ID: 1173616769

View in Genome Browser
Species Human (GRCh38)
Location 20:44408275-44408297
Sequence TCTTCCAAGGATCAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173616769_1173616773 6 Left 1173616769 20:44408275-44408297 CCCCACAACTGATCCTTGGAAGA 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1173616773 20:44408304-44408326 GTCCCAGAGCTTCTGCTATTTGG 0: 1
1: 0
2: 2
3: 474
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173616769 Original CRISPR TCTTCCAAGGATCAGTTGTG GGG (reversed) Intronic
900760383 1:4466575-4466597 TCATCAAAGAGTCAGTTGTGGGG + Intergenic
901939300 1:12649732-12649754 TAGTCCAAGGATGAGGTGTGAGG - Intronic
903178935 1:21595840-21595862 TCTCCCAAGGGTTTGTTGTGAGG - Intergenic
904458857 1:30663656-30663678 TGTACCAAGGATCGATTGTGGGG + Intergenic
904476134 1:30765770-30765792 CATTCCAAGGCTCAGTTGTCTGG - Intergenic
909682280 1:78305573-78305595 TCTTCAAAAAATCATTTGTGAGG - Intronic
909771052 1:79421979-79422001 TCTTCCAGGATTCAGTTGTCAGG - Intergenic
913245750 1:116868671-116868693 TCTTCATATGCTCAGTTGTGAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919572476 1:199266318-199266340 TCTGCCAAGAACAAGTTGTGTGG + Intergenic
919595146 1:199552353-199552375 TATTCCAATGATCAGGTGTGAGG + Intergenic
922117993 1:222633349-222633371 TCTTCAAAGGATCAGGAGTCAGG - Intronic
923686502 1:236157162-236157184 TCTACCAATTATCAGCTGTGTGG - Intronic
924174308 1:241374188-241374210 TCTTTCAAGGATGAGTTGTCTGG + Intergenic
1063752471 10:8966162-8966184 TATTCCAAGGATCAGTCCTTTGG - Intergenic
1064651357 10:17513125-17513147 TCTTGGAAGGATCACTTGTGTGG - Intergenic
1065630159 10:27671635-27671657 TACTCCAACGATCTGTTGTGGGG - Intergenic
1065878220 10:30015950-30015972 TCTTCCCAGGAAAAGTTGAGTGG - Exonic
1066667167 10:37795426-37795448 TCTTCCAAAAGTCAGTTGTCAGG - Intronic
1066761395 10:38756931-38756953 TATTCCAAGGGTTAGTGGTGAGG + Intergenic
1066960187 10:42215493-42215515 TATTCCAAGGGTTAGTGGTGAGG - Intergenic
1067683491 10:48454359-48454381 GCTTCCAAGGAGCTGGTGTGAGG + Intronic
1069861950 10:71477053-71477075 TCATCCAAGGCTCACTTGGGAGG + Intronic
1074171391 10:110941729-110941751 TCTTAACAGGATCATTTGTGGGG + Intronic
1074473746 10:113750913-113750935 TCTGCCATGGATCCATTGTGTGG - Intergenic
1074720433 10:116259785-116259807 TCTTCCAGGTATCAGCTGTGTGG + Intronic
1074752156 10:116597014-116597036 TCTCCCACTGATGAGTTGTGTGG - Intronic
1075291402 10:121234169-121234191 TCTTCCATGGATCAGGTTGGGGG + Intergenic
1075449658 10:122541224-122541246 TCTTCCAAGGAAGAGTTAAGAGG + Intergenic
1077978714 11:7276674-7276696 TCTTTTAAGCATCAGTTTTGGGG + Intronic
1078483361 11:11699803-11699825 TCTTCCATTGATGAGCTGTGTGG - Intergenic
1079374336 11:19878790-19878812 TCCTCCAAGGCTTAGTTGGGGGG - Intronic
1079774596 11:24508559-24508581 TCTTCCAAGTGTTAATTGTGGGG + Intronic
1080642182 11:34164476-34164498 TCTGCCAGGAATCAGCTGTGGGG + Intronic
1081756787 11:45550311-45550333 TCTCCAAAGGGTCAGATGTGGGG + Intergenic
1083106762 11:60365759-60365781 TCTTAGAAAGAACAGTTGTGGGG + Intronic
1087351563 11:97040043-97040065 TCTTACAAGGATATATTGTGTGG - Intergenic
1087561592 11:99796913-99796935 GATTCCAGGGGTCAGTTGTGAGG + Intronic
