ID: 1173583872

View in Genome Browser
Species Human (GRCh38)
Location 20:44166963-44166985
Sequence GTGGTGAGCAGTCCAAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583872_1173583875 1 Left 1173583872 20:44166963-44166985 CCTCATCTTGGACTGCTCACCAC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583872_1173583876 2 Left 1173583872 20:44166963-44166985 CCTCATCTTGGACTGCTCACCAC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583872_1173583874 0 Left 1173583872 20:44166963-44166985 CCTCATCTTGGACTGCTCACCAC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583872 Original CRISPR GTGGTGAGCAGTCCAAGATG AGG (reversed) Intronic
900679929 1:3911119-3911141 CTTCTGAGCAGTCCAGGATGGGG + Intergenic
902859892 1:19237619-19237641 GTGATGAGGAGTCCAGGCTGTGG + Intronic
903395488 1:22998863-22998885 TTGGGGTGCAGTCCAAGTTGGGG + Intergenic
903616384 1:24661856-24661878 GAGGTGAGCAGGCCGAGATCAGG + Intronic
904072552 1:27812805-27812827 GTGGTGATCCGTATAAGATGTGG - Intronic
904078326 1:27856497-27856519 GAGATGAGCACTCCAAGATGGGG + Intergenic
904771650 1:32884532-32884554 GAGCTGAGCAGCCCAAGATGGGG + Intergenic
904809269 1:33152850-33152872 GGGGAGAGCAGCCCAGGATGGGG + Intronic
905857122 1:41321510-41321532 GTGGTCAGCAGCCCAGGGTGGGG + Intergenic
909795642 1:79732203-79732225 GAGGTTAGAAGTCCAAGATCAGG + Intergenic
912177550 1:107178898-107178920 GAGGTGAGCATTCCCAGATGGGG - Intronic
912796265 1:112695439-112695461 ATGGAGCGCAGGCCAAGATGTGG - Exonic
913371432 1:118103951-118103973 GTGCAGAGTAGCCCAAGATGAGG + Intronic
913583491 1:120250120-120250142 GTGGTGAGCAGTAGGAGGTGAGG - Intergenic
913624684 1:120648199-120648221 GTGGTGAGCAGTAGGAGGTGAGG + Intergenic
914565478 1:148861957-148861979 GTGGTGAGCAGTAGGAGGTGAGG - Intronic
914607347 1:149268292-149268314 GTGGTGAGCAGTAGGAGGTGAGG + Intergenic
915545784 1:156596711-156596733 CTGGTGAGCAGAACAAGAAGAGG + Intronic
915648175 1:157288685-157288707 GTGCTGAACACTCCAGGATGGGG + Intergenic
915662490 1:157415821-157415843 GTGCTGAACACTCCAGGATGGGG - Intergenic
916184492 1:162117567-162117589 GAGGTCAGCAGTCCCAGCTGAGG - Intronic
916785284 1:168082621-168082643 GTGGGCAGCAGTCCTAAATGTGG + Exonic
917448271 1:175124996-175125018 GTGGTGGGCAGTCAAAGAGGTGG + Intronic
918920953 1:190709040-190709062 AGGCTGAGCAGTCCAAGATCAGG + Intergenic
919090915 1:192978412-192978434 GTGGTATGCAGTCCAAGTTGAGG + Intergenic
920387724 1:205580356-205580378 ATGGTGATCAGTCCCAGCTGAGG + Intronic
921074587 1:211690051-211690073 GTGGTTAGCAGCACAAGGTGGGG - Intergenic
922425070 1:225484889-225484911 GTGGTGGGCAATCCCAGCTGTGG + Intergenic
922444402 1:225684392-225684414 GAGACGAGAAGTCCAAGATGAGG + Intergenic
923057411 1:230437423-230437445 GAGGTCAGCAGTCCAAAATCAGG + Intergenic
1064272854 10:13880693-13880715 GTGGTGAGTATTCCAAGCAGAGG - Intronic
1066064003 10:31749540-31749562 GCGGTGGGCAGTCCCAGATAAGG + Intergenic
