ID: 1173583876

View in Genome Browser
Species Human (GRCh38)
Location 20:44166988-44167010
Sequence ACACTCGCCTTCCCACCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173583870_1173583876 7 Left 1173583870 20:44166958-44166980 CCCTGCCTCATCTTGGACTGCTC 0: 1
1: 0
2: 4
3: 19
4: 227
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583872_1173583876 2 Left 1173583872 20:44166963-44166985 CCTCATCTTGGACTGCTCACCAC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583862_1173583876 23 Left 1173583862 20:44166942-44166964 CCGCCCCTGCCACCTCCCCTGCC 0: 1
1: 4
2: 50
3: 514
4: 3609
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583866_1173583876 14 Left 1173583866 20:44166951-44166973 CCACCTCCCCTGCCTCATCTTGG 0: 1
1: 0
2: 3
3: 83
4: 828
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583863_1173583876 20 Left 1173583863 20:44166945-44166967 CCCCTGCCACCTCCCCTGCCTCA 0: 1
1: 2
2: 19
3: 192
4: 1787
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583868_1173583876 11 Left 1173583868 20:44166954-44166976 CCTCCCCTGCCTCATCTTGGACT 0: 1
1: 0
2: 1
3: 39
4: 438
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583865_1173583876 18 Left 1173583865 20:44166947-44166969 CCTGCCACCTCCCCTGCCTCATC 0: 1
1: 0
2: 11
3: 136
4: 2181
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583869_1173583876 8 Left 1173583869 20:44166957-44166979 CCCCTGCCTCATCTTGGACTGCT 0: 1
1: 0
2: 0
3: 29
4: 270
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583864_1173583876 19 Left 1173583864 20:44166946-44166968 CCCTGCCACCTCCCCTGCCTCAT 0: 1
1: 1
2: 10
3: 110
4: 1252
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1173583871_1173583876 6 Left 1173583871 20:44166959-44166981 CCTGCCTCATCTTGGACTGCTCA 0: 1
1: 1
2: 2
3: 31
4: 634
Right 1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173583876 Original CRISPR ACACTCGCCTTCCCACCTTG GGG Intronic
900012792 1:131331-131353 ACACTCCCTGTCCCACCTGGTGG - Intergenic
900042856 1:487318-487340 ACACTCCCTGTCCCACCTGGTGG - Intergenic
900143841 1:1149666-1149688 CCACGCCCCTTCCCACCATGGGG - Intergenic
901635520 1:10668474-10668496 CCCCTCGCCTTCCCACCCTCTGG - Intronic
903930796 1:26861415-26861437 ACACTCATCTTCCCTCCTGGAGG - Intergenic
904068518 1:27773691-27773713 ACACTCCCCTTCCCACCCTCGGG - Intronic
904171430 1:28594157-28594179 ACACTCCCCATCCCACCAGGTGG - Exonic
906395682 1:45462090-45462112 ACACTACCCTTCCCACCCTCTGG + Intronic
907240265 1:53077340-53077362 CCCCTCCCCTGCCCACCTTGAGG - Exonic
915469342 1:156116147-156116169 GCACTGTCCTTCCCTCCTTGGGG + Intronic
916748718 1:167704590-167704612 ACACTCAGCATCCCTCCTTGGGG - Intronic
920554640 1:206895735-206895757 ACTCCCCCCTTCCCACCATGTGG - Intergenic
922099193 1:222468327-222468349 ACACTCCCTGTCCCACCTGGTGG - Intergenic
922735842 1:227977919-227977941 ACACTCCCCGTCCCACCTGGTGG + Intergenic
922890644 1:229059159-229059181 ACACTCCTCTTCCCACCCAGGGG + Intergenic
924342397 1:243050001-243050023 ACACTCCCTGTCCCACCTGGTGG - Intergenic
