ID: 1173605257

View in Genome Browser
Species Human (GRCh38)
Location 20:44326964-44326986
Sequence GGAGCTGGGGGCGCCCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605243_1173605257 7 Left 1173605243 20:44326934-44326956 CCCCGGGACTGCGGGGCCCCGCG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605234_1173605257 26 Left 1173605234 20:44326915-44326937 CCCCGGGGCACGGCCTTGACCCC No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605242_1173605257 13 Left 1173605242 20:44326928-44326950 CCTTGACCCCGGGACTGCGGGGC No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605235_1173605257 25 Left 1173605235 20:44326916-44326938 CCCGGGGCACGGCCTTGACCCCG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605245_1173605257 5 Left 1173605245 20:44326936-44326958 CCGGGACTGCGGGGCCCCGCGCG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605233_1173605257 27 Left 1173605233 20:44326914-44326936 CCCCCGGGGCACGGCCTTGACCC No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605236_1173605257 24 Left 1173605236 20:44326917-44326939 CCGGGGCACGGCCTTGACCCCGG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605232_1173605257 28 Left 1173605232 20:44326913-44326935 CCCCCCGGGGCACGGCCTTGACC No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605244_1173605257 6 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605251_1173605257 -10 Left 1173605251 20:44326951-44326973 CCCGCGCGGCACAGGAGCTGGGG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data
1173605249_1173605257 -9 Left 1173605249 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
Right 1173605257 20:44326964-44326986 GGAGCTGGGGGCGCCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605257 Original CRISPR GGAGCTGGGGGCGCCCCCTG GGG Intergenic