAGATCAGCCTGG + Intronic
952419446 3:33118168-33118190 TCAGGAGTCCAAGATCAGCCTGG - Intronic
953495982 3:43387383-43387405 CCAGCACCCCAAGATGAGGCTGG - Intronic
954137269 3:48587765-48587787 GGAGCACGCCAAGGTGAGGCAGG + Intronic
954535720 3:51358041-51358063 TGATCAGTTCCAGATGATGCGGG + Exonic
955422926 3:58758002-58758024 TGAGTATCCCAAGAGGAGGCTGG + Intronic
956101983 3:65778218-65778240 TAAGGAGTTCAAGATCAGGCTGG + Intronic
956727194 3:72165576-72165598 TGAGCAGTCAAAGACAAGACAGG - Intergenic
956845047 3:73174976-73174998 TGGGAAGTCCAAGATAAGGATGG + Intergenic
957521499 3:81324304-81324326 TGTGCAATCCAAGTTGATGCAGG + Intergenic
957691870 3:83581172-83581194 TAAGCAGTCCAAGGTCAGGGAGG + Intergenic
958429514 3:94021402-94021424 TCAGGAGTTCAAGATGAGCCTGG - Intronic
959031375 3:101302738-101302760 TGAGCAGTTAAAAATGTGGCAGG + Intronic
959247820 3:103897927-103897949 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
960812031 3:121634839-121634861 CCAGGAGTTCAAGATGAGGCTGG - Intronic
961086429 3:124071579-124071601 TGAGAAGTCCAAGATCAAGGAGG + Intergenic
961283288 3:125780041-125780063 TGAGCAGTCCTGTATGAGGTCGG + Intergenic
961512376 3:127410934-127410956 GGAACAGCCCAAGATAAGGCTGG - Intergenic
961714366 3:128848509-128848531 TGTGCACTCTAAAATGAGGCAGG + Intergenic
961825069 3:129595040-129595062 TGGGCTGTCCAAGCTGAGGGAGG - Intronic
961987668 3:131154805-131154827 CAAGCAGTGCAAGATGAAGCTGG + Intronic
962091660 3:132250627-132250649 TGAGCAGAAATAGATGAGGCAGG - Intronic
962448121 3:135486916-135486938 CCAGCAGTTCAAGATCAGGCTGG + Intergenic
962709995 3:138078206-138078228 GGAGCAGTCCAAGGTGAGTCAGG + Intronic
963015991 3:140824444-140824466 TTAGGAGTCCAAGATCAGCCTGG - Intergenic
963108755 3:141667780-141667802 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
963277060 3:143342392-143342414 TCAGCAGTTCAAGATCAGCCTGG - Intronic
963929130 3:150983716-150983738 TGACCAGTCCAAGATGTGCCAGG + Intergenic
964175147 3:153819002-153819024 TGAGCAGTGAAAGGTGAGACGGG + Intergenic
964487099 3:157197335-157197357 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
964488066 3:157206212-157206234 TCAGGAGTCCAAGACCAGGCTGG + Intergenic
965408728 3:168302932-168302954 TCAGCAGTTCAAGACCAGGCTGG + Intergenic
965481051 3:169220115-169220137 TTAGGAGTTCAAGATGAGTCTGG + Intronic
965533841 3:169803639-169803661 TGAGGAGTCCAAGACCAGCCTGG - Intronic
966014350 3:175122854-175122876 TGAGAAGTCCAAGATCAAGGAGG + Intronic
966849083 3:184153715-184153737 GGAACAGTCCTAGGTGAGGCTGG - Intronic
967485912 3:190030360-190030382 CCAGCAGTTCAAGATGAGCCTGG + Intronic
968176332 3:196552764-196552786 TGAGAAGTCCAAGAACAGTCAGG - Intergenic
968180845 3:196594066-196594088 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
968192075 3:196675859-196675881 TCAGGAGTTCAAGACGAGGCTGG - Intronic
968578616 4:1379373-1379395 TGTGCCGGCCAAGAGGAGGCCGG - Intronic
970157029 4:13151882-13151904 AAAGCAGACCAAGATGATGCAGG - Intergenic
970532124 4:16995597-16995619 TGAGCATTCCAGAATGATGCTGG + Intergenic
970789239 4:19836968-19836990 AGAGTGGTCCAAGATGAGGTCGG - Intergenic
971537589 4:27772933-27772955 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
972067769 4:34972224-34972246 TCAGAAGTTCAAGATGAGGCAGG - Intergenic
972376250 4:38473857-38473879 TCAGAAGTTCAAGATGAGTCTGG - Intergenic
973582397 4:52357176-52357198 TGAGCAGTCCAAGATCAAGGTGG - Intergenic
973637842 4:52876538-52876560 TCAGGAGTTCAAGATGAGCCTGG + Intronic
973932384 4:55806174-55806196 CCAGCAGTTCAAGATGAGCCTGG + Intergenic
973958537 4:56087220-56087242 TCAGGAGTCCAAGATCAGCCTGG - Intergenic
