ID: 1173611618

View in Genome Browser
Species Human (GRCh38)
Location 20:44372427-44372449
Sequence GGATCCTCTGGACAGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173611618_1173611627 22 Left 1173611618 20:44372427-44372449 CCACCTGTCTGTCCAGAGGATCC 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1173611627 20:44372472-44372494 TCTTCTAGAATTCTCCACATGGG 0: 1
1: 0
2: 0
3: 25
4: 161
1173611618_1173611622 -5 Left 1173611618 20:44372427-44372449 CCACCTGTCTGTCCAGAGGATCC 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1173611622 20:44372445-44372467 GATCCAGGCTCCAGAACTCCAGG 0: 1
1: 0
2: 5
3: 19
4: 270
1173611618_1173611626 21 Left 1173611618 20:44372427-44372449 CCACCTGTCTGTCCAGAGGATCC 0: 1
1: 0
2: 1
3: 14
4: 182
Right 1173611626 20:44372471-44372493 GTCTTCTAGAATTCTCCACATGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173611618 Original CRISPR GGATCCTCTGGACAGACAGG TGG (reversed) Intronic
902025809 1:13382677-13382699 GGTTCCTCTTGACCAACAGGGGG - Intergenic
902511331 1:16968400-16968422 GGATTCCCTGCAGAGACAGGTGG + Exonic
904272026 1:29356386-29356408 GGGTCCTCTGGTCTGACATGTGG + Intergenic
904305958 1:29590410-29590432 GGATCCTTGGGACAGAGAGAGGG + Intergenic
904415722 1:30360047-30360069 GGAGCCTCTGGTCATGCAGGTGG + Intergenic
904457970 1:30658579-30658601 GTGTCCTCTGGAGAGACAGCAGG + Intergenic
912235370 1:107844757-107844779 GGATGCCCTCCACAGACAGGAGG - Intronic
912472004 1:109912478-109912500 GGAGGATCTGGACAGACAGTGGG - Intronic
918163392 1:181921187-181921209 GGATCCCCTGTCCAGAGAGGAGG - Intergenic
919047010 1:192464977-192464999 AGATCATTTGGACACACAGGGGG - Intergenic
921165378 1:212503175-212503197 ACATCCTATGGCCAGACAGGAGG - Intergenic
922417412 1:225433941-225433963 TGATGCTCTGGCCAGAGAGGAGG - Intergenic
923426971 1:233880497-233880519 GGGTCCTCAGGACTGTCAGGGGG + Intergenic
924906036 1:248453463-248453485 TCATCCTGTGGACAGTCAGGAGG - Exonic
924921854 1:248638574-248638596 TCATCCTGTGGACAGTCAGGAGG + Exonic
1062867173 10:865550-865572 GGATGTTCTGGACAGACGGACGG - Intronic
1066156909 10:32687893-32687915 GGATCTTCTGGCCAGGCAGTAGG - Intronic
1067428304 10:46225758-46225780 GGGTCCACTGGCCAGCCAGGTGG + Intergenic
1069773944 10:70916125-70916147 GTATCCCCTGAGCAGACAGGGGG - Intergenic
1070963572 10:80515984-80516006 GGAGCCTTTGGTCAGACAGGTGG + Intronic
1075423616 10:122324985-122325007 GGACCATCTTGACAGACAGAAGG + Intronic
1076027195 10:127125517-127125539 GTACCATCTGGAGAGACAGGAGG + Exonic
1077486955 11:2843374-2843396 GGTTCCTCAGGACAGACAGGAGG + Intronic
1077724617 11:4661613-4661635 GGTTCCTCTTCACAGCCAGGAGG + Intergenic
1082726475 11:56743082-56743104 GGATTCTCAGGATAGCCAGGAGG + Exonic
1082808310 11:57463677-57463699 TGGTCCTCGGGAGAGACAGGAGG + Intronic
1083198131 11:61103053-61103075 TGATGCTCTGGACAGACAGTGGG + Intronic
1083227867 11:61295712-61295734 GGCTCCTCTGGGCACCCAGGGGG + Intergenic
1083429870 11:62608755-62608777 GTAGCCTCGGGACAGACAGCTGG - Exonic
