ID: 1173602216

View in Genome Browser
Species Human (GRCh38)
Location 20:44303950-44303972
Sequence GGGAGTGGCCATGGAGTAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173602216_1173602220 -8 Left 1173602216 20:44303950-44303972 CCATCTACTCCATGGCCACTCCC 0: 1
1: 0
2: 2
3: 28
4: 278
Right 1173602220 20:44303965-44303987 CCACTCCCACCACTGGTTTATGG 0: 1
1: 0
2: 1
3: 17
4: 232
1173602216_1173602221 -7 Left 1173602216 20:44303950-44303972 CCATCTACTCCATGGCCACTCCC 0: 1
1: 0
2: 2
3: 28
4: 278
Right 1173602221 20:44303966-44303988 CACTCCCACCACTGGTTTATGGG 0: 1
1: 0
2: 0
3: 17
4: 184
1173602216_1173602227 9 Left 1173602216 20:44303950-44303972 CCATCTACTCCATGGCCACTCCC 0: 1
1: 0
2: 2
3: 28
4: 278
Right 1173602227 20:44303982-44304004 TTATGGGCATAGGCAACAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 145
1173602216_1173602224 -1 Left 1173602216 20:44303950-44303972 CCATCTACTCCATGGCCACTCCC 0: 1
1: 0
2: 2
3: 28
4: 278
Right 1173602224 20:44303972-44303994 CACCACTGGTTTATGGGCATAGG 0: 1
1: 0
2: 0
3: 7
4: 94
1173602216_1173602226 8 Left 1173602216 20:44303950-44303972 CCATCTACTCCATGGCCACTCCC 0: 1
1: 0
2: 2
3: 28
4: 278
Right 1173602226 20:44303981-44304003 TTTATGGGCATAGGCAACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173602216 Original CRISPR GGGAGTGGCCATGGAGTAGA TGG (reversed) Exonic
900338172 1:2175144-2175166 GGGAGTGGCCACCAAGGAGAGGG + Intronic
901079362 1:6575098-6575120 GGGCGTGGCCATCCAGAAGAGGG + Exonic
901122196 1:6905110-6905132 GGCAGTGGAGATGGAGAAGATGG - Intronic
901305465 1:8229583-8229605 GGGACTGGCCACCGTGTAGAGGG + Intergenic
902733468 1:18384675-18384697 GGGAGAGGCCAGGGAGCAGAGGG + Intergenic
903281819 1:22254596-22254618 GGGAGCAGCCATGGAGAAGCAGG + Intergenic
903999572 1:27331183-27331205 GGGTGTGGCCATGGAGAAGAGGG + Intronic
904832226 1:33312462-33312484 GGGGGTGCCCTTGGAGTAGGAGG + Intronic
904873223 1:33634844-33634866 GTGAGTGGCCAAGGAGCAGGAGG - Intronic
906104686 1:43284797-43284819 GGGCGTGGCCAGGGAGCAGGAGG - Intronic
906108004 1:43306141-43306163 GGGAGAGACCCTAGAGTAGATGG + Intronic
906696959 1:47829534-47829556 GGGAGTGGTGATGGAGAGGATGG - Intronic
908241727 1:62194422-62194444 GGGAGAGGCCAGGGAGCAGTTGG + Intergenic
911548079 1:99244970-99244992 AGGTGTGTCCATGGATTAGAAGG + Intergenic
911593081 1:99770178-99770200 GGCAGTGGAGATGGAGAAGAGGG - Intergenic
911647840 1:100354198-100354220 TGGAGTGGCCATAGGGTACAGGG + Intronic
912044406 1:105436892-105436914 GGGAGAGGCCAGGCAGTGGAAGG - Intergenic
913079095 1:115365125-115365147 GGCATTGGCCATGAAGGAGAAGG - Intergenic
913535880 1:119771698-119771720 GGGAGTGGCCAGGGATTTGGAGG - Intergenic
913670728 1:121095275-121095297 AGGAGGGGTCATGGAGTGGAGGG - Intronic
915240704 1:154519620-154519642 GGGAGTGGGCAGGGAGGAAATGG + Intronic
915525709 1:156475118-156475140 GGCAGTGGGCATGGAAGAGAAGG + Exonic
