ID: 1173594240

View in Genome Browser
Species Human (GRCh38)
Location 20:44248262-44248284
Sequence GTGAACTGCACCCCTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173594238_1173594240 -2 Left 1173594238 20:44248241-44248263 CCGCTTCCTGGGGGTAAGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 152
Right 1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1173594237_1173594240 -1 Left 1173594237 20:44248240-44248262 CCCGCTTCCTGGGGGTAAGGCTG 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1173594239_1173594240 -8 Left 1173594239 20:44248247-44248269 CCTGGGGGTAAGGCTGTGAACTG 0: 1
1: 0
2: 0
3: 13
4: 292
Right 1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1173594231_1173594240 19 Left 1173594231 20:44248220-44248242 CCAACTGGATTCTCAGGGTTCCC 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173594240 Original CRISPR GTGAACTGCACCCCTCAGAC AGG Intronic
902403714 1:16172021-16172043 GTGACCTTCCCCCATCAGACTGG + Intergenic
903279454 1:22242215-22242237 TTGAACTCCACCACCCAGACTGG - Intergenic
905453636 1:38073055-38073077 GTGAACTGTAACCATGAGACGGG - Intergenic
905698801 1:39996201-39996223 GTGAGCTGCGCCACTCAGAGAGG - Intergenic
909929024 1:81473591-81473613 CTGAACTGCACCATTCAGAAGGG + Intronic
910077386 1:83297460-83297482 GTGATCTGCCCACCTCAGCCTGG - Intergenic
913707381 1:121440211-121440233 GTGAAGAGCACCCCACAGAATGG + Intergenic
922604083 1:226878316-226878338 GTGATCTGCCCACCTCAGACAGG + Intronic
1063614831 10:7592689-7592711 GAGAACTGCACTCCACAGGCAGG + Intronic
1065503175 10:26401617-26401639 CTGAATTGCACACCTCATACGGG - Intergenic
1067515527 10:46938317-46938339 GTGAAGAGCAAGCCTCAGACAGG - Intronic
1067646724 10:48113498-48113520 GTGAAGAGCAAGCCTCAGACAGG + Intergenic
1071772786 10:88748376-88748398 GTGATCTGCCCGCCTCAGACAGG - Intronic
1071824406 10:89310456-89310478 GCAAACTGCAACCCTCAGATTGG - Intronic
1073683942 10:105732455-105732477 TTGAACTGCACCCCAAAAACTGG + Intergenic
1077019003 11:409267-409289 GGGCACTGCACCCCTCAGCCTGG + Intronic
1078626894 11:12966213-12966235 ATGAACCTCACCCCTCAGATGGG - Intergenic
1078706213 11:13746665-13746687 GAGCACAGCAACCCTCAGACAGG + Intergenic
1078830456 11:14972613-14972635 GTGAATTTCACCTCTCAGTCCGG + Intronic
1081139262 11:39477364-39477386 GTGAACTGTAAACATCAGACAGG + Intergenic
1082944208 11:58740750-58740772 CTGAGCTGGACCCCTCAGCCAGG - Intergenic
1085592805 11:77779618-77779640 GTGATCTGCCCACCTCAGCCTGG + Intronic
1089973979 11:122716750-122716772 CTGAACTGGACTCCTTAGACAGG - Intronic
1091068044 11:132535670-132535692 GTGACCTGAACCCCTCTCACTGG - Intronic
1091906768 12:4195421-4195443 GTGAGAGGGACCCCTCAGACTGG - Intergenic
1092951313 12:13506160-13506182 ATGAACTTCTCCCATCAGACAGG - Intergenic
1094443366 12:30503666-30503688 GTGAACTGAACCACTCAGAGTGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1100200755 12:92295658-92295680 GTGGACAGCAACCCACAGACTGG + Intergenic
1100389583 12:94136621-94136643 GCTAACTGCACCCCTCCTACAGG + Intergenic
1103520829 12:121536356-121536378 GTCAACTACACCCCTCCGATGGG - Intronic
1103596971 12:122030066-122030088 GGGAACTGCACCCCTGATTCAGG - Intronic
1106145007 13:27042432-27042454 GTGATCCGCACACCTCAGCCTGG + Intergenic
1107089691 13:36464574-36464596 GTGAATTGCACCCCTCAAGTTGG - Intergenic