1084600215 11:70141106-70141128 GGAACGTTTGGACAGAGAGGTGG - Intronic
1085799712 11:79578066-79578088 GAATCCTCTGTAAAGACTGGGGG + Intergenic
1086498814 11:87431432-87431454 GGGATCTCTGGACAGACAGAGGG + Intergenic
1088812298 11:113399958-113399980 TGCTCCTCTGGACCGCCAGGTGG - Exonic
1090408676 11:126492814-126492836 GGATGCTCTGGAGAGGGAGGGGG + Intronic
1090821740 11:130348856-130348878 GGGTGCACTGGACAGAAAGGAGG - Intergenic
1095717920 12:45368616-45368638 GGAAACTCTGGACAGATAGATGG + Intronic
1096060382 12:48693469-48693491 GGACCCTCTGAAGAGACTGGAGG - Exonic
1096677760 12:53234674-53234696 GGAATCTCTGGACAGAAAGCTGG - Intergenic
1096748484 12:53743838-53743860 GGATCTTCTGGAGAGGGAGGAGG + Intergenic
1096795156 12:54072294-54072316 ATATCCTCTGGACATACAGGGGG - Intergenic
1102465456 12:113128204-113128226 GGGTCCTCGGGCCACACAGGAGG + Intronic
1103957946 12:124589174-124589196 GGATCATGTGGCCAGACAGCAGG - Intergenic
1104352037 12:128053194-128053216 GGTCCCTTTGGACTGACAGGAGG + Intergenic
1104656432 12:130576913-130576935 GGAACTTCTGGACAGAGATGGGG + Intronic
1104760929 12:131297218-131297240 GGTTCCTCTGCTCAGACATGAGG - Intergenic
1104818849 12:131663574-131663596 GGTTCCTCTGCTCAGACATGAGG + Intergenic
1106578863 13:31000555-31000577 GGTCCCTCAGGACAGACAGTGGG - Intergenic
1106948310 13:34853630-34853652 GGATGCTCTGGGAAGTCAGGGGG + Intergenic
1107765482 13:43729998-43730020 GGATCCTCTGGAGAGAGGGGAGG - Intronic
1109508545 13:63337688-63337710 GGATCATCATGACAGACAGGAGG - Intergenic
1114531475 14:23399224-23399246 GGACCCACTGGGCAGAAAGGAGG - Intronic
1114803033 14:25799823-25799845 AGATCCTCTGGGCAGAGATGTGG - Intergenic
1117617049 14:57544758-57544780 AGATCCCCTGGCCAGAGAGGAGG + Intergenic
1123042813 14:105497296-105497318 GGACCCCATGGACAGACAGTCGG - Intronic
1126780956 15:52138477-52138499 GGGTCCTGTGGACAGCCAGTGGG - Intronic
1127684290 15:61326847-61326869 GCATCCTTTGTACAGAAAGGGGG + Intergenic
1130109607 15:80953734-80953756 GGTTCCTCCCCACAGACAGGAGG + Intronic
1130354177 15:83115010-83115032 GTATCCTAGAGACAGACAGGTGG - Intronic
1130914628 15:88295214-88295236 GGATCCTCTGTATAGACTGGAGG - Intergenic
1131732923 15:95300958-95300980 GGATCCCGGGGACAGGCAGGAGG + Intergenic
1134832231 16:17332839-17332861 AGCTCCTGCGGACAGACAGGTGG - Intronic
1137388250 16:48059905-48059927 TGATCCTGTGCACATACAGGAGG - Intergenic
1138473584 16:57257566-57257588 AGTTCCTTTTGACAGACAGGAGG - Intronic
1139973545 16:70791247-70791269 GGATCATCAGGAAAGGCAGGGGG - Intronic
1140031213 16:71340703-71340725 AGATGCTCTGAGCAGACAGGAGG - Intergenic
1141032434 16:80601507-80601529 GGATCCCATAGACAGAGAGGGGG + Exonic
1143644974 17:8224098-8224120 GGTTCCCCTGGACAGACAGTGGG + Intergenic
1143912467 17:10263035-10263057 GCACCCTCTGGAGAGACATGTGG - Intergenic
1144835626 17:18155244-18155266 GAATCCTCTGGACAGGTAGGGGG - Intronic
1144890286 17:18490490-18490512 GGTTCCTCTCGAGAGAGAGGAGG - Intronic
