ID: 1173602262

View in Genome Browser
Species Human (GRCh38)
Location 20:44304295-44304317
Sequence GGGTGATTACCCCAACAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173602262 Original CRISPR GGGTGATTACCCCAACAGCA AGG Exonic
900618316 1:3575473-3575495 GTGTAATTACCCCAAGAGCCAGG + Intronic
901639779 1:10687382-10687404 GAGTGATTACAGCACCAGCAGGG + Intronic
902037565 1:13468610-13468632 GGGTCATTAAGTCAACAGCAGGG + Intergenic
915008742 1:152664788-152664810 AACTGATTACCCCAACTGCAGGG + Intergenic
916343251 1:163759249-163759271 GGGTGAGAACCCCCACAACAGGG + Intergenic
924269939 1:242321748-242321770 GAGTGATTACCCCAACCACCAGG - Intronic
1064608030 10:17064506-17064528 TTGGGATTACCCCAGCAGCATGG - Intronic
1066714971 10:38277017-38277039 GAGTGATTACCCCAACCACCAGG + Intergenic
1066783109 10:38973682-38973704 GAGTGATTACCCCAACCACCAGG - Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1070892888 10:79955179-79955201 GTCTGATCACCCCAACACCAAGG + Intronic
1072538000 10:96377871-96377893 GTGGGTTGACCCCAACAGCAGGG - Intronic
1075398590 10:122145010-122145032 GGGTGTTTCCCCAAACAGCTGGG - Intronic
1076790772 10:132775585-132775607 GGGTGTTGCCCCCAACAGCCTGG + Intronic
1091453246 12:586754-586776 GGGTCCTTTCCCCAACAGCCAGG + Intronic
1092963360 12:13617381-13617403 GGCTGAGTGCCCCAACACCATGG + Intronic
1097300183 12:58009767-58009789 AGGGAATTACTCCAACAGCAAGG + Intergenic
1111773380 13:92627430-92627452 CACTGATTACCCCAAAAGCACGG - Intronic
1118459664 14:65976611-65976633 GGGTGACCTCCCCACCAGCATGG - Intronic
1121175038 14:91884725-91884747 GGGTGCTTGCCCCAACCTCAGGG - Intronic
1122285550 14:100649854-100649876 GGCTGAGAAGCCCAACAGCATGG - Intergenic
1128406359 15:67344087-67344109 GGCTGATTCCACCAACAGCAAGG + Exonic
1128797464 15:70476282-70476304 AGGGGTTTATCCCAACAGCAAGG + Intergenic
1131731889 15:95290646-95290668 GGGTGATTAGCCTTACAGCTTGG - Intergenic
1133141788 16:3750408-3750430 GTGTGACTTCCCCAACAGAAAGG - Intronic
1137838067 16:51613140-51613162 TGGTGATTACCCCCACAGAGTGG - Intergenic
1142102451 16:88282486-88282508 GGATGATTACCTCCACAGCGGGG - Intergenic
1146493811 17:33302747-33302769 GTGTGATTACCCAAACAGAAGGG + Intronic
1149981155 17:61312430-61312452 GTCCAATTACCCCAACAGCATGG - Intronic
1155072777 18:22330751-22330773 GTGTGATTACACAAAAAGCAAGG - Intergenic
1155144482 18:23071785-23071807 GTGTGAATTCCCCAAGAGCAGGG + Intergenic
1155162727 18:23208722-23208744 GGGTGATTAAGACAACAACAAGG + Intronic
1157597216 18:48871154-48871176 GGGAGATTCCTCCAACACCATGG - Intergenic
1157614508 18:48978623-48978645 GGGAGATTCCTCCAACACCATGG + Intergenic
1160810696 19:1011763-1011785 GTGTGAGTACCGCAGCAGCATGG + Exonic
1161245093 19:3247047-3247069 GGGTGGTTACCCCTGCAGGATGG + Intronic
1162735142 19:12742897-12742919 GGGGGATTTTGCCAACAGCAAGG + Intronic
1166163765 19:40971709-40971731 GGGTGATAACCCTGACAGTACGG - Intergenic
1167459668 19:49618190-49618212 GGGTCATGACCCCAGCAACAAGG - Intronic
928626330 2:33143167-33143189 GGGTGATTGCCCAAGCAGAATGG - Intronic
