ID: 1173583874

View in Genome Browser
Species Human (GRCh38)
Location 20:44166986-44167008
Sequence TCACACTCGCCTTCCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 157}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583868_1173583874 9 Left 1173583868 20:44166954-44166976 CCTCCCCTGCCTCATCTTGGACT 0: 1
1: 0
2: 1
3: 39
4: 438
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583870_1173583874 5 Left 1173583870 20:44166958-44166980 CCCTGCCTCATCTTGGACTGCTC 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583871_1173583874 4 Left 1173583871 20:44166959-44166981 CCTGCCTCATCTTGGACTGCTCA 0: 1
1: 1
2: 2
3: 31
4: 634
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583872_1173583874 0 Left 1173583872 20:44166963-44166985 CCTCATCTTGGACTGCTCACCAC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583862_1173583874 21 Left 1173583862 20:44166942-44166964 CCGCCCCTGCCACCTCCCCTGCC 0: 1
1: 4
2: 50
3: 514
4: 3609
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583865_1173583874 16 Left 1173583865 20:44166947-44166969 CCTGCCACCTCCCCTGCCTCATC 0: 1
1: 0
2: 11
3: 136
4: 2181
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583869_1173583874 6 Left 1173583869 20:44166957-44166979 CCCCTGCCTCATCTTGGACTGCT 0: 1
1: 0
2: 0
3: 29
4: 270
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583866_1173583874 12 Left 1173583866 20:44166951-44166973 CCACCTCCCCTGCCTCATCTTGG 0: 1
1: 0
2: 3
3: 83
4: 828
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583864_1173583874 17 Left 1173583864 20:44166946-44166968 CCCTGCCACCTCCCCTGCCTCAT 0: 1
1: 1
2: 10
3: 110
4: 1252
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157
1173583863_1173583874 18 Left 1173583863 20:44166945-44166967 CCCCTGCCACCTCCCCTGCCTCA 0: 1
1: 2
2: 19
3: 192
4: 1787
Right 1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583874 Original CRISPR TCACACTCGCCTTCCCACCT TGG Intronic
903161350 1:21491326-21491348 TCACACACCCCCTCCCTCCTGGG + Intergenic
904688458 1:32276399-32276421 TCCCACTCGTCCTCCCACCACGG - Exonic
904970528 1:34416089-34416111 TCATACACGCCATCCGACCTAGG - Intergenic
906049906 1:42861982-42862004 TCATGCTAGCCTTCCAACCTGGG + Intergenic
910455953 1:87397442-87397464 CTCCACTTGCCTTCCCACCTCGG - Intergenic
915909867 1:159908288-159908310 TCACTCTCACCTCCCAACCTAGG + Intergenic
916582866 1:166123964-166123986 TCCCACTCCTCTTCCCACTTTGG - Intronic
916662387 1:166934718-166934740 TCACGCTGACCTTCCCACTTGGG + Intronic
921155292 1:212433798-212433820 TCACAACCACCTGCCCACCTGGG + Intronic
922525726 1:226301832-226301854 TCAAGCTAGCCTTCCCACCTTGG - Intronic
922890642 1:229059157-229059179 TTACACTCCTCTTCCCACCCAGG + Intergenic
1064684896 10:17850364-17850386 TCAAGCTATCCTTCCCACCTTGG - Intronic
