ID: 1173605260

View in Genome Browser
Species Human (GRCh38)
Location 20:44326978-44327000
Sequence CCCCTGGGGTTAAGCGCGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605242_1173605260 27 Left 1173605242 20:44326928-44326950 CCTTGACCCCGGGACTGCGGGGC No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605251_1173605260 4 Left 1173605251 20:44326951-44326973 CCCGCGCGGCACAGGAGCTGGGG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605245_1173605260 19 Left 1173605245 20:44326936-44326958 CCGGGACTGCGGGGCCCCGCGCG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605244_1173605260 20 Left 1173605244 20:44326935-44326957 CCCGGGACTGCGGGGCCCCGCGC No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605253_1173605260 3 Left 1173605253 20:44326952-44326974 CCGCGCGGCACAGGAGCTGGGGG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605249_1173605260 5 Left 1173605249 20:44326950-44326972 CCCCGCGCGGCACAGGAGCTGGG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data
1173605243_1173605260 21 Left 1173605243 20:44326934-44326956 CCCCGGGACTGCGGGGCCCCGCG No data
Right 1173605260 20:44326978-44327000 CCCCTGGGGTTAAGCGCGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605260 Original CRISPR CCCCTGGGGTTAAGCGCGCT AGG Intergenic