ID: 1173589966

View in Genome Browser
Species Human (GRCh38)
Location 20:44217033-44217055
Sequence GTCCCATGGGACAACGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173589966_1173589975 20 Left 1173589966 20:44217033-44217055 CCGACCCCGTTGTCCCATGGGAC No data
Right 1173589975 20:44217076-44217098 ATAGGAGCTGTACCTACCACAGG No data
1173589966_1173589972 2 Left 1173589966 20:44217033-44217055 CCGACCCCGTTGTCCCATGGGAC No data
Right 1173589972 20:44217058-44217080 CGCATGCAGTCCACCAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173589966 Original CRISPR GTCCCATGGGACAACGGGGT CGG (reversed) Intergenic
No off target data available for this crispr