ID: 1173583875

View in Genome Browser
Species Human (GRCh38)
Location 20:44166987-44167009
Sequence CACACTCGCCTTCCCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583862_1173583875 22 Left 1173583862 20:44166942-44166964 CCGCCCCTGCCACCTCCCCTGCC 0: 1
1: 4
2: 50
3: 514
4: 3609
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583870_1173583875 6 Left 1173583870 20:44166958-44166980 CCCTGCCTCATCTTGGACTGCTC 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583869_1173583875 7 Left 1173583869 20:44166957-44166979 CCCCTGCCTCATCTTGGACTGCT 0: 1
1: 0
2: 0
3: 29
4: 270
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583871_1173583875 5 Left 1173583871 20:44166959-44166981 CCTGCCTCATCTTGGACTGCTCA 0: 1
1: 1
2: 2
3: 31
4: 634
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583865_1173583875 17 Left 1173583865 20:44166947-44166969 CCTGCCACCTCCCCTGCCTCATC 0: 1
1: 0
2: 11
3: 136
4: 2181
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583866_1173583875 13 Left 1173583866 20:44166951-44166973 CCACCTCCCCTGCCTCATCTTGG 0: 1
1: 0
2: 3
3: 83
4: 828
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583868_1173583875 10 Left 1173583868 20:44166954-44166976 CCTCCCCTGCCTCATCTTGGACT 0: 1
1: 0
2: 1
3: 39
4: 438
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583872_1173583875 1 Left 1173583872 20:44166963-44166985 CCTCATCTTGGACTGCTCACCAC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583864_1173583875 18 Left 1173583864 20:44166946-44166968 CCCTGCCACCTCCCCTGCCTCAT 0: 1
1: 1
2: 10
3: 110
4: 1252
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data
1173583863_1173583875 19 Left 1173583863 20:44166945-44166967 CCCCTGCCACCTCCCCTGCCTCA 0: 1
1: 2
2: 19
3: 192
4: 1787
Right 1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583875 Original CRISPR CACACTCGCCTTCCCACCTT GGG Intronic
No off target data available for this crispr