1112308098 13:98293535-98293557 GTGTCCTGCACCCCACAGAGAGG + Intronic
1121958404 14:98236152-98236174 TTGAACTGAACCCCTCACAATGG + Intergenic
1122236218 14:100332053-100332075 GTGATCTGCCCGCCTCAGCCTGG + Intergenic
1122928838 14:104924011-104924033 GGGAACTGCACCCTCCTGACTGG + Intergenic
1202895279 14_GL000194v1_random:3012-3034 GTGAACTGCACCCACCACAAGGG + Intergenic
1125471039 15:40004057-40004079 CTCAACTTCACCCATCAGACAGG + Intronic
1126066517 15:44830111-44830133 GTGACCTCCACCCCGCAGAGAGG - Intergenic
1126093364 15:45070758-45070780 GTGACCTCCACCCCGCAGAGAGG + Intronic
1131587939 15:93716338-93716360 CTTCACTGCACACCTCAGACAGG + Intergenic
1138819740 16:60244730-60244752 GTGATCTGCCCACCTCAGCCTGG - Intergenic
1141614727 16:85203683-85203705 GTGAACTGTACACTTGAGACAGG - Intergenic
1143425243 17:6831247-6831269 GAGAACTGCCTTCCTCAGACAGG + Intronic
1145201868 17:20952833-20952855 GTGATGTGCACCCCACAGGCAGG - Intergenic
1147761893 17:42803719-42803741 TTGAACGGCACCTCTCAGAGTGG + Intronic
1154500345 18:14992905-14992927 GTGAACTGCACCCACCACAAGGG + Intergenic
1157909482 18:51602107-51602129 GTGACATGCACCCCTCCCACAGG + Intergenic
1158633328 18:59134987-59135009 GAGAACTGCCCCTCTCAGAGAGG - Intergenic
1160066183 18:75576292-75576314 GTGCACTGCAACCCTCATATTGG - Intergenic
1161478205 19:4497930-4497952 GAGAAGTGCTCCCCTCAGTCGGG - Intronic
1165998730 19:39864506-39864528 GTGATCTGCCTCCCTCAGCCTGG + Intronic
1167165992 19:47800595-47800617 GTAAGCTGGACACCTCAGACTGG + Intergenic
926143261 2:10381138-10381160 GGCACCTGCACACCTCAGACCGG - Intronic
932219876 2:69991185-69991207 GAGAGCTGCACCCCACACACGGG + Intergenic
933921568 2:87052895-87052917 GTGAACAGCCTGCCTCAGACTGG - Intergenic
935150283 2:100427763-100427785 GTGAACAGCACCCGCGAGACAGG + Intergenic
935377130 2:102411112-102411134 GGGCACTGGAGCCCTCAGACTGG - Intergenic
937962622 2:127472599-127472621 GTGTACTGTTCCTCTCAGACAGG - Intronic
938810556 2:134848712-134848734 GTGAACAGCAACCCACAGAATGG - Intronic
939462411 2:142513819-142513841 ATGAACTGCATCCCTTAGAAGGG - Intergenic
941198823 2:162484022-162484044 GTAAACTGCACACCCAAGACTGG - Intronic
1170646843 20:18204108-18204130 GTGGACTCCACCCCCCCGACCGG + Intergenic
1173124081 20:40320699-40320721 GGGAGCTGCACCACTCAGAAGGG + Intergenic
1173594240 20:44248262-44248284 GTGAACTGCACCCCTCAGACAGG + Intronic
1181544821 22:23596231-23596253 TTGAACTGCACCCCTGAGGTTGG - Intergenic
1183907052 22:41049500-41049522 GTGACTTGCATCCCTCACACAGG - Intergenic
1184547021 22:45177474-45177496 GTGAAATGCAGTCCTCAGCCAGG - Intronic
952331885 3:32371126-32371148 GTGATCTGCCCACCTCAGTCAGG - Intergenic
952914094 3:38218614-38218636 GTGAAAGGCAACCCACAGACTGG - Intronic
955025500 3:55163698-55163720 GTGAACTACATGCTTCAGACAGG + Intergenic
957024043 3:75159452-75159474 GTGACCTGCCCGCCTCAGCCTGG + Intergenic
959399741 3:105885211-105885233 GTGAAGTGAACCCTTCAGAATGG - Intergenic
967414604 3:189202291-189202313 GAGAGCTACCCCCCTCAGACCGG + Intronic
970873390 4:20842337-20842359 CTGAAGTGCACCCCTCTGAAGGG - Intronic
971483977 4:27140876-27140898 GTGATCTGCCCGCCTCAGCCGGG - Intergenic
972244567 4:37231367-37231389 CTGAACTGTACACTTCAGACAGG - Intergenic
972774837 4:42231105-42231127 GTGATCTGCCCGCCTCAGCCTGG + Intergenic
