ID: 1173595350

View in Genome Browser
Species Human (GRCh38)
Location 20:44255599-44255621
Sequence CCAGCAAATAAGTGTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173595350 Original CRISPR CCAGCAAATAAGTGTAAAGC TGG Intronic
905195834 1:36276558-36276580 GCATCAAGAAAGTGTAAAGCTGG + Intronic
907534591 1:55138379-55138401 AGAACAAATAAGAGTAAAGCAGG - Intronic
908777521 1:67655594-67655616 ACAGCAAACAATTATAAAGCTGG + Intergenic
916100382 1:161389173-161389195 ACAGAAAGTAAATGTAAAGCAGG + Intergenic
917242468 1:172963560-172963582 CCAGCAAATATATGAAAAGAAGG + Intergenic
919745045 1:201003630-201003652 CCAGCAAATCAGTGCACTGCGGG - Exonic
921734706 1:218613764-218613786 ACAGCAAATAAGTATAGAGGAGG - Intergenic
922060004 1:222079829-222079851 CCAACAAATAAGTCATAAGCTGG + Intergenic
922364354 1:224850257-224850279 CCAGATGATAAGTGTAAAGATGG - Intergenic
1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG + Intronic
1068305964 10:55208679-55208701 GGAGCAAATATGTGAAAAGCCGG - Intronic
1069799436 10:71072980-71073002 CCAGCAATGGAGAGTAAAGCTGG - Intergenic
1070575432 10:77673659-77673681 CCAGCTAATAAATGCAGAGCAGG - Intergenic
1071700813 10:87933117-87933139 GCAGCAATTCACTGTAAAGCTGG + Exonic
1073876963 10:107935997-107936019 CAAGAAAATTTGTGTAAAGCAGG + Intergenic
1074925781 10:118069041-118069063 CCTGCAAACATGGGTAAAGCTGG - Intergenic
1077453222 11:2663227-2663249 CCAGCAGATCACTGGAAAGCAGG + Intronic
1081016036 11:37882126-37882148 CCCAAAAATAAGTGTAAAACAGG - Intergenic
1082769441 11:57195436-57195458 CCATGAGATAGGTGTAAAGCTGG - Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1091870999 12:3891252-3891274 CACGCAAATATATGTAAAGCTGG + Intergenic
1091914354 12:4258167-4258189 AAAGCAAATAAGTTTAAAGATGG - Intergenic
1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG + Intronic
1094329687 12:29277632-29277654 CCGGCAGATAATTTTAAAGCAGG - Intronic
1095219000 12:39586022-39586044 TAAGCACATAAGTGTAAAGATGG - Intronic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1107350744 13:39512179-39512201 ACAGGAAATCAGTGTTAAGCAGG - Intronic
1109588231 13:64438669-64438691 TCAACAAATATGTGTAAAGAAGG - Intergenic
1111840419 13:93442688-93442710 CCAGCAAAAATGTATATAGCTGG - Intronic
1117106298 14:52400342-52400364 CCAGCAAAGTCTTGTAAAGCTGG + Intergenic
1117847511 14:59927020-59927042 CCAGAATACAAATGTAAAGCTGG - Intronic
1119171421 14:72538960-72538982 CCAGCAAATAACTGAAATGAGGG - Intronic
1120383402 14:83811935-83811957 AAAGCATATATGTGTAAAGCTGG + Intergenic
1120651468 14:87138893-87138915 ACAGAAAATAATTTTAAAGCAGG - Intergenic
1127518607 15:59720861-59720883 CCTTCAAAGAAGTGGAAAGCAGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140203940 16:72918205-72918227 CAAGCAAATAAGTCAAAAGCAGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1145785307 17:27589699-27589721 CCAGAAAAAAAGTGCAAGGCTGG - Intronic
1146176893 17:30670880-30670902 ACAGCTAATAACTGTGAAGCCGG - Intergenic
1146350356 17:32086980-32087002 ACAGCTAATAACTGTGAAGCTGG - Intergenic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1155545181 18:26907321-26907343 CCACCAAATAAGGAGAAAGCAGG + Exonic
1162981925 19:14246030-14246052 ACAGCTAATAACTGTGAAGCCGG + Intergenic
926787552 2:16533271-16533293 CCAGTAACTCTGTGTAAAGCTGG + Intergenic
927843503 2:26459667-26459689 CCAGCAAATTAGGGTAGAGCCGG - Intronic
928612560 2:33004894-33004916 CCAGGAAATCATTGGAAAGCTGG + Intronic
929188137 2:39116572-39116594 CCAGCCAATAAGTTTTAAGTAGG - Intronic
929353758 2:40994008-40994030 CCATCAAATAAGTGTTAAAAGGG + Intergenic
933583423 2:84152970-84152992 CCAGCAAATAAATGTGAAAGTGG - Intergenic
934942676 2:98513903-98513925 CCAGCAAATAAGAGAACAACGGG - Intronic
939013427 2:136873930-136873952 TCAGCAAACAAGTGTCAAGCTGG - Intronic
941808986 2:169737085-169737107 TCAGCAAGTAAGAGGAAAGCAGG - Intronic
944579689 2:201121174-201121196 CTGGCAAATAATTATAAAGCTGG + Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946885737 2:224220692-224220714 AGAGCAAATCTGTGTAAAGCTGG - Intergenic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG + Intergenic