1067712594 10:48661887-48661909 GTGGGGAGCATTTCAAGAAGTGG - Intergenic
1070324610 10:75379958-75379980 GTGCTGAGCAGGCCATGCTGTGG - Intergenic
1070971257 10:80569365-80569387 GTTGTGAGCAGTACAAGCTTTGG - Intronic
1071477919 10:86040924-86040946 GTGCTCAGCAGCCCAAGGTGGGG + Intronic
1073443452 10:103566577-103566599 CTGGTGAGCAGTTAAAAATGTGG - Intronic
1075082143 10:119391316-119391338 ATGGCGAGCAGTGCATGATGGGG - Intronic
1075252309 10:120890722-120890744 ATGGTGAGCAGTTTAAGAAGTGG + Exonic
1077236448 11:1484220-1484242 GTGGTGGGAAGTGCCAGATGAGG - Intronic
1078471957 11:11595410-11595432 AGGGTGAGAAGTCCAAGATCAGG - Intronic
1079475201 11:20822750-20822772 GTGGTTACCAGTGCAGGATGGGG + Intronic
1082639979 11:55647373-55647395 CAGGTGAGAAGTCCAAAATGAGG - Intergenic
1085771100 11:79326577-79326599 GTGGTGAGCAGGACAGGAAGAGG - Intronic
1088344437 11:108806872-108806894 GTGATGAGTGGTACAAGATGAGG + Intronic
1088859094 11:113783233-113783255 GTGGGTAGCAGTTCCAGATGAGG + Intergenic
1089554499 11:119308828-119308850 GCGGGGAGCAGACAAAGATGAGG - Exonic
1092296391 12:7202415-7202437 GTGGTCAGTGGTCCCAGATGGGG + Intronic
1092913240 12:13166808-13166830 GTCTTGAGAAGTCCAGGATGCGG + Intergenic
1093032739 12:14303640-14303662 GAGGTGAGAACTCCAAGATCTGG + Intergenic
1097459868 12:59848162-59848184 GTGGTGTGCAGTGCATGAGGTGG - Intergenic
1100297462 12:93275947-93275969 GTGAAGAGCAGTCCAGGCTGAGG - Intergenic
1106000191 13:25715171-25715193 GTTGGGAGTAGTGCAAGATGAGG + Intronic
1109737258 13:66503034-66503056 CTGCTGAGCAGTCCAGGATGGGG + Intronic
1112733396 13:102392792-102392814 GTGGTGAGCGGTCCAGAATAAGG - Intronic
1113549548 13:111181953-111181975 TTGGTGAGCTGTCCTAAATGTGG + Intronic
1114534232 14:23412826-23412848 GGGCTGAGCAGATCAAGATGTGG + Exonic
1119907866 14:78321976-78321998 GTGGTGAACAGTCCAAAGTAGGG - Intronic
1127876665 15:63117456-63117478 GTGGTGAGCAGTACAAGCTTTGG + Intergenic
1129698128 15:77752226-77752248 GTGGTGGGCAGTCCACCTTGGGG - Intronic
1130844709 15:87734019-87734041 GTGCTGAGCAGAGCAAGGTGAGG + Intergenic
1131293359 15:91126340-91126362 GTGCTGATCATGCCAAGATGAGG + Intronic
1142023628 16:87800471-87800493 GTGGCCAGAAGTCCAAGATTGGG + Intergenic
1142807632 17:2379821-2379843 GTGGGCAGCAGTCCAGGCTGCGG - Exonic
1144256275 17:13471410-13471432 TTGCTGAGCAGCACAAGATGAGG - Intergenic
1144472683 17:15558757-15558779 GTGGTCAGAAGTCCAGAATGAGG - Intronic
1144923799 17:18785934-18785956 GTGGTCAGAAGTCCAGAATGAGG + Intronic
1146163682 17:30572809-30572831 GTGGTGGGCAGGGCAGGATGGGG - Intergenic
1146671622 17:34741849-34741871 GGGGGGAGATGTCCAAGATGAGG + Intergenic
1149220051 17:54406687-54406709 ATAGTGAGTATTCCAAGATGGGG + Intergenic
1151730175 17:75906363-75906385 GTGGTGGCCAGGCCAAGGTGGGG - Intronic
1153259865 18:3213829-3213851 CTGGTGAGAAGTCCCAGATAAGG + Intronic
1153697331 18:7657302-7657324 GCCGTGGGCAGTCCACGATGGGG + Intronic