1088640230 11:111865842-111865864 TCTTCCAAAGTTCTGTTATGTGG + Intronic
1090862200 11:130663925-130663947 TCCTCCAAGGATAAGTTGAAAGG + Intergenic
1092536937 12:9397926-9397948 CCTTCCAGGGAACAGTTGTATGG + Intergenic
1092557737 12:9575380-9575402 CCTTCCAGGGAACAGTTGTGTGG - Intergenic
1094149232 12:27264005-27264027 TATTCCAAGGGTTAGTGGTGAGG + Intronic
1094317719 12:29150279-29150301 TCTTCCACGGTTGAGTTATGTGG + Intronic
1094513553 12:31112528-31112550 CCTTCCAGGGAACAGTTGTATGG + Intergenic
1098397440 12:70035899-70035921 TTTTCCAAGGCACATTTGTGGGG + Intergenic
1099652931 12:85451740-85451762 TTTTCCATGGACCAGTGGTGTGG - Intergenic
1099789238 12:87310360-87310382 TCTTCCAAGAAAATGTTGTGAGG - Intergenic
1100786224 12:98081408-98081430 TCTGCCACGGACCAGTTGTATGG + Intergenic
1100874169 12:98944782-98944804 TCTCCACAGTATCAGTTGTGTGG + Intronic
1104351671 12:128049450-128049472 TCATCCCAAGATGAGTTGTGAGG + Intergenic
1106318522 13:28616875-28616897 TTTTCTAATGATCAGTTATGTGG + Intergenic
1107267077 13:38568553-38568575 TCTTCTAAGGATCTCTTGTGAGG - Intergenic
1110165871 13:72442438-72442460 TTTTCTGAGCATCAGTTGTGGGG - Intergenic
1111338463 13:86852285-86852307 TTTGCCAAAGATCAGATGTGTGG - Intergenic
1113671361 13:112177730-112177752 AATTACAATGATCAGTTGTGAGG - Intergenic
1118716313 14:68562621-68562643 TGTTCTAATGATCAGCTGTGAGG + Intronic
1118748122 14:68788914-68788936 TCTTCCAAGGGGCAGGGGTGGGG + Exonic
1119309110 14:73631827-73631849 TATTCCAAGAAACAGGTGTGGGG - Intergenic
1122277710 14:100603736-100603758 CCTTGCAAGGAGCAGTGGTGGGG + Intergenic
1202932105 14_KI270725v1_random:47213-47235 TATTCCAAGGGTTAGTGGTGAGG + Intergenic
1128185752 15:65642267-65642289 TTTTCCACGGATCAGCTCTGTGG - Intronic
1135633988 16:24058465-24058487 ACTTTCAAGGTTCACTTGTGTGG - Intronic
1137555099 16:49465313-49465335 TCTAACAAGGCCCAGTTGTGAGG - Intergenic
1138881565 16:61022171-61022193 TCTTCAAATGATCAGTTATCAGG - Intergenic
1144692127 17:17274198-17274220 TCTTCCAATTTTGAGTTGTGGGG + Intronic
1149326178 17:55531955-55531977 TCACCCAAGTGTCAGTTGTGTGG + Intergenic
1150111618 17:62505350-62505372 TCTTAGAAGGCTGAGTTGTGAGG - Intronic
1152720355 17:81920671-81920693 TCTTCCAGGGATCAGCTGCTTGG - Exonic
1152875897 17:82786008-82786030 TATTCCAAGAAGCAGGTGTGCGG - Intronic
1153951085 18:10058298-10058320 TCCACCAAGGCTCAGTTGGGTGG + Intergenic
1154097443 18:11431510-11431532 TCTTCTAAGGATCTCTTGTAAGG - Intergenic
1154170095 18:12045272-12045294 TTCTCCCAGGATCACTTGTGGGG - Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1163179664 19:15590245-15590267 TATTGCAAGGGTCAGATGTGGGG - Intergenic
1164666822 19:30044939-30044961 TCTTTCAAGGAGCACTTGTTAGG + Intergenic
1167678418 19:50904096-50904118 TCTTACAGGGATATGTTGTGTGG - Intergenic
925069010 2:951315-951337 TCTTCCAAGGTTTGGTTTTGAGG + Intronic
926743584 2:16132077-16132099 TCAGCCAAGTATCAGCTGTGTGG - Intergenic
927906641 2:26863204-26863226 TCCTCCAATGTTCAGCTGTGTGG + Intronic
928218134 2:29379558-29379580 TCTTCCAAGGAGAATTTCTGTGG + Intronic
930297137 2:49569142-49569164 TCTTCCAAGAATCAGTTTGATGG + Intergenic
932902641 2:75716909-75716931 TGTTCCAAAGGTCAGGTGTGAGG + Intergenic
