ID: 1173618325

View in Genome Browser
Species Human (GRCh38)
Location 20:44417384-44417406
Sequence CATTCTCTGCAGGGGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173618325_1173618332 5 Left 1173618325 20:44417384-44417406 CCTTGTACCCCCTGCAGAGAATG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1173618332 20:44417412-44417434 ATCAAGCTGATTCTCTGCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 155
1173618325_1173618331 4 Left 1173618325 20:44417384-44417406 CCTTGTACCCCCTGCAGAGAATG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1173618331 20:44417411-44417433 CATCAAGCTGATTCTCTGCCAGG 0: 1
1: 0
2: 2
3: 9
4: 167
1173618325_1173618333 6 Left 1173618325 20:44417384-44417406 CCTTGTACCCCCTGCAGAGAATG 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1173618333 20:44417413-44417435 TCAAGCTGATTCTCTGCCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173618325 Original CRISPR CATTCTCTGCAGGGGGTACA AGG (reversed) Intronic
904342491 1:29845825-29845847 CATCCTCTGCAGGTGGGACCAGG + Intergenic
904363936 1:29998795-29998817 CATTCTGTGCAGAGGCCACAGGG + Intergenic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905395134 1:37661849-37661871 CATTCTCTGGGGGGCTTACAAGG + Intergenic
909863058 1:80633001-80633023 CATGCCCTGCAAGGGGGACAAGG + Intergenic
910477261 1:87620420-87620442 CATGCCCTGCAAGGGGGACAAGG + Intergenic
911429876 1:97772143-97772165 CATTCTCATCAGGGAATACAAGG + Intronic
911846940 1:102765616-102765638 CATTCTCTGAAGAGGGGAGAGGG + Intergenic
913698135 1:121347753-121347775 CATTCTCCACAGGCGCTACAGGG - Intronic
914139414 1:144932299-144932321 CATTCTCCACAGGCGCTACAGGG + Intronic
914977214 1:152377833-152377855 CATGCCCTGCAAGGGGGACAAGG - Intergenic
916360242 1:163959769-163959791 CAGTTTCTGCAGGGGGAAAAGGG - Intergenic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
918232871 1:182551458-182551480 CAGTCTATGCTGAGGGTACATGG + Intronic
920073629 1:203321329-203321351 CATTCTTTCCAGGGGGGAAAGGG + Intergenic
920485534 1:206366403-206366425 CATTCTCCACAGGCGCTACAGGG - Intronic
922067559 1:222158716-222158738 CATACTCTGCAGGGCTTTCAAGG - Intergenic
923129326 1:231061542-231061564 CATTGTCTGGAGGTGGTGCAGGG - Intergenic
923204838 1:231749062-231749084 CAATCTGAGCAGGGGATACAGGG + Intronic
923352846 1:233126366-233126388 CATTCTCTGCAGGGGTCAAAAGG + Intronic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1066436186 10:35398227-35398249 CATTCTCTGCAGTGAGTATGGGG + Intronic
1066660344 10:37732939-37732961 CATACTCTGGAGGGGGCAGAGGG + Intergenic
1067248865 10:44570595-44570617 CATGGTCTGCAGGCTGTACAAGG + Intergenic
1067363711 10:45605265-45605287 CATTCTCTAAAGAGGGGACACGG - Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1073208525 10:101781098-101781120 CAGTCTCTGCAGGTGGGAGAGGG - Intergenic
1073300344 10:102467540-102467562 CATTTTCTTCAGGGGGTTCAAGG + Intronic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1075048985 10:119168001-119168023 CATTCATTGCAGGAGTTACACGG + Exonic
1078155554 11:8796924-8796946 CTTTCTCTGAAAGGGGTACCTGG - Intronic
1078444508 11:11394150-11394172 CAACCTCTGCAGGGGATTCAGGG + Intronic
1079013591 11:16850109-16850131 CATTCTCTGGAAGGGTTAAAGGG - Intronic
1080169391 11:29281394-29281416 GATTCTCTCCAGAGGGTGCAGGG + Intergenic
1080889766 11:36399234-36399256 CATTCTGAGCAGGGGGTGAAGGG + Intronic