1066023479 10:31326933-31326955 TCACTCTATCCTTCCTACCTTGG + Intronic
1066188877 10:33037229-33037251 GCCCCCTCTCCTTCCCACCTAGG - Intergenic
1068854191 10:61780655-61780677 TCACATTAGCTTTTCCACCTTGG + Intergenic
1068919238 10:62465413-62465435 GGACACACCCCTTCCCACCTAGG - Intronic
1071897205 10:90080543-90080565 TCCAACTCGTCTTCCCAGCTGGG - Intergenic
1073253915 10:102139011-102139033 ACACACTCCTCCTCCCACCTGGG - Intronic
1073870147 10:107853964-107853986 TCACTGTCTCCTTCCCTCCTTGG + Intergenic
1075015866 10:118909659-118909681 GCCCACCTGCCTTCCCACCTGGG - Intergenic
1076466625 10:130687144-130687166 TCAAACACGTCTTCCCACATTGG + Intergenic
1076794250 10:132791097-132791119 TCACACGCGGCTCCGCACCTGGG + Intergenic
1083018484 11:59481617-59481639 TCATATTTACCTTCCCACCTTGG - Intergenic
1083491483 11:63017522-63017544 TGCCCCTCGGCTTCCCACCTGGG + Intergenic
1083571094 11:63762805-63762827 TCCAACGCGCCTTCCCACCCCGG + Exonic
1084104345 11:66971318-66971340 TCACACTAGCCTTGTCCCCTAGG - Intergenic
1084383114 11:68826051-68826073 CCACACCCGCCTTCCCTCCCTGG + Intronic
1086220489 11:84437503-84437525 GCACAATCAACTTCCCACCTCGG + Intronic
1087966227 11:104419490-104419512 ACACACTTGCCTTCCCCACTAGG - Intergenic
1088645122 11:111911721-111911743 TCACACTCACCTAGCCACCATGG - Exonic
1090268598 11:125370446-125370468 TCCTACTCCCCTTCCCTCCTGGG + Intronic
1090358262 11:126155205-126155227 CCAAACTCGCCTTCCCAGCCGGG - Intergenic
1093592252 12:20917174-20917196 TCACACTCTCCCTCCCACAAGGG - Intergenic
1094060023 12:26303641-26303663 TCACACTAGGCTTCACACTTGGG - Intergenic
1094239118 12:28201458-28201480 TCCCAGTCGCCATCCCATCTAGG - Intronic
1099738519 12:86601205-86601227 GTACACACCCCTTCCCACCTAGG - Intronic
1103520470 12:121534487-121534509 TGAAACTCACCTTCCCACCCCGG + Exonic
1103618920 12:122174025-122174047 TCACACACCCCTGCCCACCCTGG + Intronic
1104453893 12:128894177-128894199 TCACGCTGGACTTCCCACCAAGG - Intronic
1104650747 12:130530790-130530812 TCACCTTCTCCTTCCAACCTAGG + Intronic
1104666455 12:130650511-130650533 TCACAGGGGCCTGCCCACCTGGG + Intronic
1104986216 12:132598839-132598861 TCACAGTCGCTTCCTCACCTGGG + Intergenic
1105706248 13:22969291-22969313 TCACCATCGCCTGCCCACCTGGG + Intergenic
1107299113 13:38947090-38947112 TCACATATGCCTTCCCTCCTGGG + Intergenic
1107419423 13:40232938-40232960 TCACACTGGCCTTCCCCCATTGG + Intergenic
1109510580 13:63367360-63367382 TCACACACCCCTTCCCACTAGGG - Intergenic
1114795239 14:25707516-25707538 AAACTCTCGGCTTCCCACCTTGG - Intergenic
1115809325 14:37089319-37089341 TCACATTAACCTTCCTACCTAGG + Intronic
1118882470 14:69841244-69841266 TCACCCTCCACTTCCTACCTGGG + Intergenic
1121605841 14:95239118-95239140 TCACCCTGGCCTGCCCATCTGGG - Intronic
1122247929 14:100417387-100417409 GCACCCTCGCCTGACCACCTTGG - Intronic
