ID: 1173599500

View in Genome Browser
Species Human (GRCh38)
Location 20:44283275-44283297
Sequence GACTCAGGCCTGGCACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173599500_1173599503 4 Left 1173599500 20:44283275-44283297 CCAGGTGGTGCCAGGCCTGAGTC No data
Right 1173599503 20:44283302-44283324 TTCCTCCATCAACTGATTATAGG No data
1173599500_1173599508 26 Left 1173599500 20:44283275-44283297 CCAGGTGGTGCCAGGCCTGAGTC No data
Right 1173599508 20:44283324-44283346 GGCATTTGCCAAGAGGCCTCTGG No data
1173599500_1173599507 19 Left 1173599500 20:44283275-44283297 CCAGGTGGTGCCAGGCCTGAGTC No data
Right 1173599507 20:44283317-44283339 ATTATAGGGCATTTGCCAAGAGG No data
1173599500_1173599504 5 Left 1173599500 20:44283275-44283297 CCAGGTGGTGCCAGGCCTGAGTC No data
Right 1173599504 20:44283303-44283325 TCCTCCATCAACTGATTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173599500 Original CRISPR GACTCAGGCCTGGCACCACC TGG (reversed) Intergenic
No off target data available for this crispr