ID: 1173605231

View in Genome Browser
Species Human (GRCh38)
Location 20:44326909-44326931
Sequence AAGGCCGTGCCCCGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605231_1173605250 18 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605250 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
1173605231_1173605246 5 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605246 20:44326937-44326959 CGGGACTGCGGGGCCCCGCGCGG No data
1173605231_1173605248 17 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605248 20:44326949-44326971 GCCCCGCGCGGCACAGGAGCTGG No data
1173605231_1173605241 -5 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605241 20:44326927-44326949 GCCTTGACCCCGGGACTGCGGGG No data
1173605231_1173605252 19 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605252 20:44326951-44326973 CCCGCGCGGCACAGGAGCTGGGG No data
1173605231_1173605240 -6 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605240 20:44326926-44326948 GGCCTTGACCCCGGGACTGCGGG No data
1173605231_1173605255 30 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605231_1173605247 11 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605247 20:44326943-44326965 TGCGGGGCCCCGCGCGGCACAGG No data
1173605231_1173605254 20 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605254 20:44326952-44326974 CCGCGCGGCACAGGAGCTGGGGG No data
1173605231_1173605239 -7 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605239 20:44326925-44326947 CGGCCTTGACCCCGGGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605231 Original CRISPR AAGGCCGTGCCCCGGGGGGC TGG (reversed) Intergenic