916530198 1:165649366-165649388 GGGAGTGGGGAGGGAGGAGAGGG - Intronic
918659949 1:187075210-187075232 AGGTGTGGTCATGGAGTAGAAGG - Intergenic
919091661 1:192984854-192984876 GGGTGTGGGGAGGGAGTAGAGGG - Intergenic
919823156 1:201485425-201485447 GGGAGTGGGCCTGGGGTGGAGGG - Intronic
920366599 1:205451172-205451194 TGGAGTGGCCAAGGAGGAAAGGG - Intronic
921083873 1:211768974-211768996 GGGAATGACTAAGGAGTAGAAGG + Intronic
921165279 1:212502498-212502520 GGCAGTGGAAATGGAGGAGATGG + Intergenic
921279802 1:213555261-213555283 GGGAGTGGGCATGGGGGAAATGG - Intergenic
922565184 1:226597017-226597039 GGGAGTGGCCAGGGACAGGAAGG + Intronic
923276732 1:232403224-232403246 GGGTGTGCCCATGGAGCAGAGGG + Intronic
923362938 1:233230258-233230280 GGGAGAAGGCATGGAGTAAAGGG + Intronic
923385848 1:233464650-233464672 GGAAGTGGGGATGGAGAAGAGGG - Intergenic
923773760 1:236960231-236960253 GGTGGTGGCCATGGGGTGGAAGG + Intergenic
924003157 1:239576256-239576278 GGGGGTGGGTAGGGAGTAGAGGG - Intronic
924904920 1:248442006-248442028 GGGAGTGAGGATGGTGTAGAAGG - Exonic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1065194925 10:23255089-23255111 GGAAGTGGCCAGGGAGAGGAGGG + Intergenic
1065809256 10:29426430-29426452 TGGTGTGACCCTGGAGTAGATGG + Intergenic
1067067983 10:43114344-43114366 GGAAGTGGCCATGGAGGTGTGGG - Intronic
1067068763 10:43117978-43118000 GGGAGAGGCCCTGGAGAAGGTGG - Intronic
1070683431 10:78465023-78465045 GGGAGTGGACATCAAGAAGAAGG + Intergenic
1071399659 10:85256895-85256917 GGGACTGGCAAAGGAGGAGATGG - Intergenic
1071573009 10:86708258-86708280 GGGAGTGGGGCTGGAGCAGAAGG + Intronic
1071703968 10:87976652-87976674 GCCAGTGGCCATGGAGTATGAGG + Intergenic
1072614082 10:97038039-97038061 GGGAGTGTCCATGGACAAGGAGG - Intronic
1073113810 10:101079667-101079689 CGGAGTTGGCATGGAGTACAGGG - Intergenic
1073435232 10:103512294-103512316 GGGAGTGGGCAAGGAGCTGATGG + Intronic
1074188528 10:111116516-111116538 GGAAGCTTCCATGGAGTAGAGGG - Intergenic
1074389149 10:113042397-113042419 GGGAATGGCCATTGCCTAGAGGG + Intronic
1076584587 10:131536862-131536884 GGAAGTGGACATCGAGTGGAGGG + Intergenic
1076674696 10:132141919-132141941 GGGCATGGCCAAGGAGGAGACGG + Exonic
1077146624 11:1049350-1049372 GGGTGAGGCCAAGGAGCAGAGGG - Intergenic
1077234291 11:1472477-1472499 GGTTGTGGCCATGGTGTGGAGGG - Intronic
1078197220 11:9145994-9146016 AGGAGGGGCCATGGGGTAGCTGG - Intronic
1081671569 11:44945532-44945554 GGGAGTTGCCATGGGGAAGATGG - Intronic
1082654155 11:55832665-55832687 GGTAATGGCCATAGAGAAGAAGG - Intergenic
1082804341 11:57438044-57438066 GGGGGTGGCAATGGAGTTGGGGG - Intergenic
1085023219 11:73221906-73221928 GGGAGTAGGCATGGAGTAGAAGG + Intronic
1086308479 11:85508329-85508351 AGGAGTGTACATGGTGTAGATGG - Intronic
1086817724 11:91393912-91393934 GGGAATGACCATGGAGTAGGTGG + Intergenic
1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG + Intergenic
