ID: 1173605253

View in Genome Browser
Species Human (GRCh38)
Location 20:44326952-44326974
Sequence CCCCCAGCTCCTGTGCCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605253_1173605260 3 Left 1173605253 20:44326952-44326974 CCGCGCGGCACAGGAGCTGGGGG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605253 Original CRISPR CCCCCAGCTCCTGTGCCGCG CGG (reversed) Intergenic