ID: 1173595868

View in Genome Browser
Species Human (GRCh38)
Location 20:44258129-44258151
Sequence GACCCAAGCATTGAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173595867_1173595868 -2 Left 1173595867 20:44258108-44258130 CCAACATTTAAAAGTCAAGGGGA 0: 1
1: 0
2: 0
3: 30
4: 273
Right 1173595868 20:44258129-44258151 GACCCAAGCATTGAGCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173595868 Original CRISPR GACCCAAGCATTGAGCACCC AGG Intronic
901814577 1:11786990-11787012 GACCCTGGAATTCAGCACCCTGG - Exonic
905523598 1:38619433-38619455 AACCCAGGCTTTGAGCACACAGG + Intergenic
907281851 1:53352784-53352806 GACCCAGGCATTCAGCTTCCAGG - Intergenic
908979459 1:69936772-69936794 GAGCTAAACATTGAGCACACAGG - Intronic
909878974 1:80848519-80848541 GCCCCAGGCAATGAGCCCCCAGG + Intergenic
912586124 1:110767575-110767597 TACTCAAGCATTAAGCTCCCTGG - Intergenic
914932929 1:151950626-151950648 CATCCAAGCCGTGAGCACCCAGG - Intergenic
918100660 1:181370482-181370504 GAGCCAAACATTGAGTACACAGG - Intergenic
919244132 1:194955553-194955575 GACCCAAGGATTGAGAGCTCTGG - Intergenic
919657702 1:200213879-200213901 AACCCAAGCAGTGAGCCCCTGGG + Intergenic
922028833 1:221779083-221779105 GCTCCTGGCATTGAGCACCCAGG - Intergenic
922729246 1:227941444-227941466 GACCCCAGAGTTGAGCAACCAGG + Intronic
924728229 1:246689728-246689750 GAACCACCCAGTGAGCACCCTGG - Intergenic
1065705662 10:28469504-28469526 GACCCCAGCCCTGACCACCCAGG - Intergenic
1072445638 10:95496396-95496418 GACCTCATCATTGAGCACCCAGG - Intronic
1076299186 10:129411882-129411904 GAGCCAAGCAGTGACGACCCAGG + Intergenic
1076848653 10:133082334-133082356 GACCCAGGCAGAGAGCACCTGGG - Intronic
1077365284 11:2159064-2159086 AACCCATGCCTTGGGCACCCCGG - Intronic
1078413622 11:11147699-11147721 GACCAAAGCATGCAGCACCCTGG - Intergenic
1079413786 11:20213648-20213670 GACCCCACACTTGAGCACCCTGG + Intergenic
1083627584 11:64079443-64079465 GATCCAAGAAATGAGCAGCCGGG + Intronic
1084651220 11:70490537-70490559 AACCACAGCATTGAGGACCCAGG + Intronic
1085975848 11:81653719-81653741 GAGCTAAGCATTGAGTACCCAGG - Intergenic
1089073338 11:115717710-115717732 GCCCCAAGCAGGGATCACCCTGG + Intergenic
1095531387 12:43190493-43190515 GCCCCAGGCAATGAGCTCCCAGG + Intergenic
1096294929 12:50375934-50375956 GAGCCAGGCATGGAGCACCGAGG + Intronic
1099233051 12:80049837-80049859 GACCCAAGAATTGAGCCCTAGGG - Intergenic
1104978310 12:132561833-132561855 GAACCAGGCACTGAACACCCAGG - Intronic
1106483104 13:30151346-30151368 GACCCAAGGAGTCAGCAGCCTGG + Intergenic
1107201347 13:37722267-37722289 TGTCCAAGCATTGAACACCCAGG - Intronic
1108039840 13:46329869-46329891 GACCCAAGTATTGGGTACCCAGG - Intergenic
1109914920 13:68970605-68970627 GACTCAGGCATTGAACACTCAGG - Intergenic
1126026170 15:44448147-44448169 GACCAAACCATTGAGCACATGGG - Intronic
1127959852 15:63882620-63882642 GGGCCAAGCTCTGAGCACCCTGG + Intergenic