1153826432 18:8879207-8879229 GTGGTTAGCAGCACAAGATATGG + Intergenic
1154014190 18:10601910-10601932 GTGGTTAGCAGCCCAAGGTAGGG + Intergenic
1155334337 18:24749249-24749271 GTGGAGAGCTCTCCAAAATGAGG - Intergenic
1156014955 18:32537183-32537205 GTGGTGAGCAAAACCAGATGAGG + Intergenic
1156455169 18:37289137-37289159 GTGGAGGGCAGACCATGATGGGG + Intronic
1157552906 18:48593819-48593841 GAGGTGAGCAGGCCAAGGTGAGG + Intronic
1158590761 18:58776919-58776941 GTGGTGAGCCCTGCAAGATATGG - Intergenic
1164702025 19:30292249-30292271 GTAGTGAGGAGTGCAAGATTTGG - Intronic
1166938705 19:46350295-46350317 ATGGAGAGGAGTCCAGGATGAGG + Intronic
1166965705 19:46528410-46528432 GTCGGGAGGAGTCCAGGATGAGG - Intronic
1167906844 19:52668227-52668249 GTGGTTAGCAGCACAAGATAGGG - Intronic
1167984709 19:53304595-53304617 CTGATGAGCAGTGCAAAATGTGG + Intergenic
927093066 2:19727209-19727231 GAGGTCAGCAGTGCAAAATGGGG - Intergenic
929112704 2:38418857-38418879 GTGGTGTACACTCCAGGATGAGG - Intergenic
930414367 2:51071403-51071425 GTGGTGAGCACTTCCTGATGGGG + Intergenic
933073334 2:77890251-77890273 GTGGCTAGCAGTCCAAAATTAGG - Intergenic
934735668 2:96688701-96688723 GTGGAGAGCAGTTCAGGGTGCGG + Intergenic
938546476 2:132337435-132337457 GTGGCTAGCAGTGGAAGATGGGG + Intergenic
939608254 2:144278669-144278691 GTGGTGCTCAGTAAAAGATGTGG - Intronic
940543847 2:155057375-155057397 GAGGTCAGCAGTCCAGGATCAGG + Intergenic
942537870 2:176984558-176984580 GTGGACAGCAGTCACAGATGGGG + Intergenic
942832321 2:180251782-180251804 GTGGTTGGAAGTCCAAGATAGGG + Intergenic
945325964 2:208482744-208482766 TTGAAGAGCTGTCCAAGATGAGG + Intronic
946269381 2:218577695-218577717 GTGGTTACCAGGGCAAGATGGGG + Intronic
946299284 2:218812747-218812769 TTGGTGAGGACTCCCAGATGGGG + Exonic
947532421 2:230920359-230920381 GAGATGAGCATTTCAAGATGGGG + Intronic
948120012 2:235523027-235523049 GCGGTTGGGAGTCCAAGATGAGG + Intronic
948860624 2:240751035-240751057 GAGGTGAGTTGGCCAAGATGAGG + Intronic
1170791382 20:19512196-19512218 CTGGAGAGCAGACCAAGATCAGG + Intronic
1171137811 20:22712704-22712726 GGGGTGAGCAATCCAAGAAAGGG + Intergenic
1171875336 20:30570167-30570189 GTGGCTAGCAGTGGAAGATGGGG + Intergenic
1172646674 20:36474614-36474636 GTGGAGTGCAGACCAAGGTGGGG + Intronic
1173464750 20:43271920-43271942 CTGGGGAGCAGTCCCAGCTGGGG + Intergenic
1173583872 20:44166963-44166985 GTGGTGAGCAGTCCAAGATGAGG - Intronic
1175707406 20:61190781-61190803 GTGGTTAGCAGCACAAGATAGGG + Intergenic
1178755679 21:35347236-35347258 GAGAAGAGCATTCCAAGATGAGG - Intronic
1181443263 22:22949510-22949532 GGGGTGAGGAGTCCATGCTGGGG + Intergenic
1181567747 22:23750183-23750205 TTGGAGAGCAGTGCCAGATGGGG - Intronic
1181873293 22:25920479-25920501 CTGGTGCCCAGTCCAGGATGCGG + Intronic
1182535964 22:31003136-31003158 GTGCTGAGCAGTCCAAGCCATGG + Intergenic
1184279352 22:43428237-43428259 GTGCAGAGCAGTCCAGGATGGGG - Intronic
1185005930 22:48277028-48277050 GTGGGGACCAGTCCTGGATGGGG - Intergenic