974668745 4:65000891-65000913 TGGGAAGTCCAAGATGAAGGTGG + Intergenic
974881197 4:67759375-67759397 TGAGCAGTTCAAGATCAGCCTGG + Intergenic
975021953 4:69501501-69501523 TGAACAGTCCAAGATGACTGGGG + Intronic
975194067 4:71502168-71502190 TCAACAGTTCAAGATGAGTCTGG - Intronic
976151349 4:82095422-82095444 TCAGCAGTTCAAGACCAGGCTGG + Intergenic
980442287 4:132865110-132865132 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
980530775 4:134050493-134050515 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
980780746 4:137488426-137488448 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
981053163 4:140331770-140331792 TGAGCAGGTGAAGATGAGTCTGG - Intronic
981106772 4:140890680-140890702 TGGGAAGTCCAAGATCAGGATGG - Intronic
982486227 4:155968760-155968782 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
983236106 4:165181064-165181086 TGAGGAGTTCAAGACCAGGCTGG + Intronic
983557784 4:169073844-169073866 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
983591251 4:169413805-169413827 TCAGGAGTTCAAGATGAGCCTGG + Intronic
984017174 4:174440700-174440722 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
984275157 4:177600513-177600535 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
984509000 4:180656187-180656209 GGAGTAGTCCAAAATTAGGCAGG - Intergenic
985009626 4:185569128-185569150 TCAGGAGTTCAAGATGAGACTGG - Intergenic
985095648 4:186410088-186410110 AAGGAAGTCCAAGATGAGGCTGG + Intergenic
986072839 5:4303900-4303922 GCATCAGTCGAAGATGAGGCCGG + Intergenic
987405092 5:17517073-17517095 TCAGCAGTTCAAGATCAGCCGGG + Intergenic
987568928 5:19630149-19630171 TGAGGAGTTCAAGACCAGGCTGG - Intronic
987802402 5:22715925-22715947 TCAGGAGTTCAAGATGAGCCTGG + Intronic
989038001 5:37195389-37195411 TGAGGAGTTCAAGATCAGCCTGG + Intronic
989999240 5:50873723-50873745 TGAGAAGTCCAAGATCAAGAAGG + Intergenic
990499397 5:56380669-56380691 TTAGGAGTTCAAGATGAGCCTGG + Intergenic
991300072 5:65121457-65121479 TGAGAAGTCCAAGATCAAGTTGG + Intergenic
991721633 5:69499147-69499169 TGAGCAGAGGAAGTTGAGGCTGG - Intronic
992056945 5:72999590-72999612 TCAGAAGTTCAAGATCAGGCTGG - Intronic
992738550 5:79748751-79748773 TGAGGAGTTCAAGATCAGCCTGG - Intronic
993836165 5:92822690-92822712 TGAGCAGCTGAAGATGAGGATGG - Intergenic
995517355 5:112967368-112967390 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
996606551 5:125329804-125329826 ATAGCTGTCCAAGATGAGCCAGG - Intergenic
996674306 5:126156818-126156840 TGAGGAGTCCAAGACCAGCCTGG - Intergenic
996736505 5:126763476-126763498 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
997531303 5:134583098-134583120 TGAGCAGGACAGGATGGGGCTGG - Exonic
997798115 5:136831846-136831868 TCAGGAGTCCAAGATCAGCCTGG - Intergenic
997979942 5:138462825-138462847 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
998189393 5:140010086-140010108 TGAGCAGTTCAAGACCAGTCTGG + Intronic
998219509 5:140265183-140265205 TGGGCTGTCCAAGCAGAGGCTGG - Intronic
998326534 5:141285501-141285523 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
998469573 5:142373013-142373035 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
998611737 5:143696397-143696419 TCAGGAGTTCAGGATGAGGCTGG + Intergenic
999660067 5:153852091-153852113 TCAGGAGTCCAAGACCAGGCTGG + Intergenic
999685242 5:154096983-154097005 TGAGCAGTCCAGGGTCAGGACGG - Intronic
1000017756 5:157293263-157293285 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1000049977 5:157554441-157554463 TGAACTGTCCAATATGAGGTTGG - Intronic
1000074671 5:157773755-157773777 TGAGGAGTTCAAGACCAGGCTGG + Intergenic