1133275942 16:4638552-4638574 CACCCACGCATTGATCCCCCTGG - Intronic
1135735517 16:24928666-24928688 GACCTAAGCTGTGAGCACTCTGG + Intronic
1135986924 16:27190612-27190634 GAGCCAGGCATGGAGCAGCCAGG - Intergenic
1137817941 16:51417045-51417067 GGACCACACATTGAGCACCCAGG + Intergenic
1137836989 16:51601717-51601739 GTCTCAAGTATTGAGTACCCAGG - Intergenic
1138236334 16:55386202-55386224 GAACTTAGCATTGACCACCCTGG - Intergenic
1140125515 16:72114735-72114757 GAGCTAAACATTGAGCACACAGG - Intronic
1140646375 16:77035643-77035665 GACCCAACACTGGAGCACCCAGG - Intergenic
1142284317 16:89165550-89165572 GCCACAGGCACTGAGCACCCCGG - Intergenic
1143789833 17:9285641-9285663 GTCCCAAACAGTGATCACCCTGG + Intronic
1144467148 17:15505810-15505832 GCCCCGGGCAATGAGCACCCGGG + Intronic
1145258936 17:21343342-21343364 GGCCCACGCAATGAGCAACCAGG - Intergenic
1145317687 17:21744662-21744684 GGCCCACGCAATGAGCAACCAGG + Intergenic
1146454216 17:32996767-32996789 GACCTGTGCAGTGAGCACCCTGG + Intronic
1148725285 17:49784890-49784912 TACCCAGGCATTAATCACCCAGG - Intronic
1151098158 17:71523065-71523087 GAGCTAAGCATTCAGCACACAGG + Intergenic
1152063333 17:78095508-78095530 GACCCAAACGTCGAGCACCCGGG - Intronic
1152588223 17:81198550-81198572 GGCCCCACCATTGAGCAGCCTGG + Intronic
1152908534 17:82983926-82983948 GACACCAGCAGTGAGCACACAGG + Intronic
1153141212 18:1974403-1974425 GGCCCCAGCATTTAGCAGCCTGG - Intergenic
1155178793 18:23325096-23325118 GACCCAGCCAGGGAGCACCCAGG - Intronic
1156158043 18:34327425-34327447 GTGCTAAGCATTGAGTACCCAGG + Intergenic
1157333792 18:46722448-46722470 GACCCAAGCATTCAGAAGCCAGG - Intronic
1157419862 18:47537852-47537874 TACCCAAGCATCCATCACCCAGG - Intergenic
1158522135 18:58180312-58180334 GAGCCAAGGACTGTGCACCCGGG - Intronic
1161587268 19:5112478-5112500 GACCCAGCCACTGAGCACCAAGG + Intronic
1163318055 19:16555055-16555077 AACCCCAGCCTTGAGCGCCCGGG + Intronic
1165449058 19:35871818-35871840 GACCCAGGCAGTAAGAACCCAGG - Intronic
1167323103 19:48808159-48808181 GACCCACGCTCTGATCACCCCGG - Intronic
1167762991 19:51461075-51461097 CACCCAAGCATTGGGCATTCTGG - Intergenic
1167954928 19:53057017-53057039 GTGTCCAGCATTGAGCACCCAGG - Intergenic
925151069 2:1615165-1615187 GACCCCAGCACTCTGCACCCTGG - Intergenic
934670982 2:96212659-96212681 GACCCAACCAATCAGCACTCTGG + Intergenic
936090908 2:109500872-109500894 CACCGAAGCCTTGAGCTCCCAGG - Intronic
936116460 2:109706794-109706816 GATACAAGGATGGAGCACCCAGG + Intergenic
940396157 2:153195362-153195384 GAGTCAAACATTGAGCAGCCAGG + Intergenic
942375161 2:175329044-175329066 GACCCCAACACTGGGCACCCTGG - Intergenic
944330224 2:198457055-198457077 AACCCAAGCATCTTGCACCCAGG - Intronic
944650741 2:201827907-201827929 GAGCCAAGCACTGAGCAGCAAGG + Intronic
1169098057 20:2921071-2921093 GACCCAGGCATTGAGAAGCAAGG + Intronic
1170459607 20:16564914-16564936 CTCCCAAGCCTTGAGCCCCCTGG + Intronic