1145141930 17:20453828-20453850 GGTTCCTCTCGAGAGAGAGGAGG + Intronic
1145808770 17:27752606-27752628 GGTTCCTCTTGAGAGAGAGGAGG - Intergenic
1148049951 17:44765004-44765026 GGTTCCTCTAGGCAGCCAGGAGG - Intronic
1149313959 17:55421790-55421812 GGTTCCGCTGGACACGCAGGCGG - Exonic
1152254207 17:79227965-79227987 GAATCCTCTGGAGAGACAAGGGG + Intronic
1153169110 18:2294300-2294322 GGATCATCATGGCAGACAGGAGG - Intergenic
1154020594 18:10661210-10661232 GCATCCTATAGACAGTCAGGCGG + Intergenic
1155386367 18:25282341-25282363 GGAACCACTGGAAAGCCAGGCGG + Intronic
1157326707 18:46674386-46674408 AGCTCCCCTGGACAGGCAGGAGG + Intronic
1158506017 18:58045871-58045893 GGAACCTCTGAAAAGAAAGGAGG - Intronic
1158633165 18:59133621-59133643 GGATCCTCTGGTTCCACAGGAGG - Intergenic
1160405213 18:78640887-78640909 GGCTCCTGTGGACAGACAGCAGG + Intergenic
1160425067 18:78773729-78773751 GGAACCCCTGGGCAGGCAGGAGG + Intergenic
1162936542 19:13984240-13984262 GGCCCCCCTGGACGGACAGGCGG - Intronic
1163520281 19:17787935-17787957 GGATCCTTGGGAAAGATAGGTGG + Intronic
1163598550 19:18234225-18234247 GGAAGCTCAGGACAGGCAGGAGG + Intronic
1163827902 19:19533852-19533874 GGGGCTTCTGGACAGACAAGGGG - Intronic
1165124725 19:33585894-33585916 GGAACAGCTGGACAGGCAGGAGG - Intergenic
1166106601 19:40600921-40600943 GGTACATCTGGACAGCCAGGTGG - Intronic
1166693193 19:44836649-44836671 GGAAGCACTGGACAGCCAGGAGG + Intergenic
929433610 2:41909552-41909574 GGATCTTCTGGACCTGCAGGAGG - Intergenic
929805785 2:45143784-45143806 GGTTCCTCAGGATAGACAGAGGG + Intergenic
930283180 2:49395907-49395929 TCATCCTTTGGACAGACAGCTGG + Intergenic
930720179 2:54630897-54630919 GGATGCTCAGGGCAGACAGGAGG - Exonic
932307947 2:70717081-70717103 GGTTCCTCTGTGCAGAGAGGAGG - Intronic
934778528 2:96954202-96954224 GGATCCTCAGGTCTGACAGCTGG - Intronic
936031974 2:109079814-109079836 GAATTCTCTACACAGACAGGTGG + Intergenic
937139959 2:119591354-119591376 GGAAAAGCTGGACAGACAGGTGG + Intronic
941232973 2:162934228-162934250 AGTTCCTCTGGACAGAGAGAAGG - Intergenic
943646299 2:190409942-190409964 GGATGCTCTGGGGAAACAGGAGG + Intronic
945003326 2:205375779-205375801 GAAGCCTCTGGACAGACTAGAGG + Intronic
948277422 2:236719689-236719711 GGGTCCTCAGGACACACTGGAGG - Intergenic
948913490 2:241018340-241018362 GGATCCACAGGACAGAGATGGGG + Intronic
1169346148 20:4829455-4829477 TGGTCCCCTGGACACACAGGAGG + Intergenic
1172425420 20:34852333-34852355 GGATCCTCTGAACCAAGAGGGGG - Intronic
1172996840 20:39077116-39077138 GGTTCCGCAGGAGAGACAGGTGG - Intergenic
1173611618 20:44372427-44372449 GGATCCTCTGGACAGACAGGTGG - Intronic
1174107373 20:48172145-48172167 AGATCCTCTGGACAGGGAGTGGG + Intergenic
1175335986 20:58196620-58196642 GGATGCGCTGGAGAGCCAGGTGG - Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1178961046 21:37065255-37065277 GGCCCCTCAGGACAAACAGGAGG + Exonic
1179818642 21:43923709-43923731 GGATCCGATGGACAGCCAGGGGG + Intronic
1179890321 21:44331850-44331872 GGACCCGCTGGACAGCGAGGAGG - Exonic