1066233496 10:33461818-33461840 GCCCTTGCCTTCCCACGTTGTGG + Intergenic
1066666793 10:37790974-37790996 ACAGTCAAGTTCCCACCTTGGGG + Intronic
1066734078 10:38455554-38455576 ACACTCCCCGTCCCACCTGGTGG + Intergenic
1067093954 10:43286212-43286234 ACCCTCGCCAGCCCTCCTTGAGG + Intergenic
1067664646 10:48266716-48266738 AAACTCTCATTCCCACCTAGTGG + Intronic
1071050566 10:81443434-81443456 ACACTACCCTTCCCAGCTTCTGG + Intergenic
1073357600 10:102869648-102869670 GCGCTCGCGTTCCCGCCTTGCGG - Intronic
1075106229 10:119542080-119542102 ACCCTCGCGATCCCACCTTTTGG + Intronic
1076969128 11:123535-123557 ACACTCCCTGTCCCACCTGGTGG - Intergenic
1077054657 11:585204-585226 ACACTGCCCTTTCCAGCTTGAGG + Intronic
1077392039 11:2304685-2304707 ACACTCTCCTTCCCAGCTGCCGG + Intronic
1078944995 11:16055727-16055749 ACACTCGCCTTGCAGCATTGTGG - Intronic
1081231989 11:40596608-40596630 CCACTCCCCTTCCCAGCTTCTGG + Intronic
1081378967 11:42391787-42391809 CCACTCTCCTTCCCACCTCAAGG + Intergenic
1095984253 12:47989040-47989062 ACACTCGCAGTCTCACCTGGAGG - Intronic
1099271607 12:80517654-80517676 TCACTACCCTTCCCACCTTCTGG + Intronic
1105938685 13:25127581-25127603 CCCCTCCCCTTCCCACCTTCTGG - Intergenic
1106037085 13:26052512-26052534 ACTCTCTCCGTTCCACCTTGTGG - Intergenic
1107145898 13:37059866-37059888 ACACCCTCCCTCCCACTTTGCGG - Intergenic
1110448181 13:75611686-75611708 TCACTACCCTTCCCACCTTCAGG + Intergenic
1113671281 13:112177006-112177028 ACACTCGCCCTGCTACCTGGAGG + Intergenic
1116594234 14:46819697-46819719 TCAGTCGCCTCCCCAGCTTGGGG + Intergenic
1121446219 14:93980886-93980908 CCACTCTCCTTCCCTCCTTCTGG - Intergenic
1121786314 14:96663687-96663709 ACACTTCCCAGCCCACCTTGCGG + Intergenic
1122557676 14:102590490-102590512 ACACTCGCCTTCCCATCGCTTGG - Intergenic
1122838402 14:104442605-104442627 ACACAAGCCTTCCAACCATGTGG + Intergenic
1123174495 14:106403507-106403529 ACACCCATCTTCCCACATTGAGG + Intergenic
1123182715 14:106484452-106484474 ACACCCATCTTCCCACATTGAGG + Intergenic
1202944191 14_KI270726v1_random:12277-12299 ACACCCATCTTCCCACATTGAGG - Intergenic
1124113836 15:26820815-26820837 CCACTCCCCTTCCCAGCTTTTGG - Intronic
1124907993 15:33890010-33890032 GAACTCGCCTTGACACCTTGTGG - Intronic
1125493796 15:40170565-40170587 TTACTCTCCTTCCCACCTTGAGG - Exonic
1127647344 15:60971872-60971894 ACACTGGCCCTCCCACCATTGGG + Intronic
1128224721 15:65993822-65993844 TCATTCCCCTTCCCACCATGAGG + Intronic
1128964723 15:72047220-72047242 CCCTTCTCCTTCCCACCTTGTGG - Intronic
1129736928 15:77971848-77971870 ACACCCTCCTCCCCACCTTCAGG - Intergenic
1138345355 16:56316980-56317002 ACAGTCGCCTTCCCACCCCCTGG + Intronic
1142451546 16:90175587-90175609 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1142927723 17:3255752-3255774 CCACTCCCCTTCCCACCCTCGGG - Intergenic
1143250644 17:5520865-5520887 ACACTGGGCTGCTCACCTTGGGG + Exonic
1143498218 17:7324379-7324401 GCACCCACTTTCCCACCTTGAGG + Exonic
1144480205 17:15622641-15622663 TCTCTCGCCTTCCCATCATGTGG + Intronic