1122484781 14:102071786-102071808 ACACTCACGCCTTCCCTCCTGGG + Intergenic
1122810129 14:104283618-104283640 GCACAGTAGCCTTCCTACCTGGG - Intergenic
1122945381 14:105006234-105006256 TCACCCTGTTCTTCCCACCTTGG - Intronic
1123105885 14:105840866-105840888 GCACCCTCGTCTCCCCACCTGGG + Intergenic
1123888108 15:24748122-24748144 TCACAGTCGGCTACCCACTTTGG - Intergenic
1125496373 15:40198309-40198331 TCAAGCTATCCTTCCCACCTTGG + Intronic
1127774659 15:62255470-62255492 TCACACGCTCCTGGCCACCTGGG + Intergenic
1127821249 15:62658210-62658232 CCACACTGGCGTTCACACCTTGG - Intronic
1128474872 15:67988748-67988770 TCACAGTCCCCTTACAACCTTGG - Intergenic
1129713879 15:77835956-77835978 TCACACAGGGCTCCCCACCTGGG + Intergenic
1132938320 16:2493694-2493716 TCAGACTAACCTTTCCACCTGGG - Intronic
1134915217 16:18063644-18063666 TCGCACTCACCTACACACCTAGG - Intergenic
1140609402 16:76580412-76580434 TCACACTTGCCTACCCAGATGGG - Intronic
1141699473 16:85635882-85635904 TCAGACTCGCCTTCCCTCCCTGG + Intronic
1142600378 17:1050878-1050900 ACACTCTGCCCTTCCCACCTCGG + Intronic
1142600389 17:1050909-1050931 ACACTCTGCCCTTCCCACCTCGG + Intronic
1143512668 17:7405012-7405034 TCACCCCCGCCTTCCCTCCTAGG + Intronic
1143633012 17:8149480-8149502 TCCATCTCGCCTGCCCACCTGGG - Exonic
1146364943 17:32216263-32216285 TCTCAATCTCCTTCCCAGCTAGG + Intronic
1147542376 17:41371260-41371282 TCAAACTTGCCTTCACAGCTTGG + Intronic
1148964857 17:51426360-51426382 TCACAATAGCCTTCTGACCTTGG - Intergenic
1149639165 17:58192112-58192134 TCACACTCTCCCTGGCACCTTGG + Intergenic
1150228237 17:63535253-63535275 CCACACTCGGTTTCCCACATCGG + Intronic
1151794905 17:76337638-76337660 GCACTCTCGCCTTCCAGCCTGGG - Intronic
1160265498 18:77338539-77338561 CCCCACTCGCCCTGCCACCTCGG - Intergenic
1165559192 19:36664551-36664573 GCACTCTAACCTTCCCACCTGGG + Intronic
1165803798 19:38568229-38568251 CCACTCTGGCCTTCCCACCGTGG + Intronic
1165872243 19:38981176-38981198 TCACACACCCCCTCCCACCCAGG + Intergenic
1166067109 19:40366432-40366454 ACACACCCACCTTCTCACCTGGG + Exonic
1167780356 19:51594870-51594892 TCACTCTCGCCCTTCAACCTGGG + Intergenic
926011147 2:9408995-9409017 CCAGACACGCCTTCCCATCTGGG - Intronic
930494765 2:52127086-52127108 TCAAACTCGTCTTCCCTGCTGGG - Intergenic
933409725 2:81910114-81910136 TCACACCAGCCCTCCGACCTTGG - Intergenic
938194406 2:129314252-129314274 CCCCACACCCCTTCCCACCTCGG - Intergenic
939333375 2:140792106-140792128 TCCCACTCGCTTTCCCACAGTGG + Intronic
939372422 2:141318559-141318581 TCAGACTGGCTTTCTCACCTAGG + Intronic
941786570 2:169505520-169505542 TCCCACCCGCCATCCCATCTAGG + Exonic
945682559 2:212931724-212931746 TGACACTTGCTTTCCCACCAAGG - Intergenic
947711551 2:232319207-232319229 CCACACTGGCCTTCCCATGTGGG + Intronic