1179997253 21:44979746-44979768 GCATTCTCTGGACAGACACCTGG + Intergenic
1180039898 21:45270526-45270548 GGGACCTGTGGACAGCCAGGAGG - Intronic
1180100599 21:45582209-45582231 GGGTACTCTGCACAGACATGAGG + Intergenic
1184906071 22:47487499-47487521 GGGGCCTCTGGACACAAAGGTGG - Intergenic
950039705 3:9912091-9912113 GCAGCCACTGGACTGACAGGAGG - Intronic
950797750 3:15524091-15524113 GGAGCCTCTGCACATACAGCTGG + Intergenic
952651995 3:35738207-35738229 GCAGCCCCTGGACAGACTGGAGG - Exonic
952727046 3:36597332-36597354 AGGTCCTCTGTTCAGACAGGAGG + Intergenic
956072111 3:65464022-65464044 GGATGCCCTGGCCAGAGAGGAGG + Intronic
957393799 3:79615009-79615031 GAATTCCCTTGACAGACAGGAGG - Intronic
959062952 3:101632651-101632673 GGCTCCCCTGGACAGATGGGAGG + Intergenic
960235951 3:115282336-115282358 GGCTCCTGTGGAAAAACAGGAGG + Intergenic
961086338 3:124070775-124070797 GGATCCTCAGCCCAGTCAGGAGG + Intergenic
962103566 3:132367812-132367834 GGAACATCTGAACAGACAGCTGG + Exonic
963007871 3:140742748-140742770 GTACCCTCTGGACAGCCTGGTGG - Intergenic
965417925 3:168420420-168420442 GGGTCTTCTGGGAAGACAGGTGG + Intergenic
969973655 4:11074404-11074426 GGAGTCTCTGGATGGACAGGTGG - Intergenic
970871068 4:20817467-20817489 GCATTCCCTGGACAGAGAGGGGG - Intronic
972230781 4:37070395-37070417 GGATCCAGTGGACAGAGAGATGG - Intergenic
972287424 4:37662468-37662490 GGACACTCTTGACAGGCAGGAGG + Intronic
980970000 4:139558623-139558645 GGGTCCTCTGGACCTACAAGAGG + Intronic
981532074 4:145762691-145762713 GGCCCCTCTGGACAGCCAGGAGG - Intronic
981569516 4:146136861-146136883 GAGTCCTCGGGAGAGACAGGAGG - Intergenic
982069811 4:151685430-151685452 GGAGCCTCTGGAACGTCAGGGGG - Intronic
983233258 4:165150768-165150790 TGAACCTCTGGCCAGGCAGGAGG - Intronic
984964222 4:185127135-185127157 GGAACCTGTGGACACACAGATGG - Intergenic
985016981 4:185646751-185646773 GGATCCTCCAGACAGAAAAGTGG - Exonic
985616256 5:923496-923518 GGGGCCTGCGGACAGACAGGTGG + Intergenic
985865022 5:2507834-2507856 GGATCCCCGGGACAGGCACGTGG + Intergenic
986151605 5:5134924-5134946 GGATCTTGTGGAAACACAGGGGG + Intergenic
986432402 5:7694037-7694059 GGATCATCTGAACAGAGTGGAGG + Intronic
988775005 5:34469530-34469552 GGATCCTCTGCCCAGTGAGGAGG - Intergenic
988902078 5:35744781-35744803 GGATCATCATGGCAGACAGGAGG + Intronic
992379473 5:76223073-76223095 GCATCGCCTGGACAGACAAGGGG - Intronic
995477302 5:112561250-112561272 GGGTCCTCTGGGCTGAGAGGGGG - Intergenic
999606539 5:153323021-153323043 GGAGACTCGAGACAGACAGGGGG + Intergenic
1002828340 6:794429-794451 TGATCCACTGGACAGGCACGGGG + Intergenic
1002972989 6:2043480-2043502 GGCTGCTGTGGTCAGACAGGTGG - Intronic
1007777850 6:44233687-44233709 GGAGCCTCTGGACGGACAGTGGG + Exonic
1010009100 6:71029058-71029080 GGATCATCATGGCAGACAGGAGG - Intergenic
1011318666 6:86065473-86065495 GGATGCCCTGACCAGACAGGAGG + Intergenic
1015303252 6:131677902-131677924 GATTCCTCTGGACATGCAGGTGG + Exonic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018007033 6:159631856-159631878 GGATCCTCTGAAGACGCAGGTGG - Intergenic