972817832 4:42663621-42663643 ATGAACTGGATCCCTCAGATTGG + Intergenic
973330601 4:48907110-48907132 GTGACCTGCACTTCACAGACGGG + Intergenic
976770300 4:88645118-88645140 GTCTGCTGCACCCCACAGACTGG + Intronic
982085983 4:151836574-151836596 GTGATCTGCCCACCTCAGCCGGG + Intergenic
985174697 4:187188597-187188619 CTGACCTGCGCCACTCAGACAGG + Intergenic
990050449 5:51493873-51493895 GTGACCAGGACCCCTCTGACTGG - Intergenic
992387682 5:76301521-76301543 TGGAACTGTACCCCACAGACCGG + Exonic
997666415 5:135633040-135633062 GAGGACTGCAGCCCTAAGACGGG + Intergenic
998230392 5:140357796-140357818 GGGCACTGCTCCCCTCAGACCGG - Intergenic
1004149072 6:13097855-13097877 GAAAACAGCAGCCCTCAGACAGG + Intronic
1007822221 6:44569122-44569144 GTGGACTGCACCCATTAGAGTGG + Intergenic
1013691627 6:112651573-112651595 ATGAACTGCTGCCCTCAGAAAGG - Intergenic
1015143979 6:129965329-129965351 CTGAACTGCACCCCTAAAAATGG + Intergenic
1019324273 7:430317-430339 GTGAATTGCAGCCGTCACACAGG + Intergenic
1022416343 7:30180773-30180795 CTGAACTGCACACATCAGAATGG - Intergenic
1027295160 7:76762673-76762695 GTGATCTGCCCACCTCAGCCTGG - Intergenic
1031142229 7:117956104-117956126 ATGAACTTCTCCCCTCAGCCTGG + Intergenic
1032387609 7:131535301-131535323 CTGAACTGCACCCCTAAAAATGG + Intronic
1036258033 8:7220884-7220906 GAGAACTGTACCCCTCAGTGAGG - Intergenic
1036310082 8:7679480-7679502 GAGAACTGTACCCCTCAGTGAGG - Intergenic
1036359454 8:8066622-8066644 GAGAACTGTACCCCTCAGTGAGG + Intergenic
1036390306 8:8318893-8318915 GTGCACTGCACCCTCCAGGCCGG - Exonic
1036891503 8:12600330-12600352 GAGAACTGTACCCCTCAGTGAGG - Intergenic
1036938903 8:13032320-13032342 GTCACCTGCACACCTCACACAGG + Intergenic
1036999549 8:13701909-13701931 GTGAATTGTACCCCTCAAATGGG + Intergenic
1037603169 8:20415968-20415990 GTGCACTGCCACCCTCAAACAGG + Intergenic
1038575404 8:28700514-28700536 AAGAACTGCACCCCAGAGACAGG - Intronic
1038763363 8:30405276-30405298 CGGAGCTGCACTCCTCAGACAGG - Intronic
1041345067 8:56888702-56888724 GTGAACTGGGCCCCTGAGAGAGG - Intergenic
1046540819 8:115580368-115580390 GTAAAATGGACCCATCAGACTGG + Intronic
1048398448 8:134038493-134038515 GTGTCTTCCACCCCTCAGACTGG + Intergenic
1048755507 8:137733454-137733476 GTGAACTGCACCCAGCAAAGGGG + Intergenic
1049719540 8:144109313-144109335 GTGACCTGCACCCCTCCCACAGG + Exonic
1051741972 9:20261090-20261112 GTGATCTGCCCGCCTCAGCCCGG + Intergenic
1052873360 9:33530408-33530430 GTGATCTGCCCGCCTCAGGCTGG - Intronic
1052985009 9:34480514-34480536 GTGAGCTGCCCACCTCAGCCTGG + Intronic
1053104898 9:35400959-35400981 ATAAACAGCACCCCTGAGACTGG - Intronic
1053502740 9:38614341-38614363 GTGATCTGCCCGCCTCAGGCTGG + Intergenic
1053647203 9:40130570-40130592 GTGAACTGCACCCACCACAAGGG - Intergenic
1053758521 9:41333273-41333295 GTGAACTGCACCCACCACAAGGG + Intergenic
1054537375 9:66245600-66245622 GTGAACTGCACCCACCACAAGGG + Intergenic
1055324262 9:75112059-75112081 GTGATCTGCCCACCTCAGCCTGG + Intronic
1056772655 9:89491230-89491252 TTGAACTGCTGCCCTAAGACAGG - Intronic
1057147243 9:92766316-92766338 GTGCACTGCACTCCTCAGAAAGG - Intergenic
1189015945 X:37096515-37096537 CGGAGCTGCACTCCTCAGACAGG - Intergenic
1190260731 X:48795270-48795292 GTGAACTGCTCCCCCCACAGCGG + Intergenic
1198257108 X:134933456-134933478 GTGATCTGCCCTCCTCAGCCAGG + Intergenic