1144918101 17:18741097-18741119 TCTCTCGCCTTCCCATCATGTGG - Intergenic
1148213603 17:45822565-45822587 AGACTCTCCTTCCCATCTTGAGG + Intronic
1149046719 17:52255019-52255041 AAACTGGCCTCCCCACCTTAAGG + Intergenic
1150283865 17:63944820-63944842 ACCCACGCCGTCCCACCCTGTGG - Intronic
1150959193 17:69895610-69895632 CCACAGTCCTTCCCACCTTGAGG - Intergenic
1154992581 18:21610706-21610728 ACACTCCCCTTCCCTCTTTCGGG - Intergenic
1157450243 18:47780837-47780859 AGCATTGCCTTCCCACCTTGAGG - Intergenic
1158024345 18:52878072-52878094 AAACTCCCCTCCCCACTTTGGGG + Intronic
1158448544 18:57542702-57542724 CCACTCTCCATCCCTCCTTGAGG + Intergenic
1158624076 18:59056745-59056767 ATCCTCGCCTGCCCACCCTGAGG - Intergenic
1160579953 18:79878014-79878036 ACACTGTCCGTCCCACGTTGCGG + Intronic
1160645935 19:193461-193483 ACACTCCCTGTCCCACCTGGTGG - Intergenic
1162153126 19:8659485-8659507 ACACTGGCCTTCCCACCATTCGG - Intergenic
1163649609 19:18509655-18509677 ACACTCCCCTCCCCAACTGGAGG + Intronic
1163953259 19:20611117-20611139 ACTCTTGCCTTACCACATTGTGG - Intronic
1167300473 19:48674684-48674706 ACAGTCTCCTTCCCAGCTTGGGG - Intergenic
927472567 2:23386442-23386464 ACACTTCCCTTGACACCTTGTGG + Intronic
927561333 2:24076448-24076470 ACTCTCGCCTTTCCATCTTCCGG - Intergenic
932772253 2:74507195-74507217 CCGTGCGCCTTCCCACCTTGGGG + Intronic
937865510 2:126748504-126748526 GCACCCGCCTTCCCCTCTTGTGG + Intergenic
942539371 2:176999526-176999548 AAACTTCCCTTCCCTCCTTGGGG - Intergenic
946475822 2:220005507-220005529 ACACTCTCCTCCTCCCCTTGGGG - Intergenic
949082930 2:242119893-242119915 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1169037224 20:2463280-2463302 CCACTCTCCTCCCCAACTTGGGG + Intronic
1170035215 20:11982277-11982299 ACACTGGCCATCTCACCTGGGGG + Intergenic
1172667792 20:36612867-36612889 ACACTGGCCTTGCCATCTTGTGG - Exonic
1173583876 20:44166988-44167010 ACACTCGCCTTCCCACCTTGGGG + Intronic
1173957845 20:47048246-47048268 ACACTCTCCTCCCCTCCCTGAGG - Intronic
1176279572 20:64292755-64292777 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1181026506 22:20130768-20130790 ACCCTGGCCTGCCCACCCTGAGG + Intronic
1184533429 22:45071072-45071094 ACACCAGCCTTCCCACCTCCTGG + Intergenic
961696964 3:128712053-128712075 CCAAGCTCCTTCCCACCTTGGGG - Intergenic
968371746 3:198226065-198226087 ACACTCCCTGTCCCACCTGGTGG + Intergenic
968845057 4:3036361-3036383 ACTTCCGCCTCCCCACCTTGAGG + Intronic
969647949 4:8444265-8444287 CCACTCCCCTTCCCACCCTCTGG - Intronic
970656316 4:18234456-18234478 TCTCTCTCATTCCCACCTTGAGG - Intergenic
973646507 4:52956061-52956083 CCACTCTCCCTCCCAGCTTGAGG + Intronic
975831428 4:78373156-78373178 ACAAACACCTTCCCACCTGGAGG - Intronic
981089705 4:140720138-140720160 CCATGTGCCTTCCCACCTTGGGG - Intronic
984496154 4:180499457-180499479 ACACTCTCCCTCCAACCTTCTGG + Intergenic
986809211 5:11338403-11338425 ACACTCACCTTCTGAACTTGGGG + Intronic
987740289 5:21899051-21899073 TTACTCTCCTTCCCACCTGGGGG + Intronic
994055077 5:95405860-95405882 ACACTTGCTTTCCCACCCTGTGG + Intronic