934324708 2:92001605-92001627 TGTTCCAAGGGTTAGTGGTGAGG + Intergenic
937196500 2:120161908-120161930 TTTTCCAAGGACCAGGTTTGGGG - Intronic
941320735 2:164050735-164050757 TCTTCCTCGGAGCAGCTGTGTGG + Intergenic
943021239 2:182576461-182576483 TCTACCAACGAACACTTGTGTGG + Intergenic
944135040 2:196389861-196389883 TCATCCAAGGATGAGGTCTGTGG - Intronic
944559616 2:200922809-200922831 TCTTACAAGGATCTGTGGTAAGG + Intronic
946676616 2:222167352-222167374 TCTTCAAAAGATAAGTTGTAAGG + Intergenic
1169625658 20:7565531-7565553 TAGTGCAAGGAACAGTTGTGGGG + Intergenic
1173616769 20:44408275-44408297 TCTTCCAAGGATCAGTTGTGGGG - Intronic
1174138557 20:48397435-48397457 TCCTCCAAGGAACCGTCGTGTGG - Intergenic
1175200789 20:57276092-57276114 TATTCCGAGGCTCAGTTGTCTGG - Intergenic
1175974832 20:62705525-62705547 GCTTCCAAGGACCTCTTGTGTGG + Intergenic
1176287545 21:5026426-5026448 TTTTCCAAGGAGCTGTTCTGTGG - Exonic
1176594133 21:8675351-8675373 TATTCCAAGGGTTAGTGGTGAGG + Intergenic
1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG + Intergenic
1177564297 21:22797946-22797968 TCTCCCAAAGAGCAGTTGGGAGG + Intergenic
1179869636 21:44237049-44237071 TTTTCCAAGGAGCTGTTCTGTGG + Exonic
1180276987 22:10652481-10652503 TATTCCAAGGGTTAGTGGTGAGG + Intergenic
1180584211 22:16871390-16871412 TATTCCAAGGGTTAGTGGTGAGG + Intergenic
1182501152 22:30748539-30748561 CCTAGCAAGGATCTGTTGTGGGG + Intronic
1184678699 22:46057839-46057861 TCTTCCAAGGAGAAGGAGTGTGG + Intronic
1185219229 22:49620968-49620990 TCTGTCAAGGCTCAGTTCTGCGG - Intronic
951308361 3:21094947-21094969 GATTGCAAGGATCAGTTTTGAGG - Intergenic
953450984 3:43005976-43005998 TCTTCCAAGGATAAGGGGTAGGG + Intronic
953802781 3:46039772-46039794 TATTGCAAGGATCAATTTTGAGG + Intergenic
954345971 3:49999634-49999656 TATTCCAACCATCGGTTGTGAGG + Intronic
955661876 3:61308043-61308065 TCTGACAATGATCAGCTGTGTGG - Intergenic
956153163 3:66264673-66264695 TTTTCCATGGACCAGTGGTGGGG - Intronic
957598873 3:82306117-82306139 TCTTCCAGGGTGCAGCTGTGAGG - Intergenic
960069566 3:113413657-113413679 TTTGCCAAAGATCAGATGTGTGG + Intronic
962944393 3:140154138-140154160 TTTTGAGAGGATCAGTTGTGGGG + Intronic
963685302 3:148426080-148426102 GCTTTCAAGGGTCAGTTATGTGG - Intergenic
968185561 3:196631789-196631811 TCTCCCAAGAATCAGTTGCCTGG + Intergenic
976889687 4:90031577-90031599 TCTGCCATTGATCAGTTGTGTGG + Intergenic
978120467 4:105073072-105073094 GTTTCCAAGGATCAGGGGTGGGG - Intergenic
980106934 4:128596851-128596873 TCATTCAAGAAACAGTTGTGGGG - Intergenic
981815232 4:148823487-148823509 ACTTCCAAGGTTAAGCTGTGGGG - Intergenic
986114377 5:4756437-4756459 TCTTTCAAGGAATTGTTGTGTGG + Intergenic
989047785 5:37289563-37289585 TATTGCAAGCATCTGTTGTGGGG + Exonic
989106538 5:37868233-37868255 TCTTCCAAAGAGCACTTGAGGGG - Intergenic
991005577 5:61824839-61824861 TTTTCCAAGGAACAGTTGGGAGG + Intergenic
992366328 5:76093858-76093880 TATTCCAAGGAACAGTTTTAAGG + Intronic
995212451 5:109556115-109556137 TCTTCATAGAATCACTTGTGTGG + Intergenic
1000771296 5:165358076-165358098 TTTTCCAAGGACCAGGTGAGGGG + Intergenic
1001462561 5:171930209-171930231 TCTTCAAAAGATCAGTTTTTAGG + Intronic