1185363447 22:50423163-50423185 CGGGTGAGATGTCCAAGATGGGG - Intronic
950656891 3:14442083-14442105 GTGGTGAGCTGGCCAGGGTGTGG + Intronic
951466591 3:23006600-23006622 GTGGTGTGTAGTCCAAGAATAGG + Intergenic
952865755 3:37854207-37854229 GAGGTGAGCAGACCCAGACGTGG - Intergenic
956041094 3:65145902-65145924 GTGGTGGGCTGTGCAAGATAAGG - Intergenic
959940573 3:112076887-112076909 GAGGTGTGCAGTCCATGGTGTGG - Exonic
964274774 3:154998137-154998159 GGGGTTAGAAGTCCAAGATCAGG + Intergenic
966301186 3:178481107-178481129 GAGGTGAGCAGTTCAGGCTGAGG - Intronic
966490915 3:180527752-180527774 GCTGTGAGCAGTCCAAAATATGG - Intergenic
967293329 3:187942874-187942896 GTGGTCAGCAGTGCAGGGTGAGG - Intergenic
969673049 4:8600284-8600306 GTGGTGAGCAGGGCAATGTGAGG + Intronic
972067770 4:34972228-34972250 GAGGTCAGAAGTTCAAGATGAGG - Intergenic
976900825 4:90173614-90173636 AAGGTGAGCAATCCAAGAGGCGG + Intronic
980048226 4:128012744-128012766 GGGGAGAGTAGTACAAGATGAGG + Intronic
982445612 4:155487289-155487311 GAGGTTAAAAGTCCAAGATGAGG - Intergenic
983490978 4:168388787-168388809 GTGGTGAGCAGTCCCAGCAGGGG + Intronic
985854653 5:2415692-2415714 GTGGTGAGCAGTCCATCACCAGG + Intergenic
986255644 5:6100609-6100631 GTGGTGAGAAGTCCATGGGGAGG - Intergenic
986255855 5:6101253-6101275 GTGGTGAGAAGTCCATGGGGAGG - Intergenic
986932639 5:12845880-12845902 GTGGTGCAGAGTGCAAGATGTGG - Intergenic
989061104 5:37412674-37412696 GTGGTGGGGAGTCCAAGTTTGGG + Intronic
989507371 5:42243000-42243022 GTGGTGAGAGTTCCAAGAAGAGG + Intergenic
991437302 5:66609983-66610005 GTGGTTAGAAGTCCAAAATCAGG + Intronic
991446429 5:66704932-66704954 GTGCTAAGCAGTCCTAGAGGTGG + Intronic
995434942 5:112124818-112124840 GAGGTTAGAAGTCCAAGATAAGG - Intergenic
995448265 5:112271055-112271077 GTGGTGACCAGGGCAAGATCTGG - Intronic
996770484 5:127080436-127080458 CTGGGGAGCAGTCCTGGATGAGG + Intergenic
997997346 5:138597298-138597320 GAGGCTAGAAGTCCAAGATGGGG - Intergenic
998625617 5:143842473-143842495 GTGGTGAGAAGTCAATGATATGG + Intergenic
998938724 5:147257671-147257693 GTGGTGAGCAGCACAAGGTAGGG + Intronic
999483015 5:151966207-151966229 GTGGTGAGCAGTCCAAGCAGAGG + Intergenic
1000193787 5:158938562-158938584 AGGCTGAGAAGTCCAAGATGAGG + Intronic
1000607387 5:163339255-163339277 TTGGTGTGCAGTCCAAGTAGTGG - Intergenic
1001543650 5:172556762-172556784 GTGGTGTAAAGTCCAACATGTGG - Intergenic
1002100276 5:176854244-176854266 GTGGTGAGGAGGGCAAGGTGGGG - Intronic
1002809310 6:611486-611508 CTGATGAGCAGGTCAAGATGAGG + Intronic
1003472560 6:6450820-6450842 GCCCTGAGCAGTCCAAGATGGGG - Intergenic
1003552886 6:7114534-7114556 GTTCTGTGCACTCCAAGATGTGG - Intronic
1004682373 6:17908880-17908902 GTGGTGAGGAGTTCAGGATTGGG + Intronic
1006719805 6:36142852-36142874 GTGCTCAGCAGTGCAAGGTGGGG + Intronic
1007495261 6:42255828-42255850 CTGGTCAGAAGTCCAGGATGAGG + Intronic
1015009847 6:128332422-128332444 GGGGTGGGCACTTCAAGATGAGG - Intronic