1087442974 11:98208624-98208646 GGGAGAGGCCAAGGAGTGGGAGG + Intergenic
1089159794 11:116428678-116428700 GTGAGTGGCCAGGGAGAAGATGG + Intergenic
1089209980 11:116793157-116793179 GGTAGTGGAAATGGAGGAGAGGG - Intergenic
1090049191 11:123362469-123362491 GGGGGTGGCCATGGACTTCAGGG + Intergenic
1090589186 11:128246936-128246958 GGGAGTGGACCTGGAGTTGGGGG - Intergenic
1090794674 11:130124490-130124512 AGGAGTAGCCATGGAGAAAAGGG - Intronic
1091886084 12:4018124-4018146 GTGAGTGGCCCTGGGGTATAGGG - Intergenic
1092019202 12:5186418-5186440 GAGAGGTGCCTTGGAGTAGAAGG + Intergenic
1092893292 12:12989512-12989534 GGGTATGGCCATAGAGCAGAAGG + Intronic
1094104082 12:26790766-26790788 TGGAGTGCCCATAGAGTAGGTGG + Intronic
1095279038 12:40327764-40327786 GGTAGTGGAAATGGAGAAGAAGG + Intronic
1095593725 12:43935971-43935993 GGGAGTGGTGAGGGAGGAGAGGG + Intronic
1096589532 12:52648472-52648494 GGGAGAGGCCCAGGAGTAGACGG - Intronic
1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG + Exonic
1097369412 12:58758294-58758316 GGGAGTGGGCATGGAAAAGGAGG + Intronic
1098577382 12:72058494-72058516 GGGTGCAGCCATAGAGTAGAGGG - Intronic
1099888151 12:88556939-88556961 GGCAGTTGCCATTGAGTTGATGG + Intronic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1102010976 12:109618109-109618131 GGGAGTGGCCAGGGGGCAGCAGG - Intergenic
1102817464 12:115879420-115879442 GGGAATGGCTATGGAATAAAAGG + Intergenic
1102926258 12:116828663-116828685 GGGAGTGGGCAAGGAAGAGAGGG + Intronic
1103911255 12:124353866-124353888 GGGAGCTGCCATGTAGTGGAAGG - Intronic
1103948951 12:124541330-124541352 GGGAGTGGAGATGGAGGGGATGG + Intronic
1104231774 12:126891971-126891993 GGGAGGAGCCATGAAGGAGAGGG - Intergenic
1106121370 13:26862594-26862616 GGGAGGGGCCAGGAAGTATATGG + Intergenic
1106217020 13:27711711-27711733 GGGGCTGGCCAAGGAGAAGATGG - Intergenic
1107435010 13:40374312-40374334 GTGAATGGCCATGGAGTTGATGG + Intergenic
1107466103 13:40652115-40652137 GGGAGTGGGGAGGGAGGAGAGGG - Intronic
1107795529 13:44047401-44047423 GAGAGAGGCTATGGAGTGGAAGG + Intergenic
1112409843 13:99153553-99153575 GGGTAAGGCCATGGAGGAGAAGG + Intergenic
1113485503 13:110649711-110649733 GGCAGTGTCAATGGAGCAGAGGG + Intronic
1114347016 14:21807206-21807228 GTTAGAGGCCATGGAGCAGAAGG - Intergenic
1114413073 14:22518599-22518621 AGGAGTGGTGATGGAGAAGAAGG + Intergenic
1115768755 14:36648502-36648524 GGCAGTGGACAAGGAGTAGGCGG + Intergenic
1118095144 14:62527995-62528017 AGGGGTGGCCAGGGAGTACATGG + Intergenic
1119179002 14:72591914-72591936 GGTAGTGGCTATTGAGGAGACGG - Intergenic
1119261148 14:73238397-73238419 CGGACTGGCCTTGGAGTTGAAGG + Intronic
1120140249 14:80922211-80922233 GGAAGTTGCCATGGAGGAAAAGG - Intronic
1120763470 14:88306684-88306706 GGGAGGGGGCATGGGGTAGGAGG + Intronic
1121162235 14:91754458-91754480 GGAAGTGGCCAGGGAAGAGAAGG - Intronic
