ID: 1173605249

View in Genome Browser
Species Human (GRCh38)
Location 20:44326950-44326972
Sequence CCCAGCTCCTGTGCCGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605249_1173605260 5 Left 1173605249 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605249_1173605256 -10 Left 1173605249 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
Right 1173605256 20:44326963-44326985 AGGAGCTGGGGGCGCCCCCTGGG No data
1173605249_1173605257 -9 Left 1173605249 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605249 Original CRISPR CCCAGCTCCTGTGCCGCGCG GGG (reversed) Intergenic