1018431044 6:163723199-163723221 GGGTGATCTGCACAGACAGGTGG + Intergenic
1019428407 7:987856-987878 GGATCCCCAGGACACACAGAGGG - Intronic
1019428421 7:987899-987921 GGATCCCCAGGACACACAGAGGG - Intronic
1019671210 7:2280026-2280048 AAGTCATCTGGACAGACAGGAGG + Intronic
1019740446 7:2670390-2670412 GGATCATCAGGACCGGCAGGTGG + Intergenic
1021336619 7:19410716-19410738 GGATCCTTTAGAAAGACAGCTGG - Intergenic
1021744085 7:23721464-23721486 TCAGCCTCTGGACAGAGAGGAGG - Intronic
1022286105 7:28957134-28957156 GGAGCCTCTGCACAGCCTGGAGG - Exonic
1022359642 7:29645804-29645826 GGCTCCCCTGGACAGACGGCGGG - Intergenic
1023809576 7:43901672-43901694 GGGTCCTCTGGCCACACTGGGGG - Intronic
1029462676 7:100705550-100705572 GGGTCCCCAGCACAGACAGGAGG + Intergenic
1031879081 7:127176462-127176484 GGATCATCATGGCAGACAGGAGG + Intronic
1035018534 7:155787313-155787335 GGACCCTCGGGGCAGCCAGGCGG - Intergenic
1038367353 8:26949250-26949272 GGATCATCATGGCAGACAGGAGG - Intergenic
1039409898 8:37344160-37344182 GGAGCAACTGGACAGAAAGGTGG - Intergenic
1042439648 8:68810789-68810811 AGCTCCTCTCCACAGACAGGTGG + Intronic
1044729124 8:95216227-95216249 GGGTCCCATGGACAGACGGGGGG + Intergenic
1045151757 8:99416102-99416124 AGATGCTCTGCACAGAGAGGAGG + Intronic
1045411561 8:101925839-101925861 TGATTGTCTGGAAAGACAGGAGG + Intronic
1047906010 8:129474051-129474073 CCATCCTGCGGACAGACAGGAGG + Intergenic
1049233364 8:141495631-141495653 GGTCCATCTGGACAGTCAGGAGG - Intergenic
1049514244 8:143044998-143045020 GGTGCCTCTGGACAAAGAGGTGG - Intronic
1052652698 9:31324236-31324258 GGAGCCTCTGTACTGACAGAAGG - Intergenic
1053200478 9:36148632-36148654 GCATCCTATGATCAGACAGGTGG + Exonic
1056176757 9:84043768-84043790 GGATGCCCTGCCCAGACAGGAGG + Intergenic
1056658821 9:88529944-88529966 GGATCCTCTTGGCCAACAGGGGG - Intergenic
1060585226 9:124781383-124781405 GGTACCTCTGGGCAGCCAGGGGG + Intronic
1060848842 9:126858804-126858826 GCATCCAATGGACAGACAGAGGG + Intergenic
1061610270 9:131740959-131740981 GGAGCCTCTGGGCTGGCAGGAGG - Intergenic
1061862158 9:133473596-133473618 GGCCGCTGTGGACAGACAGGTGG + Exonic
1061920992 9:133782427-133782449 GGATCCTGTGCACAGCTAGGGGG + Intronic
1062269278 9:135701283-135701305 GGACCCTCTGGAGAGACACTGGG + Intergenic
1203777396 EBV:81480-81502 TGATCCCCTGGAGATACAGGGGG - Intergenic
1185645217 X:1610854-1610876 GGAGCATCTGGAAAGACAGAGGG - Intergenic
1189846263 X:45141638-45141660 GGGTGCTCTGGACAGCCAGTGGG + Intergenic
1192261284 X:69506993-69507015 GGTTGCTCTGGACAGTTAGGTGG + Intronic
1192820075 X:74636280-74636302 GGATCATCATGGCAGACAGGAGG + Intergenic
1193511752 X:82410873-82410895 TCATCCTCTGGAAACACAGGCGG + Intergenic
1194098609 X:89674569-89674591 AGATGCTCTGCCCAGACAGGAGG - Intergenic
1197421308 X:126238733-126238755 GGATCCTCTCTGCAGGCAGGTGG - Intergenic
1200451631 Y:3335944-3335966 AGATGCTCTGCCCAGACAGGAGG - Intergenic