994340343 5:98619353-98619375 ACCCTCACCTTCCCAGCTTCTGG - Intergenic
995808327 5:116078944-116078966 ACACTCGCCCTCCCCCCATCAGG - Intergenic
1002730987 5:181331611-181331633 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1002753546 6:142493-142515 ACACTCCCTGTCCCACCTGGTGG - Intergenic
1006247142 6:32747362-32747384 CCTCTCCCCTTCTCACCTTGAGG + Intergenic
1008698524 6:54070541-54070563 AAATTTGCCTTCCAACCTTGTGG + Intronic
1009769759 6:68130262-68130284 ACACTACCCTTGCCAGCTTGTGG + Intergenic
1016241098 6:141931899-141931921 ATACTCCGCTCCCCACCTTGTGG + Intergenic
1016383431 6:143508650-143508672 ACACTGGCCTTCCTGCCTTTGGG + Intronic
1017770558 6:157640748-157640770 ACAACCTCCTTCCCACCTTGTGG - Intronic
1022118886 7:27287691-27287713 CCACTAGCCTTCCCAGCCTGTGG - Intergenic
1023081909 7:36534074-36534096 ACTCTCCCCTCCCCACCTTCAGG + Intronic
1024076131 7:45818773-45818795 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1024667886 7:51564219-51564241 CCACTCGCCTTACCACCTGCTGG - Intergenic
1024952729 7:54881650-54881672 ACACACTCCTCCCCACTTTGTGG - Intergenic
1025128270 7:56362679-56362701 ACACTCCCTGTCCCACCTGGTGG - Intergenic
1025176652 7:56805560-56805582 ACACTCCCTGTCCCACCTGGTGG - Intergenic
1025695140 7:63770826-63770848 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1027757382 7:82231288-82231310 TCTCTCTCCATCCCACCTTGGGG - Intronic
1037723935 8:21467723-21467745 ACACCCTCCTTCCCAGCTTGCGG - Intergenic
1046172127 8:110523514-110523536 ACTATAGCCTTCCCACTTTGGGG - Intergenic
1048844244 8:138591553-138591575 AAACTGGGCGTCCCACCTTGCGG + Intronic
1049254310 8:141605659-141605681 TCAGACGCCTGCCCACCTTGAGG - Intergenic
1049431920 8:142569276-142569298 CCACTCGCCCTCCCAGCTGGAGG + Intergenic
1052583474 9:30392439-30392461 AAACTCGGCTTCACACCTAGAGG + Intergenic
1055488038 9:76776284-76776306 CCTCCCGCCTTCCCACCTTTTGG + Intronic
1056896433 9:90554929-90554951 ACACTGTCCTTTCCTCCTTGAGG - Intergenic
1059779431 9:117510593-117510615 ACATTCGCTTGCCCACCTTTTGG + Intergenic
1061098102 9:128471820-128471842 ACAAACACTTTCCCACCTTGGGG - Intronic
1062034974 9:134378980-134379002 TCTCTTGCCTTCCCTCCTTGAGG + Intronic
1062755392 9:138284118-138284140 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1203579306 Un_KI270745v1:28290-28312 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1185617796 X:1433865-1433887 GCACTTTCCTTCCCAGCTTGGGG - Intronic
1186721276 X:12306990-12307012 ACACTTGCTTTCCCACTTGGTGG - Intronic
1187846807 X:23547145-23547167 CTACTCCCCTTCCCACCTTTTGG - Intergenic
1190151972 X:47956656-47956678 ACAATCGCCTTCCCCTTTTGGGG - Intronic
1196865187 X:120065022-120065044 CCAAGCTCCTTCCCACCTTGGGG - Intergenic
1196877906 X:120171258-120171280 CCAAGCTCCTTCCCACCTTGGGG + Intergenic
1199111322 X:143938282-143938304 ACACTACCCTTCCCAGCTTATGG - Intergenic
1202381913 Y:24280912-24280934 ACACTCCCTGTCCCACCTGGTGG + Intergenic
1202488871 Y:25389213-25389235 ACACTCCCTGTCCCACCTGGTGG - Intergenic