ID: 1173605244

View in Genome Browser
Species Human (GRCh38)
Location 20:44326935-44326957
Sequence GCGCGGGGCCCCGCAGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605244_1173605256 5 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605256 20:44326963-44326985 AGGAGCTGGGGGCGCCCCCTGGG No data
1173605244_1173605248 -9 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605248 20:44326949-44326971 GCCCCGCGCGGCACAGGAGCTGG No data
1173605244_1173605250 -8 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605250 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
1173605244_1173605257 6 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605244_1173605260 20 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605244_1173605252 -7 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605252 20:44326951-44326973 CCCGCGCGGCACAGGAGCTGGGG No data
1173605244_1173605255 4 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605244_1173605254 -6 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605254 20:44326952-44326974 CCGCGCGGCACAGGAGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605244 Original CRISPR GCGCGGGGCCCCGCAGTCCC GGG (reversed) Intergenic