1015129505 6:129793630-129793652 GTGGTTAGCAGAGCCAGATGCGG + Intergenic
1015479024 6:133687612-133687634 TTGGAGAGCAGGCTAAGATGTGG + Intergenic
1018548252 6:164962547-164962569 GTGGTGACCAGACCAATATCTGG - Intergenic
1018812182 6:167306316-167306338 GTGGTGACCAGGCCAGGGTGGGG + Intronic
1021587460 7:22224586-22224608 CTGGGGAGCAGAGCAAGATGGGG - Intronic
1023799053 7:43817642-43817664 GTGGTTAGCAGCACAAGGTGGGG - Intergenic
1026248557 7:68646026-68646048 GTGGAGAACAGTGCATGATGGGG - Intergenic
1026728387 7:72890221-72890243 GTGGTGGGCACTCCAACATGAGG + Intronic
1033381902 7:140829393-140829415 TTTGTAAGCAGTCTAAGATGTGG + Intronic
1034562002 7:151886420-151886442 GTGGTGAGCAGGGAAAAATGTGG + Intergenic
1039119018 8:34125131-34125153 ATGAGGAGCAGTGCAAGATGAGG + Intergenic
1044366015 8:91346777-91346799 GTGGAGAACAGGCCAAGAGGAGG - Intronic
1045965074 8:108015576-108015598 GTGGTCAGAAATCCAGGATGGGG - Intronic
1047142545 8:122157456-122157478 GTGGAGAGCAGTTAAAGATTAGG + Intergenic
1048436869 8:134426291-134426313 GTGGTGAGCAGTTGAATGTGAGG + Intergenic
1049193091 8:141299582-141299604 GTGGTGCGCAGGCCCTGATGGGG + Intronic
1049563539 8:143325396-143325418 GTGGCGACCATCCCAAGATGGGG - Exonic
1051437128 9:17044768-17044790 GTGGTGAGGAGTACAGGCTGTGG - Intergenic
1051519964 9:17975349-17975371 GGGCTGAGAAGTCCAAGATCAGG + Intergenic
1052769873 9:32677802-32677824 TTGGTGTGCAGTTCAATATGAGG - Intergenic
1055112925 9:72577219-72577241 GTTATGAGCAGCCCAAGAGGAGG - Intronic
1056414489 9:86362970-86362992 GTGGTTAGCAGCCCAAGGTAGGG + Intergenic
1056741171 9:89256693-89256715 GTGTTGGTCAGTACAAGATGAGG - Intergenic
1057010607 9:91598065-91598087 GTGGCTGGGAGTCCAAGATGAGG - Intronic
1060384275 9:123208806-123208828 GTGTTGGGCTGTCCATGATGGGG - Intronic
1186418394 X:9403303-9403325 GTACTGAGCAGGCCAGGATGGGG + Intergenic
1186454664 X:9701730-9701752 CTGGTGAGCGGTCCAAGAGATGG - Intronic
1187077257 X:15947485-15947507 GTAGTGAGGAGAGCAAGATGAGG - Intergenic
1187256543 X:17648251-17648273 GTGATTAGCAGACCAAGATGGGG + Intronic
1188327507 X:28823588-28823610 GAGGTCAGAAGTCCAAAATGGGG + Intronic
1190025541 X:46918923-46918945 GTGGTGACCATTCAAAGGTGTGG + Intronic
1190270216 X:48857281-48857303 GTGGTTAGCAGCACAAGATAGGG - Intergenic
1190454207 X:50610189-50610211 GTGGTGAGCTGACCAGAATGGGG - Intronic
1190810489 X:53878747-53878769 GAGGTAATCAGTCCAGGATGGGG - Intergenic
1192935752 X:75857363-75857385 TTGGTGTGCAGTCCAAGTAGTGG + Intergenic
1194466638 X:94241784-94241806 GAGGTTAGCAGTCCAAGGTTTGG + Intergenic
1196423056 X:115542192-115542214 GTGGTTAGCAGCACAAGGTGGGG + Intergenic
1198007884 X:132517416-132517438 GTGGAGAGCATTCCAAAAAGAGG + Intergenic
1199638301 X:149834727-149834749 GTGGTTAGCAGTACAAGGTAGGG - Intergenic
1200765503 Y:7077480-7077502 GTGGTGAGCAGTCCAGAAGATGG - Intronic
1201891271 Y:18946355-18946377 TTGGGGAGCAGTCCAAGTAGTGG + Intergenic