1121440415 14:93945335-93945357 GGCAGTGGGCATGGACAAGACGG - Intronic
1121452465 14:94017857-94017879 GGAAGTGGCCAGGGAAGAGAGGG - Intergenic
1121956012 14:98214063-98214085 TGGAGTGGCTGTGGAGCAGAAGG - Intergenic
1122827109 14:104375636-104375658 TGGAGTGTCCTAGGAGTAGAGGG + Intergenic
1123662105 15:22573402-22573424 GGCACTGACCATGGAGTAGGCGG - Intergenic
1123855687 15:24408861-24408883 GGGAGTGTCCATGAAGTTGGTGG + Intergenic
1123864222 15:24501038-24501060 GGGAGTGTCCATTAAGTTGATGG + Intergenic
1124262107 15:28202104-28202126 GGCACTGACCATGGAGTAGGCGG + Exonic
1124315909 15:28667684-28667706 GGCACTGACCATGGAGTAGGCGG - Intergenic
1126371868 15:47955967-47955989 GGGACAGGCCAGAGAGTAGAAGG - Intergenic
1127283000 15:57508110-57508132 GGAAGTGGCAAAGAAGTAGAGGG - Intronic
1127627000 15:60789410-60789432 GAGTTTGGCCATGGAATAGAAGG - Intronic
1128376199 15:67077828-67077850 GGGAGTGGCCAGAGAGGAGTTGG + Intronic
1129608908 15:77038030-77038052 GGGAGTGGGTGTGGAGGAGAGGG + Intergenic
1130034475 15:80344539-80344561 GGGAGGTGCCCTGGAGTAGGTGG - Intergenic
1130049110 15:80468427-80468449 GAGATGGGCCCTGGAGTAGAGGG - Intronic
1130183403 15:81653321-81653343 GGGATTGGCCAAGGATTAAAGGG + Intergenic
1130384742 15:83401219-83401241 GGCAGTGGCTATGGAGAAGTTGG - Intergenic
1131456198 15:92584547-92584569 GAGAATGGGCATGGAGAAGATGG + Intergenic
1132277536 15:100582194-100582216 GCTAGTGGCCATAGTGTAGACGG - Intronic
1132277574 15:100582443-100582465 GCTAGTGGCCATAGTGTAGATGG - Intronic
1132939321 16:2499127-2499149 GGGAGAGGCCTTGCAGTGGAAGG - Intronic
1133073730 16:3264085-3264107 GGGAGGGGTCCTGGAGGAGACGG - Intronic
1134886523 16:17798090-17798112 GGGAGTTTTCCTGGAGTAGAAGG - Intergenic
1135864924 16:26092384-26092406 GGGACTGGACATGGAGCAGTGGG - Intronic
1136024019 16:27458488-27458510 GGGAGGGGCCCTGAAGGAGAGGG + Intergenic
1137260038 16:46819096-46819118 GGGAGTGGGCTTGGAGCATAGGG - Intronic
1137391586 16:48085871-48085893 GGGAAAGACCAGGGAGTAGACGG + Intronic
1137598455 16:49740332-49740354 GAGAGTGTTCATGGAGGAGAGGG - Intronic
1140851943 16:78943380-78943402 GGGAGTGGCGATGCAGTCGGAGG - Intronic
1141480403 16:84302552-84302574 GGGAGAGGCCTCGGAGGAGATGG - Intronic
1141651734 16:85396528-85396550 GGCAGTGGCCAGGCAGTGGAAGG - Intergenic
1142431254 16:90029121-90029143 GGCAGTGGCCATGGAGCCTACGG + Exonic
1142500172 17:327908-327930 GGGAGGGGGCAGGGAGCAGATGG - Intronic
1142747567 17:1967528-1967550 GGGAGAGGCCAGGGAGGAGGCGG - Intronic
1145011297 17:19369851-19369873 GGGAATGGCCATGGGGTGGGCGG - Intronic
1145060650 17:19731232-19731254 AGAGGTGGCCAAGGAGTAGAGGG + Intergenic
1145313217 17:21711855-21711877 GGGAGAGGGCATGGGGTGGAAGG + Intergenic
1146678739 17:34791953-34791975 GGGAGTGGACCTCGAGTAGGGGG - Intergenic
1146909345 17:36638586-36638608 GGGAGCCGGCATGGAGTGGAGGG - Intergenic
1147128298 17:38388658-38388680 GGTAGGGGCCAGGAAGTAGAGGG - Intronic