1000217231 5:159172279-159172301 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1000790534 5:165601614-165601636 TGGGCAGTCCAGGAGGAAGCAGG - Intergenic
1001815532 5:174666127-174666149 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1001962958 5:175891505-175891527 TGAGGAGTCCAAGACCAGCCTGG + Intergenic
1002362573 5:178684826-178684848 TCAGCAGTCCAAGACCAGCCTGG + Intergenic
1002802661 6:540162-540184 TGAGGAGTTCAAGACGAGCCTGG - Intronic
1003091700 6:3109327-3109349 TCAGCAGTCCAGGCAGAGGCAGG + Intronic
1003181475 6:3795549-3795571 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1003183332 6:3810336-3810358 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1003415645 6:5905603-5905625 AGAGCAGTCCATGAGGAGGAGGG - Intergenic
1003823151 6:9923036-9923058 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1004126624 6:12880463-12880485 TGAGAAGTTCCAGATGAGCCTGG - Intronic
1004612865 6:17262359-17262381 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1005069134 6:21848461-21848483 TGAGAAGTTCAAGACCAGGCTGG + Intergenic
1005476333 6:26211515-26211537 TCAGGAGTTCAAGATCAGGCTGG + Intergenic
1005615945 6:27573312-27573334 TCAGAAGTCCAAGATCAAGCAGG - Intergenic
1005718073 6:28571102-28571124 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1006123667 6:31823195-31823217 TCAGAAGTCCAAGATCAGCCTGG - Intergenic
1006622499 6:35375761-35375783 TGAGGAGTTCAAGACGAGCCTGG - Intronic
1006955149 6:37862974-37862996 TGAGCAAGCCAAGGGGAGGCTGG - Intronic
1007495262 6:42255832-42255854 TCAGAAGTCCAGGATGAGGCTGG + Intronic
1008002472 6:46375152-46375174 TGAGGAGTTCAAGATCAGCCTGG - Intronic
1008057235 6:46957456-46957478 TGAGAAGCCCCAGGTGAGGCTGG + Intergenic
1008456788 6:51720375-51720397 TGAGCAGCCTGAGATGAGGCTGG - Intronic
1008615421 6:53221486-53221508 TCAGGAGTTCAAGACGAGGCTGG - Intergenic
1008693159 6:54003821-54003843 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1009580382 6:65526035-65526057 TGAGAAGTCCAAGGTCAGGGAGG + Intronic
1010044797 6:71429082-71429104 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1010112276 6:72251922-72251944 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1010183727 6:73118809-73118831 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1011517158 6:88166665-88166687 TGACCAGGCCAAGAAGGGGCTGG + Intergenic
1012885835 6:104844871-104844893 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1013211835 6:107993974-107993996 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1013358596 6:109371457-109371479 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1014535219 6:122606361-122606383 TCAGGAGTCCAAGACGAGCCTGG + Intronic
1014895665 6:126896660-126896682 TGAGCTGCCCAACATGAGCCGGG + Intergenic
1014932750 6:127353438-127353460 TGAGAAGTCCAAGGTCAGGGTGG + Intergenic
1015920315 6:138259700-138259722 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1016355870 6:143217716-143217738 TGAGAAGTTCCAGATGAGCCTGG - Intronic
1016356106 6:143220033-143220055 TGAGCAGCTCAAGATGAGGTTGG - Intronic
1016641438 6:146353839-146353861 TCAGAAGTTCAAGATGAGCCTGG - Intronic
1016717964 6:147255721-147255743 TTAGGAGTTCAAGATGAGCCCGG - Intronic
1017127846 6:151082249-151082271 TGTGCAGCCCAAGAAGATGCTGG - Intronic
1017150151 6:151272128-151272150 TGAGGAGTCCAAGACTAGCCTGG + Intronic
1018033946 6:159866278-159866300 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
1018035278 6:159876226-159876248 TGAGCAGTGCAGGCTGGGGCAGG - Intergenic
1018608233 6:165621544-165621566 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1022156517 7:27666205-27666227 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