1004852315 6:19712819-19712841 TTTTCCATGGATCAGTGGAGGGG - Intergenic
1007267459 6:40607800-40607822 TCTTCCCAGGGTCACTTTTGGGG + Intergenic
1015713671 6:136168336-136168358 TCTTACAGGGATCCGTTGTGGGG + Intronic
1016002859 6:139059961-139059983 TATTGCAAGCATCTGTTGTGGGG + Intergenic
1016302340 6:142646343-142646365 TATTCCAAGCATCAGTTGCAAGG - Intergenic
1016535188 6:145102261-145102283 TCTTCCAGGGATAACTTGAGGGG - Intergenic
1021199891 7:17716990-17717012 TCTCCCATGAATCAGTTTTGTGG + Intergenic
1021726684 7:23554030-23554052 TCTTCAAAGTATCATTTATGTGG + Intergenic
1022256167 7:28660779-28660801 ACTTCCCAGAATGAGTTGTGAGG - Intronic
1026746913 7:73021026-73021048 TCCTCCAAGGAGCAGGGGTGGGG - Intergenic
1026750565 7:73049169-73049191 TCCTCCAAGGAGCAGGGGTGGGG - Intergenic
1026754212 7:73077279-73077301 TCCTCCAAGGAGCAGGGGTGGGG - Intergenic
1026757864 7:73105312-73105334 TCCTCCAAGGAGCAGGGGTGGGG - Intergenic
1027033018 7:74905597-74905619 TCCTCCAAGGAGCAGGGGTGGGG - Intergenic
1027089539 7:75288172-75288194 TCCTCCAAGGAGCAGGGGTGGGG + Intergenic
1027093184 7:75316100-75316122 TCCTCCAAGGAGCAGGGGTGGGG + Intergenic
1027096827 7:75344067-75344089 TCCTCCAAGGAGCAGGGGTGGGG + Intergenic
1027322519 7:77023613-77023635 TCCTCCAAGGAGCAGGGGTGGGG - Intergenic
1029397937 7:100321043-100321065 TCCTCCAAGGAGCAGGGGTGGGG + Exonic
1032040824 7:128559269-128559291 TCTTGCAAGGCTGAGTTGTGAGG - Intergenic
1032681006 7:134183420-134183442 TCTTTCATTGATCAGTTTTGGGG + Intronic
1032900413 7:136300961-136300983 TTCTCCAAGGATCAGTGATGTGG - Intergenic
1035635612 8:1141446-1141468 TCTTCTAACCATCAGCTGTGTGG - Intergenic
1038191049 8:25321345-25321367 TTTTCCAAGGACCAGGGGTGGGG + Intronic
1039807842 8:41017339-41017361 TCTTCCAAAAATCTGTTGTTTGG - Intergenic
1043793736 8:84508563-84508585 TCTTGAAAGGATCTGTAGTGTGG + Intronic
1044143326 8:88681884-88681906 TCTACCAATGATTAGCTGTGTGG - Intergenic
1047042215 8:121008545-121008567 CTTTCCAGGGATCAGTTTTGTGG - Intergenic
1047742992 8:127821994-127822016 TCTACCAGTAATCAGTTGTGTGG + Intergenic
1048003444 8:130398873-130398895 TCTTTCAAGAATGAGTAGTGTGG + Intronic
1048604097 8:135949585-135949607 TATTCCCAGGAACAGTTGTGTGG - Intergenic
1050165241 9:2758487-2758509 TTTTCCAAGGATAAGTTGGTGGG + Intronic
1051025110 9:12599844-12599866 TCCTCCATTGATCAGTTTTGTGG - Intergenic
1058149185 9:101445166-101445188 TCTTCCTATGATCAGTTGACAGG - Intergenic
1058149214 9:101445593-101445615 TATTCCAAGGTTGTGTTGTGAGG + Intergenic
1059120320 9:111636329-111636351 TCCACCAAGGATCAGTTTTATGG + Intronic
1203624268 Un_KI270749v1:155585-155607 TATTCCAAGGGTTAGTGGTGAGG + Intergenic
1186111774 X:6265566-6265588 TTCTCCAAGGATCTGTCGTGGGG - Intergenic
1187136644 X:16554012-16554034 TTTTCTAAAGATCACTTGTGTGG - Intergenic
1187899066 X:24010436-24010458 TCGTCCACCGAACAGTTGTGAGG + Intronic
1189891774 X:45610445-45610467 TCTTGCCAGCACCAGTTGTGGGG + Intergenic
1194300163 X:92176843-92176865 TGTTCTAAGGATCTGTAGTGTGG - Intronic
1195836741 X:109124223-109124245 TCTGCCACTTATCAGTTGTGTGG - Intergenic
1195922333 X:109995963-109995985 TTTTCCAAGGACTGGTTGTGGGG + Intergenic
1198870302 X:141171822-141171844 TGTTCCATGGATGAGTTGGGAGG - Intergenic