1084157359 11:67321363-67321385 CATTCTCTGGAGAGGGAGCACGG - Intronic
1084205930 11:67592972-67592994 CATGCCCTGCAAGGGGGACAAGG - Intergenic
1086472319 11:87128069-87128091 TATTCTCTGAAGTGGTTACACGG + Intronic
1087377969 11:97367967-97367989 CTTCATCTGCAGGGGGTAGATGG - Intergenic
1087788663 11:102384388-102384410 CATGCTCTGCAAGGGGGACAAGG - Intergenic
1088832540 11:113549812-113549834 CATTCTCAGCAGGGACTTCAAGG + Intergenic
1089362854 11:117902483-117902505 CCTTCTCTGCCTGGGGAACAGGG - Intronic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1092759766 12:11799181-11799203 CATTCTCTCCTCGGGCTACATGG - Intronic
1093654394 12:21677788-21677810 CATGCCCTGCATGGGGGACAAGG + Intronic
1094586629 12:31782774-31782796 CATGCTCTGCGAGGGGGACAGGG + Intergenic
1097282496 12:57853282-57853304 CAGTCTGGGCTGGGGGTACAGGG - Intergenic
1099198144 12:79643435-79643457 CATTCACGGCAGGGGGTACCTGG - Intronic
1099243204 12:80162885-80162907 CATTCTCAGCAGTGGGGGCAAGG - Intergenic
1102723636 12:115039210-115039232 CATTCTCTGCAGAGTGTCAAGGG + Intergenic
1103009764 12:117449149-117449171 CCTTCTATGCAGTGGGCACAGGG - Intronic
1104265840 12:127231812-127231834 CACTCTCTGCAGGTGGAACCTGG - Intergenic
1105682575 13:22744692-22744714 CATGCCCTGCAAGGGGGACAAGG - Intergenic
1109826553 13:67728843-67728865 CTTCCTCTGCAGGTGGGACATGG - Intergenic
1111343873 13:86924160-86924182 CATGCCCTGCAAGGGGGACAAGG - Intergenic
1112431766 13:99356280-99356302 CATTCCATGCAGGGGCTAAAAGG - Intronic
1112602623 13:100871654-100871676 GATAATTTGCAGGGGGTACATGG - Intergenic
1118612339 14:67551577-67551599 CATTCTCTCCCGTGGGTGCAAGG + Intronic
1121337247 14:93084991-93085013 CAGGGTCTGCAGGGGGCACAGGG - Intronic
1121845665 14:97169981-97170003 CAGGCTCTGCAGGGGAGACAAGG - Intergenic
1122194348 14:100073970-100073992 CATTCTCTTCAGTGGGTTCAGGG + Intronic
1124641740 15:31400203-31400225 CATTTTCTGCAGGGAATCCACGG + Intronic
1126228361 15:46296835-46296857 CATGCCCTGCAAGGGGGACAAGG + Intergenic
1126475588 15:49062591-49062613 CATGCCCTGCAAGGGGGACAAGG - Intergenic
1126744960 15:51817217-51817239 CATGCCCTGCAAGGGGGACAAGG - Intergenic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1131151807 15:90051993-90052015 CTTCCTCTGCAGGTGGTAGAAGG - Intronic
1132010143 15:98268077-98268099 CACTCTCGGCAGTGGGCACAAGG - Intergenic
1134571767 16:15297375-15297397 AATTCTCTGCAGGGAGAGCAGGG + Intergenic
1134684593 16:16149889-16149911 CATTGGCTGCAGGGTGGACAGGG + Exonic
1134730615 16:16458668-16458690 AATTCTCTGCAGGGAGAGCAGGG - Intergenic
1134936816 16:18253228-18253250 AATTCTCTGCAGGGAGAGCAGGG + Intergenic
1135290559 16:21234144-21234166 CATTATCTGCATGGGGAAGAGGG + Intronic
1135859671 16:26044350-26044372 CATTCTCTGGAGAGGGGAGAAGG + Intronic
1136519281 16:30785985-30786007 GATTCTCTGCAGGGTGTAAATGG - Intronic
1138277586 16:55747238-55747260 GTTTCTGTGCAGAGGGTACATGG - Intergenic
1140455763 16:75104767-75104789 CATCATCTGCAAGGGGGACAGGG - Exonic
1141841025 16:86574213-86574235 CATTCCCTGCCGGGGCTGCATGG - Intergenic
1142302818 16:89268604-89268626 CATCCTCTGCACGGCGTTCAGGG + Exonic
1142342614 16:89533602-89533624 CACCCTCTCCAGGGGGCACAGGG - Intronic
1143782215 17:9234854-9234876 CATTCTCTGAAGTGGACACAAGG - Intronic
1147562031 17:41515189-41515211 CATTCTCTGCATGAGATAGATGG - Intronic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1152779820 17:82221943-82221965 CATTCTCAGCAGGGTGTTCAAGG - Intergenic