1177562602 21:22775771-22775793 GCAGCAAATATGTGTAATACAGG - Intergenic
1177591681 21:23178635-23178657 CCAGTAAATAATTTAAAAGCAGG - Intergenic
1177701858 21:24649178-24649200 CCAGCAAAATAGTTTAAAGGTGG - Intergenic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1178763853 21:35430599-35430621 CAGGCAAATAAGTGTTAATCTGG + Intronic
1182188421 22:28432502-28432524 CCAGTAAATAACTGTAAATGTGG - Intronic
1183259017 22:36782258-36782280 GCAGCAAATAAGTCAAAAGGCGG - Intergenic
1184032982 22:41905609-41905631 CCAGCAGATGATTGTTAAGCTGG + Exonic
949876640 3:8630257-8630279 CCAGTCCAAAAGTGTAAAGCAGG + Intronic
951999409 3:28768534-28768556 CCATTAAATAAGTTTAAAGCAGG + Intergenic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
953781622 3:45876498-45876520 CCTGCAAGCAAGTGTAGAGCTGG + Intronic
958594596 3:96205210-96205232 TCAGCAAAAAAGAGCAAAGCTGG + Intergenic
961557861 3:127708872-127708894 CCAGCAATCAATTGTAAAACAGG + Intronic
972330382 4:38058602-38058624 CCAGAATATAAATGTAAAACAGG - Intronic
974087326 4:57275353-57275375 GTAACAAATATGTGTAAAGCAGG - Intergenic
974313072 4:60238335-60238357 TCAGTTAATAAGTATAAAGCTGG - Intergenic
975050777 4:69862138-69862160 ACTGAAAACAAGTGTAAAGCTGG + Intergenic
975290293 4:72670514-72670536 CCAGGAAATAAGAGCAAACCTGG - Intergenic
976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG + Intronic
977182222 4:93890369-93890391 CTAGAGAATAAGTGGAAAGCTGG - Intergenic
978211117 4:106136398-106136420 CCAGAAAAGAAGTGGAAAACTGG + Intronic
978455825 4:108890308-108890330 CAATGAAATAAGTGTAAAGCTGG - Intronic
985007829 4:185551794-185551816 CAATCAAATAAGTGAGAAGCTGG - Intergenic
989754068 5:44930921-44930943 CCAGGGAATAAATGTAAAGGAGG - Intergenic
991084820 5:62639180-62639202 CCTGCAAGTAAGTGTAAAAGTGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
1005267967 6:24132948-24132970 TAAGCAAATAAATGTATAGCTGG - Intronic
1010385647 6:75276635-75276657 CTGGTAAATAAGAGTAAAGCAGG - Intronic
1016241718 6:141939171-141939193 CCAGGAAATAAGTAAAAAGCAGG + Intergenic
1017147455 6:151247552-151247574 CAAGCAAATAAATTTAAAGATGG - Intronic
1017831543 6:158134933-158134955 TCAGCCAATAAGTGTTGAGCTGG + Intronic
1023466548 7:40462134-40462156 CCAGAAGTTAAGTGTGAAGCTGG + Intronic
1025147242 7:56515416-56515438 CCAGAAAACAAGAGCAAAGCTGG + Intergenic
1026319124 7:69253692-69253714 CCAGAAAACAAGGGCAAAGCTGG - Intergenic
1028069265 7:86430883-86430905 CATACAAATCAGTGTAAAGCTGG + Intergenic
1028418828 7:90609945-90609967 AAACCAAATAAGGGTAAAGCAGG - Intronic
1031925183 7:127632156-127632178 CCAGCTAAGTAGGGTAAAGCAGG - Intergenic
1033502728 7:141968542-141968564 GCAGCAAAGAAGTGTTGAGCAGG + Intronic
1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG + Intergenic
1036137813 8:6178341-6178363 CAAGCAAATAAGCGGAAAGAGGG - Intergenic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1037110824 8:15162566-15162588 CCATAAGATAAGTGAAAAGCTGG - Intronic
1038352344 8:26788708-26788730 TCAGCCAATAAGAGTGAAGCTGG + Intronic
1038966242 8:32575648-32575670 CTAGAAAATAAGTATAAAGTAGG + Intronic
1042147851 8:65750732-65750754 CCAGAAAATAAGAGTTAGGCAGG - Intronic
1042589230 8:70380083-70380105 ACAGGAAACAAGTGTCAAGCAGG + Intronic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1046528697 8:115415460-115415482 CCAGCATATAAGAGTAACACAGG + Intronic
1047636779 8:126772315-126772337 TCAGCAAATCAGTGGAAACCAGG - Intergenic
1050222561 9:3410558-3410580 GCAGCAAATAAGTGTAATTTTGG + Intronic
1051162016 9:14219589-14219611 CCATAAAATACGTGTAAAGCAGG - Intronic
1052888728 9:33676272-33676294 GCAGCAATTCACTGTAAAGCTGG - Intergenic
1186579212 X:10799261-10799283 CAAGCAAATAATTGACAAGCAGG + Intronic
1192087003 X:68110033-68110055 CCAGCAAAACAGCGTAAAACAGG - Intronic
1192303239 X:69928717-69928739 ACAGCACATAATTGTAAACCAGG + Intronic
1195100547 X:101551018-101551040 CCTGCAGGTCAGTGTAAAGCTGG + Exonic