ID: 1173605255

View in Genome Browser
Species Human (GRCh38)
Location 20:44326962-44326984
Sequence CAGGAGCTGGGGGCGCCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605244_1173605255 4 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605231_1173605255 30 Left 1173605231 20:44326909-44326931 CCAGCCCCCCGGGGCACGGCCTT No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605245_1173605255 3 Left 1173605245 20:44326936-44326958 CCGGGACTGCGGGGCCCCGCGCG No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605243_1173605255 5 Left 1173605243 20:44326934-44326956 CCCCGGGACTGCGGGGCCCCGCG No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605234_1173605255 24 Left 1173605234 20:44326915-44326937 CCCCGGGGCACGGCCTTGACCCC No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605232_1173605255 26 Left 1173605232 20:44326913-44326935 CCCCCCGGGGCACGGCCTTGACC No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605242_1173605255 11 Left 1173605242 20:44326928-44326950 CCTTGACCCCGGGACTGCGGGGC No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605235_1173605255 23 Left 1173605235 20:44326916-44326938 CCCGGGGCACGGCCTTGACCCCG No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605233_1173605255 25 Left 1173605233 20:44326914-44326936 CCCCCGGGGCACGGCCTTGACCC No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data
1173605236_1173605255 22 Left 1173605236 20:44326917-44326939 CCGGGGCACGGCCTTGACCCCGG No data
Right 1173605255 20:44326962-44326984 CAGGAGCTGGGGGCGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605255 Original CRISPR CAGGAGCTGGGGGCGCCCCC TGG Intergenic