1155778075 18:29793845-29793867 CATGCCCTGCAAGGGGTATAAGG - Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1156772162 18:40741779-40741801 CTTTGGCTGCAGGTGGTACAAGG - Intergenic
1158638071 18:59178701-59178723 CAGTCTTTGCAGGGGGGACCAGG + Intergenic
1162136606 19:8559288-8559310 CAGTCTCTCCTGGGGGTACTGGG + Intronic
1162680160 19:12334497-12334519 CACACTCTGCAGAGGGCACAGGG - Intergenic
1164942981 19:32265995-32266017 CATTCTTTCCAGGGGGCACCTGG + Intergenic
1165746057 19:38229871-38229893 CATTGGCTGCTGGGGATACAGGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925910358 2:8569759-8569781 CATGCACTGCAGAGGGGACACGG - Intergenic
929096668 2:38268874-38268896 CAATCTCTGCAGAGGGTCCTGGG - Intergenic
929437908 2:41942197-41942219 GATTTTCTCAAGGGGGTACAAGG - Intronic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
931034691 2:58227076-58227098 CATGCCCTGCAAGGGGGACAAGG - Intronic
932235832 2:70120427-70120449 GATTCTCTGCAGATGGTTCATGG + Intergenic
932254844 2:70275690-70275712 CATTTTCTGCAGGGGATATCAGG - Intronic
935113543 2:100113828-100113850 CCTTCTCTGCTAGGGGAACATGG - Intronic
935333920 2:101997635-101997657 CATTCTCTCCTGGGAGTGCAGGG + Intronic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
937287403 2:120762070-120762092 CACACTCTGCTGGGGGCACAGGG + Intronic
937576064 2:123423567-123423589 CATTCAATGCAGTGTGTACAGGG + Intergenic
939484759 2:142797135-142797157 TATTCTATGCAGGGAATACATGG + Intergenic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
944489319 2:200241848-200241870 CATTCCCTGCAGAGGAAACATGG - Intergenic
945440154 2:209868736-209868758 TGTTCTCTGCATGGGTTACAGGG - Intronic
946010582 2:216560477-216560499 CATTTTCTGCAGCGGCTACTGGG + Intronic
946595634 2:221302957-221302979 CATTCTAGGCAGAGGGGACATGG - Intergenic
948051134 2:234980170-234980192 CCTTATCTGCAGGGGATACAGGG + Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1169100002 20:2939366-2939388 CATTCTCTGCAGCTGTAACATGG + Intronic
1170122703 20:12927583-12927605 CATCCTCTGCGGGGGGCTCAGGG + Intergenic
1171404798 20:24903447-24903469 CATTCAATGCAGTGGGTAGAGGG + Intergenic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173793740 20:45844306-45844328 CATTCTCTGCAGCTGGCTCAGGG + Exonic
1175550103 20:59811942-59811964 CATTCTCAGCAGGGGGTGCTGGG + Intronic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1180157648 21:45985876-45985898 CGCTGTCTGCAGGGGGTGCATGG + Intronic
1180892022 22:19296374-19296396 CATGCCCTGCAAGGGGGACAAGG - Intergenic
1181404613 22:22673798-22673820 CATTCTCTGCAGAGACTACCTGG - Intergenic
1183574849 22:38681725-38681747 CATTCTGTTCAGCGGGTATAGGG - Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
1185202989 22:49519745-49519767 CATTCTCTGCCGTGGATACTGGG - Intronic
949797846 3:7870330-7870352 AATTCTCTGCAGGGGAGACTGGG - Intergenic
952639199 3:35571255-35571277 CATGCTTTGCAGGGAGAACAAGG + Intergenic
954134113 3:48574296-48574318 TATTCTCTGCAGGGTCTACCAGG - Exonic
956868029 3:73388369-73388391 AATGCTCTGCAGAGGGAACATGG + Intronic
957912180 3:86634358-86634380 CATACTCTGCAGTGGGCACAAGG + Intergenic
958632365 3:96700367-96700389 CATGCCCTGCAAGGGGGACAAGG + Intergenic
958913752 3:100024802-100024824 CATTTTATGGAGGGGGTCCAGGG + Intronic
961817810 3:129560287-129560309 CCCTCTGTGCAGTGGGTACAAGG - Intronic