1170688941 20:18594600-18594622 TACCCAAGCTCTGAGCACCAAGG - Intronic
1173595868 20:44258129-44258151 GACCCAAGCATTGAGCACCCAGG + Intronic
1175552179 20:59824728-59824750 GACCTGAGCATTGACCACCAGGG + Intronic
1176372689 21:6071882-6071904 GAACCCAGCATTGAGACCCCAGG + Intergenic
1179750787 21:43466361-43466383 GAACCCAGCATTGAGACCCCAGG - Intergenic
1185245221 22:49769731-49769753 GGCCCAGGCTCTGAGCACCCAGG - Intergenic
955458401 3:59151222-59151244 GAACCTAGGATTGAGCACCGAGG - Intergenic
956229866 3:67001995-67002017 GACCGAAACATTAAGCAGCCTGG - Intronic
961654723 3:128435034-128435056 GAGCCACGCAGTGAGCTCCCAGG - Intergenic
966905201 3:184518774-184518796 CGCCCAAGCAGTGAGCACCTGGG - Intronic
973263835 4:48191017-48191039 GACATAATGATTGAGCACCCAGG + Intronic
977290466 4:95160019-95160041 GTTCCAAGCATTGTGGACCCTGG + Intergenic
978705463 4:111703996-111704018 GAGCCAAACACTGAGCACCTGGG + Intergenic
982130892 4:152227786-152227808 GGTCCAAGCATTGGGCAGCCAGG - Intergenic
985519712 5:367884-367906 GCCCCGAGCATTGGACACCCAGG + Intronic
986560424 5:9055075-9055097 GACCCCAGCATTCAGCAGGCGGG - Intronic
988755405 5:34243752-34243774 AACCTAAACATTGAGCACACAGG + Intergenic
989324195 5:40171681-40171703 GAACTAAACATTGAGCACGCAGG + Intergenic
989353037 5:40509710-40509732 GAGGCCAGCCTTGAGCACCCTGG + Intergenic
1002780651 6:362973-362995 GGCCCAAGCACTGAGCAAGCAGG + Intergenic
1003530556 6:6933968-6933990 GACTCAAGCTTTGAGAACCATGG + Intergenic
1005554038 6:26955523-26955545 AACCTAAACATTGAGCACACAGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1010891569 6:81318856-81318878 GAGCCAAACATTGAGCACATGGG + Intergenic
1016008448 6:139113248-139113270 CACACAAGCATTAAGCTCCCTGG - Intergenic
1018255328 6:161912654-161912676 GACCCAAGAACTGAGGCCCCAGG + Intronic
1019475967 7:1244370-1244392 GAGCGAAGCATCCAGCACCCAGG + Intergenic
1023017115 7:35979566-35979588 GAGTGAAGCAATGAGCACCCTGG + Intergenic
1026658511 7:72278127-72278149 AACCCCTGCCTTGAGCACCCAGG + Intronic
1028562558 7:92191752-92191774 CACCCAACATTTGAGCACCCAGG - Intergenic
1032666491 7:134042406-134042428 GACAAGAGCATTGAGCACACTGG - Intronic
1035735269 8:1882868-1882890 GACCCAAGCACTGAGCAGGCTGG - Intronic
1036009147 8:4701479-4701501 GACCCCAGCACAGAACACCCAGG + Intronic
1044480693 8:92684036-92684058 GGCTCAAGAATTGAGCAGCCTGG + Intergenic
1048476606 8:134748139-134748161 GACCCAAGCAATCATCCCCCAGG + Intergenic
1055570460 9:77611353-77611375 AACACAAGCATTGAGCATTCAGG - Intronic
1055887098 9:81076360-81076382 GACCAAAGCATTGAGCAACTTGG - Intergenic
1058252631 9:102719556-102719578 GACCTAAACATGGAGCACCCAGG + Intergenic
1059887073 9:118758155-118758177 GTCCCAATTATTGAGCACACTGG + Intergenic
1188175004 X:26978059-26978081 GACCCAGGGTTTGGGCACCCTGG + Intergenic
1189340304 X:40200029-40200051 GGCCCTAGCAGTGCGCACCCTGG + Intergenic
1192476125 X:71444639-71444661 GACCAAAGCCTTGACCTCCCGGG - Intronic