ID: 1173601577

View in Genome Browser
Species Human (GRCh38)
Location 20:44299215-44299237
Sequence CGGCCGGCTGTTCCGAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173601577_1173601592 24 Left 1173601577 20:44299215-44299237 CCCGCACTCGGAACAGCCGGCCG No data
Right 1173601592 20:44299262-44299284 AGGCTTAGCACCCAGGCCAGCGG No data
1173601577_1173601593 30 Left 1173601577 20:44299215-44299237 CCCGCACTCGGAACAGCCGGCCG No data
Right 1173601593 20:44299268-44299290 AGCACCCAGGCCAGCGGCTGCGG No data
1173601577_1173601583 -6 Left 1173601577 20:44299215-44299237 CCCGCACTCGGAACAGCCGGCCG No data
Right 1173601583 20:44299232-44299254 CGGCCGGCCCTGCCGGACCCGGG No data
1173601577_1173601582 -7 Left 1173601577 20:44299215-44299237 CCCGCACTCGGAACAGCCGGCCG No data
Right 1173601582 20:44299231-44299253 CCGGCCGGCCCTGCCGGACCCGG No data
1173601577_1173601587 4 Left 1173601577 20:44299215-44299237 CCCGCACTCGGAACAGCCGGCCG No data
Right 1173601587 20:44299242-44299264 TGCCGGACCCGGGCAATAAGAGG No data
1173601577_1173601591 17 Left 1173601577 20:44299215-44299237 CCCGCACTCGGAACAGCCGGCCG No data
Right 1173601591 20:44299255-44299277 CAATAAGAGGCTTAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173601577 Original CRISPR CGGCCGGCTGTTCCGAGTGC GGG (reversed) Intergenic
No off target data available for this crispr