932562091 2:72882212-72882234 GGGTGAGAAGCCCAAGAGCATGG + Intergenic
932738208 2:74270707-74270729 GGATGGTTACCCCACCAGGAGGG + Intronic
935411744 2:102771616-102771638 CTGTGATTATCCCAGCAGCATGG + Intronic
938911304 2:135888096-135888118 GTCTGATCACCCCAACAGTATGG - Intergenic
945456360 2:210056400-210056422 CGGTGATTAGCACAACATCAGGG - Intronic
1170142186 20:13135861-13135883 TGGTGATTATCCCACCAGCCTGG - Intronic
1171971427 20:31567317-31567339 GGGTGGTTACCCCAAGGGGAGGG - Intronic
1173602262 20:44304295-44304317 GGGTGATTACCCCAACAGCAAGG + Exonic
1176892677 21:14337228-14337250 TGGTGCTTACCCCACCAACAGGG - Intergenic
1179324556 21:40328584-40328606 TGGTTATTACCCCAAAAGCATGG + Intronic
950682339 3:14593938-14593960 GGGTGAGTCCCCCACCATCAGGG - Intergenic
956835655 3:73094365-73094387 GGGAGTGCACCCCAACAGCAGGG - Intergenic
962202116 3:133409792-133409814 GGGTGGCTACCCCAACTCCATGG + Intronic
963067594 3:141275592-141275614 GGGGGATTAGCACAAGAGCACGG - Intronic
965411697 3:168339496-168339518 GACTGTTTACCCCAACAGAATGG + Intergenic
984833094 4:183994112-183994134 GGGTGATTTCCCCAAGCCCAAGG + Intronic
997734576 5:136203866-136203888 GGGTAATAACCCCAACTCCAGGG - Intergenic
999937000 5:156497856-156497878 GCATGATTAACCCAACAGCAAGG - Intronic
1000245871 5:159447941-159447963 GGGTGACTACGTCAACAGTAAGG + Intergenic
1002929032 6:1620754-1620776 GAGTAATAACCCCGACAGCACGG + Intergenic
1006302323 6:33200221-33200243 GGGTGAGTGCCCCAGCAGAAGGG - Exonic
1010841746 6:80654510-80654532 GCTTAATTACCTCAACAGCAGGG - Intergenic
1011556370 6:88574458-88574480 GGGTGATGGCCCCCACAGGAGGG + Intergenic
1013097709 6:106961048-106961070 GTGTGGTTACCACCACAGCAGGG - Intergenic
1013211508 6:107990952-107990974 GTCTGATCACCCCAACAACATGG + Intergenic
1018177194 6:161187293-161187315 GTGTGCTTTCCTCAACAGCAGGG + Intronic
1023104258 7:36748001-36748023 GGCTGATTAACGCCACAGCAAGG + Intergenic
1025106847 7:56178089-56178111 GGGAGATTACCACCAGAGCAAGG - Intergenic
1036760804 8:11507446-11507468 GGATGACCACCCCAACTGCAGGG + Intronic
1041554663 8:59139819-59139841 GGGTGATACCCCCACCAGGATGG - Intergenic
1041705739 8:60844440-60844462 GTGTGACTACCCCAAAATCAAGG - Intronic
1044429793 8:92095525-92095547 GGGTGATTACAATATCAGCAGGG + Exonic
1047503401 8:125459831-125459853 GGGTGATCTCACCAACACCATGG + Intergenic
1049953956 9:674202-674224 AGGTGATTACCCCTTCATCAGGG + Intronic
1050039945 9:1479222-1479244 GGCTAATTACCAAAACAGCATGG - Intergenic
1058351258 9:104027412-104027434 GGGTAATGACCCCAAAACCAAGG + Intergenic
1060876964 9:127090523-127090545 GGGTAATTCTCCCAACATCAGGG - Intronic
1061442791 9:130617924-130617946 GAGTGATAGCCCCAACAGCCAGG - Intronic
1062077279 9:134597570-134597592 GGGTGAAAACCCCAAATGCAGGG + Intergenic
1203784379 EBV:119303-119325 GACTTATTACCCCAACAACACGG - Intergenic
1190929747 X:54937119-54937141 GGGAAATTACCCCTATAGCAAGG + Intronic
1192539029 X:71952760-71952782 GGGAGAGGACCCCAACAGGAAGG - Intergenic
1201617112 Y:15912855-15912877 ATGTGATTCCCCCAGCAGCATGG + Intergenic