1147384680 17:40074279-40074301 GGGAGGGGCCAGGGAGTGGCAGG - Exonic
1147403612 17:40195333-40195355 GGGAGGGGGCAGGGAGCAGAAGG - Exonic
1148063177 17:44850531-44850553 GGGAGAGGACTTGGAGTAAATGG + Exonic
1148239120 17:45988406-45988428 GGGCATGGCCCTGGAGGAGAAGG - Intronic
1150118556 17:62578222-62578244 AGGAGTGGGCATGGAGAGGAGGG + Intronic
1152248701 17:79200299-79200321 GGGAGTGGCTGTGGTGAAGAGGG - Intronic
1152269727 17:79317116-79317138 GGGGGTGGCCGTGGGGGAGATGG - Intronic
1152801719 17:82333779-82333801 GGGAGGGGCCAGGGAGGAGGCGG + Exonic
1153881515 18:9425526-9425548 GGGAGGGGCTACGAAGTAGAAGG + Intergenic
1155535098 18:26808966-26808988 GGAAGATGCCTTGGAGTAGAAGG + Intergenic
1156921651 18:42529686-42529708 GGGATTTGTCATTGAGTAGAAGG - Intergenic
1159241103 18:65744969-65744991 AGCAGTGGGCATGGAGTGGAGGG + Intergenic
1160427480 18:78788103-78788125 TGGGGTGGCCATGGAGGAAAGGG - Intergenic
1160868511 19:1266638-1266660 GGGCGTCGCCATGGAGACGAGGG - Intronic
1162402079 19:10452778-10452800 GGGTGTGTCCATGGAGGGGATGG + Intronic
1163312502 19:16522638-16522660 GGGGGTGGCCCTGGAGAAGCCGG - Intronic
1165420815 19:35721115-35721137 GGGAGTGGAACTGGGGTAGATGG - Exonic
1166925231 19:46262165-46262187 GGGGGTGGAAGTGGAGTAGACGG + Intergenic
1166929378 19:46292635-46292657 GGAAGGGGCCATGGAGATGAAGG - Intergenic
1168322746 19:55519723-55519745 GGGAGTGGTCATGGTGATGAGGG + Intergenic
925173737 2:1768057-1768079 GTGAGTGGCCGTGGATTGGATGG - Intergenic
927195472 2:20543445-20543467 GGGAGTGTCCCTGGAGGAGCTGG - Intergenic
927933453 2:27060658-27060680 GAGAGAAGCCATGGAGGAGAGGG + Intronic
928613855 2:33017127-33017149 TGCATTGGCCATGAAGTAGATGG + Intronic
929245060 2:39692634-39692656 GGGAGGGGAGAGGGAGTAGATGG + Intronic
929452398 2:42046725-42046747 GGGAGGGGTCAGGGAGGAGAAGG - Intergenic
929774862 2:44923222-44923244 AGGAGTGGGTAGGGAGTAGAGGG - Intergenic
929894898 2:45951195-45951217 GGGAGTGGCTCTGGAGTTTATGG + Intronic
929987190 2:46746191-46746213 GGCAGTGGAGATGGAGAAGAGGG + Intronic
932129960 2:69178520-69178542 GGGAGGAGCCAGGGACTAGAGGG + Intronic
932129984 2:69178580-69178602 GGGAGGGGCCAGGGACTAGAGGG + Intronic
932663830 2:73680317-73680339 GGGAGTGGGCATGGGGAAAAGGG + Intergenic
934935315 2:98461030-98461052 GGGCGTGGCTATGGAGAAGATGG - Intronic
935127626 2:100238523-100238545 GGCAGTGGCCAGGGAGAAAAAGG - Intergenic
939011013 2:136845946-136845968 GTGACTGGCCATGGTGTGGATGG + Intronic
940867123 2:158828295-158828317 GTGAGAGGCAACGGAGTAGATGG - Intronic
942437169 2:175991928-175991950 GGCACTGGGCATGGAGTAGTGGG - Intronic
943924202 2:193750679-193750701 GGGAATTGTCATGGAGTATAAGG - Intergenic
944273900 2:197813357-197813379 GGGAGTGGGGATGGAGGTGAGGG + Intronic
944434181 2:199669391-199669413 GGGAATGGTCATGGGGCAGATGG - Intergenic
945044278 2:205768147-205768169 GGGAGTGGGCATGGGGTTCAGGG - Intronic
