ID: 1173595949

View in Genome Browser
Species Human (GRCh38)
Location 20:44258420-44258442
Sequence GGCGGTGCCCACAGAGCACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173595943_1173595949 -9 Left 1173595943 20:44258406-44258428 CCTGCCCAGCCCCTGGCGGTGCC 0: 1
1: 1
2: 8
3: 72
4: 661
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1173595938_1173595949 3 Left 1173595938 20:44258394-44258416 CCCTCTGGCTTCCCTGCCCAGCC 0: 1
1: 0
2: 5
3: 101
4: 706
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1173595936_1173595949 16 Left 1173595936 20:44258381-44258403 CCGGGGCAGGTGCCCCTCTGGCT 0: 1
1: 0
2: 2
3: 44
4: 302
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1173595933_1173595949 30 Left 1173595933 20:44258367-44258389 CCGGGGGCAGGTGGCCGGGGCAG 0: 2
1: 1
2: 9
3: 91
4: 693
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1173595942_1173595949 -8 Left 1173595942 20:44258405-44258427 CCCTGCCCAGCCCCTGGCGGTGC 0: 1
1: 1
2: 8
3: 39
4: 607
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1173595939_1173595949 2 Left 1173595939 20:44258395-44258417 CCTCTGGCTTCCCTGCCCAGCCC 0: 1
1: 1
2: 17
3: 131
4: 934
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162
1173595937_1173595949 4 Left 1173595937 20:44258393-44258415 CCCCTCTGGCTTCCCTGCCCAGC 0: 1
1: 0
2: 5
3: 70
4: 713
Right 1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG 0: 1
1: 0
2: 0
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173595949 Original CRISPR GGCGGTGCCCACAGAGCACG TGG Exonic