948205723 2:236161889-236161911 TCACACTCTGGTTCTCACCTCGG - Intergenic
1169037220 20:2463278-2463300 TCCCACTCTCCTCCCCAACTTGG + Intronic
1169279998 20:4258900-4258922 TCTCACTCCCATTCCCTCCTTGG - Intergenic
1170473899 20:16695478-16695500 TCAGACTTGCCTGCACACCTGGG - Intergenic
1170999182 20:21396546-21396568 GCTCACTCGCCTTCCCCCTTGGG - Intronic
1173557595 20:43977669-43977691 TCACACTCCCTCTCCCTCCTTGG + Intronic
1173583874 20:44166986-44167008 TCACACTCGCCTTCCCACCTTGG + Intronic
1174542873 20:51303721-51303743 TCACACACCCCTTCCCACCAGGG - Intergenic
1176710240 21:10144914-10144936 GCACACTGGCCTTCCCAGCCTGG + Intergenic
1177773217 21:25539807-25539829 TCACACACACCCTCCCACCAGGG + Intergenic
1179184329 21:39072858-39072880 TCTCACATGCCATCCCACCTTGG + Intergenic
1179912848 21:44459549-44459571 TCACACTCTCCTTGGGACCTGGG - Exonic
1181487266 22:23239165-23239187 TCAGACTCTCCTTCCCACACAGG - Intronic
1184495908 22:44841349-44841371 TCTCACCCGCCTGCCCACCCTGG + Intronic
1185052479 22:48561104-48561126 TCACACACGCCTTCCCAGGGTGG - Intronic
950524269 3:13514360-13514382 TCACAGTGCCCTGCCCACCTAGG + Intergenic
953327939 3:42028646-42028668 CCACACTGGCCTTCTCACCAAGG - Intronic
957912168 3:86634302-86634324 TCACACTCATCTTCCCACAGTGG + Intergenic
961558183 3:127710903-127710925 TCAGACGTGACTTCCCACCTTGG - Intronic
961705404 3:128781432-128781454 TCACACATTCTTTCCCACCTTGG - Intronic
963264335 3:143225422-143225444 TCACTCTTGCCTTCCCTTCTTGG - Intergenic
964920473 3:161890282-161890304 TCACACACTCCTTCCCACATGGG - Intergenic
968919874 4:3516961-3516983 ACACACTTCTCTTCCCACCTCGG - Intronic
969446389 4:7247047-7247069 TCTCACTGGCCTTCTCACCTTGG - Intronic
973229440 4:47824906-47824928 TCACACTCAGCTGCCCACGTTGG - Intronic
973345229 4:49047701-49047723 ACACTCTCTCCTTCCCTCCTCGG - Intronic
980751152 4:137091152-137091174 TCACAATAGCCTTCTCACTTAGG + Intergenic
980784311 4:137532595-137532617 CCACTCTCGCCCTCCCTCCTTGG - Intergenic
981089709 4:140720140-140720162 TCCCATGTGCCTTCCCACCTTGG - Intronic
981238861 4:142450484-142450506 TCACACTTCCCTTTCCTCCTTGG + Intronic
985196439 4:187435151-187435173 TCAGATTCTCCTTCCCACCCTGG - Intergenic
985579571 5:689733-689755 TCACACAGGGCTTCCCTCCTAGG - Intronic
985594417 5:781792-781814 TCACACAGGGCTTCCCTCCTAGG - Intergenic
987740287 5:21899049-21899071 TCTTACTCTCCTTCCCACCTGGG + Intronic
992231762 5:74670875-74670897 TCACACACCCCCTCCCACCAGGG + Intronic
992662415 5:78974770-78974792 CCGCACTCCCCTTCCCTCCTGGG + Intronic
994937477 5:106273329-106273351 TCCAAGTCACCTTCCCACCTTGG - Intergenic
995209252 5:109518691-109518713 TCACACTACTATTCCCACCTGGG - Intergenic
996348991 5:122517853-122517875 TCACACCTCACTTCCCACCTTGG + Intergenic
997444945 5:133933941-133933963 TAACCCTCTCCCTCCCACCTGGG + Intergenic