945123051 2:206478577-206478599 GGGAGTGGCCATTTAGGAGAAGG + Intronic
946872916 2:224100983-224101005 GGGATTGACCATGGAGGGGAAGG - Intergenic
948832860 2:240606763-240606785 GGGAGTGGGCTTGGAGAATATGG + Intronic
1170196724 20:13696490-13696512 GGGAGTGACCTTGGAAAAGAGGG + Intergenic
1171141972 20:22751120-22751142 GGGTGGGGCCAGGGAGTTGAGGG + Intergenic
1171186608 20:23127801-23127823 GGGATTGGCCAGGGAGGAGCTGG + Intergenic
1171210343 20:23311452-23311474 GGGAGTGTTCAAGGAGCAGAAGG - Intergenic
1171797963 20:29581064-29581086 TGGAGTGGTCAATGAGTAGACGG - Intergenic
1172304774 20:33873053-33873075 TGGAGTGGGCAGGGAGCAGAGGG - Intergenic
1172474330 20:35226322-35226344 GGGAGTGGCATTGGAGGAGAGGG - Intergenic
1172846776 20:37934333-37934355 GGGAGAGAACATGGAGTGGAGGG + Intronic
1173427403 20:42954995-42955017 GGGAAGGGCCAGGGAGGAGAGGG + Intronic
1173602216 20:44303950-44303972 GGGAGTGGCCATGGAGTAGATGG - Exonic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1174681733 20:52415259-52415281 GGGAGTGGACAGGGAGCAGAAGG - Intergenic
1175696969 20:61109837-61109859 GGGAGTGGCCATGGGGAAGCTGG - Intergenic
1176110870 20:63410157-63410179 GCCAGTGGCGATGGAGGAGATGG + Intronic
1176199742 20:63854927-63854949 GGGAGGGGCCATAAAGGAGAAGG + Intergenic
1176236808 20:64057223-64057245 GGCAGTGCCCACGGAGGAGAGGG - Intronic
1178584725 21:33862502-33862524 GAGAGAGGGCATGGAGCAGATGG + Intronic
1178720895 21:35007990-35008012 GGTGGTGGCCGTGGGGTAGATGG - Intronic
1179094168 21:38297012-38297034 GTGAGTGACCAGGTAGTAGACGG + Exonic
1179168966 21:38957973-38957995 GGCTGTGGGCATGGAGTAAATGG + Intergenic
1179381517 21:40903502-40903524 GAGAATGGCCAGGGATTAGATGG - Intergenic
1181477170 22:23175925-23175947 GGGACTGGCCAGGGAGATGATGG - Intergenic
1181490685 22:23259072-23259094 GCCAGTGGCCAGGGAGTAGGCGG + Intronic
1181639075 22:24187451-24187473 GTGAGTGACCGTGGAGTATATGG + Intronic
1183150930 22:36036984-36037006 GGCAGTGGACATGGAGTGGGGGG - Intergenic
1183343537 22:37294836-37294858 GGGATTGGCCAGGGAGAAGGAGG + Intronic
1183392995 22:37556441-37556463 GGGAGTGGGCAGTGGGTAGATGG + Intergenic
1183706721 22:39478926-39478948 GGCAGTGGCCATGGCCTGGAGGG - Intronic
1183919536 22:41153857-41153879 GGGGGTTGCCATGGAGTGGGGGG - Intronic
1185093165 22:48787168-48787190 TGGCGAGGCCATGCAGTAGAGGG - Intronic
949877305 3:8634659-8634681 GTGGGTGTCCATGGAGGAGAAGG + Intronic
950133114 3:10561041-10561063 GGGAGTGGCTTTTGATTAGAGGG - Intronic
951698061 3:25466657-25466679 GGGAGGCTCCATGGAGTAGTAGG - Intronic
953293878 3:41693691-41693713 TGGAATGGCAATGGAGTAGGAGG + Intronic
953446306 3:42971020-42971042 GGGATTGGGCATGGTGGAGAAGG + Intronic
956741597 3:72280047-72280069 GGGAGAGGGCATGGAGGGGAGGG + Intergenic
956787034 3:72651468-72651490 GGTGGTGGCCATGGTGGAGATGG - Intergenic
957084295 3:75665863-75665885 CTGAGTGGCCATGGAATACAAGG - Exonic
