ID: 1173606185

View in Genome Browser
Species Human (GRCh38)
Location 20:44333421-44333443
Sequence GCCCCGGGTCACACATCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173606185_1173606190 28 Left 1173606185 20:44333421-44333443 CCACAGGATGTGTGACCCGGGGC No data
Right 1173606190 20:44333472-44333494 TCTTCATGTATATAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173606185 Original CRISPR GCCCCGGGTCACACATCCTG TGG (reversed) Intergenic
No off target data available for this crispr