ID: 1173589893

View in Genome Browser
Species Human (GRCh38)
Location 20:44216634-44216656
Sequence CTCTGGGTACCCTGACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173589888_1173589893 -1 Left 1173589888 20:44216612-44216634 CCATCCCGCAGAATTTGTTTGGC No data
Right 1173589893 20:44216634-44216656 CTCTGGGTACCCTGACAAAATGG No data
1173589890_1173589893 -6 Left 1173589890 20:44216617-44216639 CCGCAGAATTTGTTTGGCTCTGG No data
Right 1173589893 20:44216634-44216656 CTCTGGGTACCCTGACAAAATGG No data
1173589889_1173589893 -5 Left 1173589889 20:44216616-44216638 CCCGCAGAATTTGTTTGGCTCTG No data
Right 1173589893 20:44216634-44216656 CTCTGGGTACCCTGACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173589893 Original CRISPR CTCTGGGTACCCTGACAAAA TGG Intergenic
No off target data available for this crispr