961483205 3:127197092-127197114 GGGAGAAGCCAAGGAGTAGGTGG - Exonic
962403435 3:135080553-135080575 GAGAGTGGTCCTGGAGGAGAGGG + Intronic
962745445 3:138394539-138394561 GGGAGTTGCCAGTGTGTAGATGG - Intronic
963178488 3:142327820-142327842 GGGGATGGGCAGGGAGTAGATGG - Intronic
965881932 3:173397328-173397350 GCGACTGGCCATGGTGTAAAAGG - Intronic
967115504 3:186333948-186333970 GTAAGTTCCCATGGAGTAGAAGG + Intronic
967687801 3:192437860-192437882 GGGAGTGGGCAAAGAGTAGGAGG - Intronic
974965820 4:68759822-68759844 GAGAGGGGCCATGGGGTTGAGGG + Intergenic
975443763 4:74439771-74439793 GGGTTTGGCCATGTTGTAGATGG - Intergenic
976734901 4:88299457-88299479 GGGATTGGCAAGGGAATAGATGG - Intergenic
979586940 4:122431501-122431523 AGGAGATGGCATGGAGTAGAAGG + Intergenic
983595297 4:169459395-169459417 TGGAGAGGACATGGAGTAAAAGG + Intronic
985118557 4:186616377-186616399 GGGAGGGGCCATGGAGTGTGAGG - Intronic
986177670 5:5365590-5365612 GGGAGAGGCCTTGGAGAAGTAGG + Intergenic
986428677 5:7660045-7660067 GGGAGGGGCCATGGGTTGGAAGG + Intronic
990250326 5:53907412-53907434 GGGAATGGGCATGGAGAAGAAGG + Intronic
990527439 5:56641836-56641858 GGGCGGGGTCACGGAGTAGATGG - Intergenic
991489125 5:67165966-67165988 GGGATTGGCCAGGGAGAAGGTGG + Exonic
996176676 5:120368228-120368250 GGGAGAGGCCAGGAAGTAGGAGG - Intergenic
998446230 5:142200507-142200529 GGGAGTAGACAGGGAGGAGAAGG + Intergenic
999115945 5:149163313-149163335 TGCAATGGCCCTGGAGTAGAAGG - Intronic
1000610398 5:163367367-163367389 GGGGGTGGTCAGGAAGTAGAGGG + Intergenic
1001514710 5:172347239-172347261 GGGAGTGGCCACTGACTTGAGGG - Intronic
1002890160 6:1325073-1325095 GGGAAGGGTCATGGAGCAGAGGG - Intergenic
1003097802 6:3156379-3156401 GGGAGGGGCCCTGGAGGAGGAGG + Intronic
1003101532 6:3179937-3179959 GGGAGGGGCCCTGGAGGAGGAGG + Intergenic
1003127059 6:3363791-3363813 TGGAGTAACCATGTAGTAGATGG - Intronic
1005254066 6:23981222-23981244 GGGAGAGGCCATGGAGAAACTGG + Intergenic
1005293452 6:24401071-24401093 GGGACTGGGGATGGAGTAGGAGG - Intergenic
1006087702 6:31608301-31608323 TGGAGTGTTCATGGAGTAGCAGG - Intergenic
1006645457 6:35511984-35512006 GGGGGTGGCGTTGGGGTAGAAGG - Intronic
1007774458 6:44217159-44217181 GGGAGGGGCCAGGGAGCAGTAGG + Intergenic
1008440256 6:51524759-51524781 GGGAGTGCACAGGGAGTTGAGGG - Intergenic
1009994986 6:70887550-70887572 GGGATTGGGCAAGGAGTGGAGGG + Intronic
1010735191 6:79436127-79436149 GGGAGTGGGCATCAAGTGGATGG - Intergenic
1013414560 6:109913222-109913244 GGGAGTGGAGAGGGAGGAGAGGG + Intergenic
1013524100 6:110958730-110958752 GGGCGTGGCCAGTGACTAGAAGG + Exonic
1014145172 6:117989146-117989168 GGGAGTGGACAGGGAGTGGAGGG - Intronic
1015317349 6:131831307-131831329 GGAATTGGGCATGGAGTATATGG - Intronic
1016434342 6:144020252-144020274 GGAAGTGTCCATAGAGTAGGTGG - Intronic
1018839502 6:167508042-167508064 GGGAGGGGACAGGGAGGAGAGGG - Intergenic