998105935 5:139469305-139469327 TCATCCTCTGCTTCCCACCTTGG - Intergenic
998331885 5:141334863-141334885 TCCCTCTCTCCTTCCCTCCTGGG - Intronic
999088625 5:148915202-148915224 TCTCACTGCCCTTCCCACCTAGG + Intergenic
1001433797 5:171683869-171683891 TCAGAATGTCCTTCCCACCTTGG + Intergenic
1001884605 5:175278045-175278067 TCACACTGTCCTCTCCACCTAGG - Intergenic
1006571687 6:35010608-35010630 TCACTCTCCCCTTCCTTCCTTGG - Intronic
1007699989 6:43760861-43760883 TCACAGTGGCCTCCCCACCAAGG - Intergenic
1008546879 6:52590990-52591012 ACACTCTCGCCTTCCCACCTTGG + Intergenic
1012363302 6:98409351-98409373 TCACAGCTGCTTTCCCACCTTGG - Intergenic
1015524292 6:134160760-134160782 TCACAATCCCATTCCCACTTTGG - Intergenic
1019291070 7:250585-250607 TGAAACTCGCCTCCCCACCCTGG + Intronic
1030265461 7:107616280-107616302 ACATACTGGCCTTCGCACCTGGG + Intronic
1030625746 7:111844231-111844253 ACACACTCGCACTCCAACCTGGG + Intronic
1032898636 7:136280868-136280890 TCTCACTCACCTACTCACCTGGG + Intergenic
1033561358 7:142535447-142535469 TCACACTCCCCATCAAACCTAGG - Intergenic
1035184944 7:157119162-157119184 TCACTCTAGCCTTACCTCCTGGG + Intergenic
1035689661 8:1551691-1551713 GCACTCACGCCTTCCCACCCAGG + Intronic
1039153440 8:34529586-34529608 TCCCAGCCGCCATCCCACCTAGG - Intergenic
1042852097 8:73226575-73226597 TCCCTCCCACCTTCCCACCTGGG + Intergenic
1045942615 8:107756206-107756228 TCACATTCGCCTTACCACAAGGG - Intergenic
1049498131 8:142946260-142946282 GCACACACGCCTCCCCACCACGG + Intergenic
1052998352 9:34563835-34563857 TAACAGTCTCCTTCCTACCTTGG + Intronic
1053208650 9:36209066-36209088 TCCCGCTGGCCTTCCCACGTGGG - Intronic
1053647213 9:40130612-40130634 GCACACTGGCCTTCCCAGCCTGG + Intergenic
1053758512 9:41333231-41333253 GCACACTGGCCTTCCCAGCCTGG - Intergenic
1054537365 9:66245558-66245580 GCACACTGGCCTTCCCAGCCTGG - Intergenic
1056418412 9:86400229-86400251 ACACGCTCTCCTTCCCTCCTGGG - Intergenic
1058954938 9:109937276-109937298 TCACACTCCGCTCCACACCTGGG + Intronic
1061845673 9:133386836-133386858 CCACACTGGTGTTCCCACCTGGG + Intronic
1062376215 9:136263020-136263042 CCACACTCTCCTTCCTGCCTGGG + Intergenic
1062598187 9:137308426-137308448 TCACACTCGTCAGCCCATCTGGG + Intronic
1202795004 9_KI270719v1_random:113909-113931 GCACACTGGCCTTCCCAGCCTGG + Intergenic
1187212604 X:17245273-17245295 TCCCAGTCGCCATCCCATCTAGG - Intergenic
1189682891 X:43535157-43535179 TCCCACTCCTCTGCCCACCTTGG + Intergenic
1189691850 X:43625033-43625055 TCAAACTCGTCTTCCCTGCTGGG + Intergenic
1189725069 X:43960076-43960098 TCACACACCCCTTTCCACTTAGG - Intronic
1192190190 X:68986401-68986423 GCACACTCAGCTACCCACCTAGG + Intergenic
1197634517 X:128900180-128900202 TCTGATTTGCCTTCCCACCTAGG + Intergenic
1198641462 X:138760508-138760530 ACACCCTCCCCTGCCCACCTTGG - Intronic