ID: 1173605535

View in Genome Browser
Species Human (GRCh38)
Location 20:44328340-44328362
Sequence ACCTTCCTGTAGAAGAACTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173605535_1173605539 16 Left 1173605535 20:44328340-44328362 CCGTAGTTCTTCTACAGGAAGGT No data
Right 1173605539 20:44328379-44328401 GCTTCCTCTAGAAACCTTGTTGG No data
1173605535_1173605542 29 Left 1173605535 20:44328340-44328362 CCGTAGTTCTTCTACAGGAAGGT No data
Right 1173605542 20:44328392-44328414 ACCTTGTTGGAATTTTGATTGGG No data
1173605535_1173605541 28 Left 1173605535 20:44328340-44328362 CCGTAGTTCTTCTACAGGAAGGT No data
Right 1173605541 20:44328391-44328413 AACCTTGTTGGAATTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173605535 Original CRISPR ACCTTCCTGTAGAAGAACTA CGG (reversed) Intergenic
No off target data available for this crispr