1018839624 6:167508331-167508353 GGGAGGGGACAGGGAGGAGAAGG - Intergenic
1018839742 6:167508657-167508679 GGGAGGGGACAGGGAGGAGAAGG - Intergenic
1020431021 7:8116276-8116298 GGTACTGGCCATGGAGTAGGAGG + Intronic
1022244347 7:28543815-28543837 GGGAGTGGGCATGGTGTTGAGGG + Intronic
1023734947 7:43226648-43226670 GGGACTGGACATGCAGGAGATGG + Intronic
1025285318 7:57655678-57655700 CGGAGCGGGCATGTAGTAGAGGG + Intergenic
1036227861 8:6974935-6974957 GGGAGTAGCCATGGGGTGGAAGG + Intergenic
1036230314 8:6994052-6994074 GGGAGTAGCCATGGGGTGGAAGG + Intergenic
1036232766 8:7013155-7013177 GGGAGTAGCCATGGGGTGGAAGG + Intronic
1036234028 8:7022691-7022713 GGGTGTGGCCATGCGGTGGAGGG + Intergenic
1039473808 8:37829017-37829039 GGGGGTGGGCATGGAGCAGGAGG - Intronic
1040540302 8:48347757-48347779 GGGAGTTGCCATGGACTTGGGGG - Intergenic
1042640529 8:70928940-70928962 GGGAGTGGGCAGGAAATAGAAGG + Intergenic
1043529578 8:81134511-81134533 GGGAGTGGGCACAGAGTAAATGG + Intergenic
1047311847 8:123698587-123698609 GGGAATGGCCCAGGAGGAGAGGG + Intronic
1048223560 8:132564662-132564684 GTGGGTGCACATGGAGTAGAGGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049126384 8:140792669-140792691 GGGACTGGCTATGGAGAAGAAGG + Intronic
1049306788 8:141908212-141908234 GGGAGGGGCCTTGGGGCAGAAGG + Intergenic
1049412309 8:142478721-142478743 GAGTGTGGCCATGGGGTAGCGGG + Intronic
1049412342 8:142478849-142478871 TGGGGTGGCCATGGAGTAGTGGG + Intronic
1049412374 8:142478977-142478999 TGGGGTGGCCGTGGAGTAGCGGG + Intronic
1050480861 9:6085694-6085716 GGGTGTGGCCACGGACTAGTTGG - Intergenic
1052524450 9:29595861-29595883 GGAATTGGCCATGGAGGGGAGGG + Intergenic
1054974956 9:71132274-71132296 GGAAGGGGCCATGGAGCATAAGG - Intronic
1055391142 9:75822906-75822928 GTGAGGGGCCATGGAGGAGAGGG - Intergenic
1056578954 9:87876546-87876568 GGGTGGGGGGATGGAGTAGAAGG - Intergenic
1056836993 9:89963309-89963331 GGGAGTGACCAGGGAGGAAAGGG - Intergenic
1058439646 9:104994913-104994935 GGGAGGGGACATGGACCAGATGG - Intergenic
1060197898 9:121635095-121635117 GAGGGTGGCTATGGAGTGGAGGG + Intronic
1060736036 9:126067065-126067087 GGGAGTGGGCATGGAGGCGGGGG + Intergenic
1061045428 9:128162440-128162462 TGGAGTGGCCGTGGAGGGGAGGG + Intronic
1061299250 9:129695276-129695298 AGGAGAGGCCATGGAGGAGAAGG + Intronic
1061935117 9:133853248-133853270 ATGAGTGGCCCTGGGGTAGAGGG - Intronic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1062510328 9:136901865-136901887 GGGAGTGGGCGAGGAGAAGAGGG - Intronic
1062586292 9:137251434-137251456 GGGAGTGGCCAGGGGGCTGAGGG + Intronic
1188005222 X:25012235-25012257 GGGAGAGGACAGAGAGTAGAAGG + Intronic
1189053102 X:37667398-37667420 GGGATTTGCCATGGAGTAGCCGG + Exonic
1193222901 X:78947598-78947620 GGGAGAGGGCTTGGAATAGATGG + Intronic
1198892377 X:141412297-141412319 GGCAGTGGCAGTGGAGAAGAAGG + Intergenic
1199839493 X:151630218-151630240 AGTAGTGGCCATGGAGTTGGAGG - Intronic