1022209393 7:28193953-28193975 TCAGCAGTTCAAGACCAGGCTGG - Intergenic
1024649346 7:51390796-51390818 TGTGTAGGCCAACATGAGGCAGG + Intergenic
1024885598 7:54138551-54138573 TCAGGAGTTCAAGATGAGACTGG - Intergenic
1024941981 7:54772915-54772937 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1025036372 7:55594753-55594775 GGAGCAGTCACAGAAGAGGCTGG + Intergenic
1025059222 7:55789763-55789785 TGAGGAGTCCAAGACCAGCCTGG + Intergenic
1025292475 7:57742861-57742883 TTAGGAGTTCAAGATGAGCCTGG - Intergenic
1026222595 7:68413488-68413510 TCAGGAGTTCAAGATGAGCCCGG - Intergenic
1026352729 7:69531632-69531654 TCAGGAGTTCAAGATGAGTCTGG + Intergenic
1026505626 7:70980275-70980297 CCAGCAGTTCAAGTTGAGGCTGG - Intergenic
1026570544 7:71525947-71525969 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1027156927 7:75775008-75775030 TCAGGAGTTCAAGATGAGTCTGG + Intronic
1028230538 7:88301783-88301805 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1028518991 7:91707977-91707999 TGAGCAGTGCAAGCTGATGTTGG - Intronic
1029009221 7:97241099-97241121 TTAGGAGTCCAAGATCAGCCTGG + Intergenic
1030065902 7:105658925-105658947 TGAGGAGTTCAAGACCAGGCTGG + Intronic
1030582501 7:111375731-111375753 TGAAGAGTTCAAGATGAGCCTGG - Intronic
1030682508 7:112448977-112448999 GAAGCAGTGAAAGATGAGGCTGG + Intronic
1030771761 7:113484294-113484316 TCAGGAGTTCAAGATCAGGCTGG - Intergenic
1031730962 7:125299784-125299806 TGAGGAGTTCAAGATCAGCCTGG - Intergenic
1031988096 7:128176811-128176833 TGAGCAGTACAGGATGATGAAGG + Intergenic
1032592999 7:133210166-133210188 GAAGAAGTCCAAGATGATGCTGG - Intergenic
1032913776 7:136463511-136463533 TGAGCAGTGGGAGATGAGGCTGG - Intergenic
1032949530 7:136891629-136891651 ACAGCAGTTCAAGATGAGACTGG - Intronic
1033598468 7:142872497-142872519 GGAGAAGTCAGAGATGAGGCTGG + Intronic
1034525317 7:151656344-151656366 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1034566504 7:151919843-151919865 TGAGGAGTCCAAGCAGAAGCTGG + Intergenic
1034605424 7:152308464-152308486 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1035653997 8:1291817-1291839 TGAGCAGTACAAAGTGTGGCTGG - Intergenic
1035899079 8:3437948-3437970 TCAGCAGTTCGAGATGAGCCTGG - Intronic
1035899164 8:3438904-3438926 TTAGGAGTTCAAGATGAGTCTGG + Intronic
1035923834 8:3706423-3706445 TGAGCCTTCTAAGATGAGGAAGG - Intronic
1036142028 8:6217534-6217556 TGAGAAGCCCCTGATGAGGCTGG + Intergenic
1039348531 8:36734784-36734806 GGTTCAGACCAAGATGAGGCTGG + Intergenic
1039747418 8:40441583-40441605 TGAGTAGTCCAACATGAAGGTGG + Intergenic
1039900648 8:41749906-41749928 TAAGAAGTCCAAGATGAGGCTGG - Intronic
1041468257 8:58179892-58179914 TGTCCAGTCCAAGTTGTGGCAGG + Intronic
1042406288 8:68408996-68409018 TCAGGAGTTCAAGATCAGGCTGG - Intronic
1042738196 8:72012414-72012436 TGAGGAGTTCAAGATCAGACTGG - Intronic
1043084933 8:75817912-75817934 TGAGAAGTCCAAGATCAAGGTGG + Intergenic
1043409713 8:79981117-79981139 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1043448048 8:80338822-80338844 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1043882240 8:85557627-85557649 CCAGGAGTTCAAGATGAGGCTGG + Intergenic
1044957259 8:97493854-97493876 TGAGGAGTTCAAGATCAGCCTGG + Intergenic
1045203247 8:100009206-100009228 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1045395256 8:101754426-101754448 TGGGAAGTCCAAGATGAAGGTGG + Intronic
1045601938 8:103726946-103726968 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1046521627 8:115333076-115333098 TCAGGAGTTCAAGACGAGGCTGG - Intergenic
1046778038 8:118184704-118184726 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1047322824 8:123804274-123804296 TCAGGAGTTCAAGATGAGCCTGG + Intronic
1047353099 8:124094694-124094716 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1047484526 8:125316995-125317017 TGAGAAGTCCAAGACCAGTCTGG - Intronic
1047921588 8:129639961-129639983 TGACCATAGCAAGATGAGGCTGG + Intergenic
1048275257 8:133061216-133061238 TCAGGAGTCCAAGATCAGCCTGG - Intronic
1048581066 8:135730219-135730241 TGTTCTCTCCAAGATGAGGCAGG - Intergenic
1049542895 8:143216419-143216441 AGGGCAGGCCAGGATGAGGCTGG - Intergenic
1049682238 8:143924561-143924583 CGAGAAGTCCAAGCAGAGGCTGG - Exonic
1049968448 9:800224-800246 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1052758689 9:32567532-32567554 TGAGGAGTTCAAGATCAGCCTGG - Exonic
1052775320 9:32727288-32727310 TGAGGGGTCCAAGATGAAGATGG - Intergenic
1053308487 9:37000541-37000563 TCAGGAGTCCAGGATGAGCCTGG + Intronic
1055509354 9:76980100-76980122 TCAGCAGTTCAAGATGAGCCTGG - Intergenic
1055526344 9:77137654-77137676 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1056741170 9:89256689-89256711 TGGTCAGTACAAGATGAGGATGG - Intergenic
1056884431 9:90427523-90427545 TGTGCAGTCCATGGCGAGGCTGG - Intergenic
1057583301 9:96306702-96306724 TGAGAAGTCCAAGATCAAGGTGG - Intergenic
1057611355 9:96546657-96546679 TCAGGAGTTCAAGATGAGCCTGG - Intronic
1058656023 9:107221229-107221251 TGAGAAGTGTTAGATGAGGCAGG + Intergenic
1058701097 9:107600902-107600924 TCAGCAGTTCAAGACGAGCCTGG - Intergenic
1059067552 9:111101554-111101576 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1059328195 9:113517497-113517519 TGGGCAGTTCAAAAAGAGGCTGG - Intronic
1060598575 9:124862733-124862755 TGAGGAGTTCAAGATCAGCCTGG - Intronic
1061653027 9:132066372-132066394 AGAGCAGCCACAGATGAGGCTGG + Intronic
1061977839 9:134080798-134080820 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1203429097 Un_GL000195v1:73472-73494 TCAGAAGTTCAAGATGAGCCTGG + Intergenic
1203437197 Un_GL000195v1:149765-149787 TCAGAAGTTCAAGATGAGCCTGG - Intergenic
1185571403 X:1137581-1137603 TCAGCAGTTCAAGATCAGCCTGG - Intergenic
1186577189 X:10779165-10779187 AGAGCAGTCCAAGAAGTGGAAGG + Intronic
1186770762 X:12815850-12815872 TTAGGAGTTCAAGATGAGCCTGG - Intronic
1186831053 X:13390534-13390556 TCAGGAGTTCAAGATGAGCCTGG - Intergenic
1186885964 X:13914046-13914068 TAAGAAATCCATGATGAGGCAGG - Intronic
1186970668 X:14839082-14839104 TCAGGAGTTCAAGATGAGCCTGG + Intergenic
1187077256 X:15947481-15947503 TGAGGAGAGCAAGATGAGGCAGG - Intergenic
1187350721 X:18514495-18514517 TGAGGAGTTCAAGATCAGCCTGG + Intronic
1190135694 X:47795284-47795306 TGAGAAGTCCAAGGTCTGGCTGG - Intergenic
1191037376 X:56041331-56041353 TCAGGAGTTCAAGACGAGGCTGG - Intergenic
1191714796 X:64186873-64186895 TGAGAATTCCCAGATGAGACTGG - Exonic
1193677052 X:84467415-84467437 TGAGGAGTCCAAGACCAGCCTGG + Intronic
1194678682 X:96825163-96825185 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1195050651 X:101093794-101093816 TGAGAAGTCCAAGATCAAGGTGG + Intronic
1195057834 X:101163822-101163844 TCAGGAGTTCGAGATGAGGCTGG + Intergenic
1195088272 X:101434154-101434176 TCAGCAGTTCAAGATCAGCCTGG - Intronic
1197218351 X:123888122-123888144 TCAGGAGTTCAAGATCAGGCTGG + Intronic
1199953715 X:152725750-152725772 TGAGCAGTGGAAGGTGAGGGTGG + Intergenic
1201187577 Y:11419128-11419150 TCAGAAGTTCAAGACGAGGCTGG - Intergenic
1201341422 Y:12938120-12938142 TCAGCAGTTCAAGATCAGCCTGG + Intergenic
1202056381 Y:20835837-20835859 TCAGGAGTTCAAGATGAGCCTGG + Intergenic