965465608 3:169027035-169027057 CATTGTCTGCAGGTGATTCATGG - Intergenic
969180149 4:5434167-5434189 CTTTCACTGCATGGGGTGCATGG - Intronic
971986976 4:33838344-33838366 CATGCCCTGCAAGGGGGACAAGG + Intergenic
972558689 4:40206145-40206167 CATTCTCTGCATGGGCAACTAGG - Intronic
973921771 4:55693784-55693806 CATTTACTGCAGTGTGTACAGGG + Intergenic
977026723 4:91828320-91828342 CAATCTCTGAAGGGGTTACATGG + Intergenic
978177902 4:105756293-105756315 CATTCTCTGGAGAGGGGAGAGGG - Intronic
980471817 4:133262864-133262886 GATTCTCTGGAGGGGGTGCACGG + Intergenic
981055554 4:140357507-140357529 CATTCACTGCAGGAGGTGCCAGG - Intronic
982009842 4:151096158-151096180 CAAACTCTGCAGGGGAGACAGGG + Intergenic
984877914 4:184385818-184385840 CATTCTCTGCAGCCAGTACCTGG - Intergenic
987673345 5:21043868-21043890 CAGGCTCCGCAAGGGGTACAAGG - Intergenic
989253387 5:39341188-39341210 CTGTCTCTGCAGGGGGGACGGGG + Exonic
989363518 5:40630267-40630289 AGGTCTCTGCAGGGAGTACAGGG + Intergenic
992549800 5:77849714-77849736 CCTTCTCTGGAGAGGGTGCAGGG + Intronic
994301852 5:98157115-98157137 CATTCCCTGCTAGGGGGACAAGG - Intergenic
996615483 5:125436216-125436238 CATTATCTGCTGGGTGTACAGGG - Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
1000532881 5:162445101-162445123 CATGCCCTGCGAGGGGTACAAGG + Intergenic
1002073473 5:176694504-176694526 CTTTCTGTGCAATGGGTACAAGG + Intergenic
1002428663 5:179190782-179190804 CATTCTGTGCATGGGGTCCCAGG - Intronic
1006244344 6:32717357-32717379 CACTCCCTGCAAGGGGAACAAGG - Intergenic
1006412335 6:33881575-33881597 CAGGCTCTGCAGGGGGTGCCAGG - Intergenic
1008446629 6:51599191-51599213 CATTCCTTCCAGGGGGTTCATGG - Intergenic
1014092820 6:117423976-117423998 CATTCTCTGTAGGTGGTGAACGG + Intronic
1018156857 6:160992548-160992570 CATTCTCTGGAGCGGGCAAAAGG - Intronic
1018936813 6:168279155-168279177 CATTCTCTCTGGGGAGTACACGG - Intergenic
1019191803 6:170255714-170255736 CCTTCTCTGCAGTGGTCACAGGG + Intergenic
1020416012 7:7946585-7946607 CATTCTCTTGAGGGAGTTCAAGG - Intronic
1023233414 7:38058047-38058069 CATGCTCGGCAGGGGGCATATGG - Intergenic
1025273603 7:57551306-57551328 CATGCCCTGCAAGGGGGACAAGG + Intergenic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1032191377 7:129767741-129767763 AAGTCTCTGCAGGGGCTAAAGGG + Intergenic
1033030701 7:137823440-137823462 GCTTCTTTGCAGAGGGTACATGG - Intronic
1035178918 7:157075253-157075275 TCTTGTCTGAAGGGGGTACAGGG - Intergenic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035724820 8:1817876-1817898 CATGGGGTGCAGGGGGTACATGG - Intergenic
1035827384 8:2659529-2659551 TGTTTTCTGCAGCGGGTACAGGG + Intergenic
1037909624 8:22736220-22736242 CATTCTCTGGATGGGGTTCCGGG + Intronic
1039390241 8:37174531-37174553 CATTCTCTCCAGGGAGGACTTGG - Intergenic
1042294099 8:67201516-67201538 CATTCTCTTCCGGATGTACATGG - Exonic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1044539318 8:93391997-93392019 AATTCTCTGCAGGGGCTGCTGGG - Intergenic
1050652012 9:7786345-7786367 CTATCTCTGCAGGGGGTCCTCGG + Intergenic
1052283231 9:26756192-26756214 CATTCCCTCCAGTGGGTGCAGGG - Intergenic
1054912272 9:70465548-70465570 CATGCTCTGCGAGGGGGACAAGG - Intergenic
1058311867 9:103514484-103514506 CATGCCCTGCAAGGGGAACAAGG - Intergenic
1060019720 9:120118544-120118566 CATGTTCTGCAGGCTGTACAGGG - Intergenic
1060654546 9:125360764-125360786 CATTCTGAGCAGGTGGCACAGGG + Intronic
1060795656 9:126510908-126510930 CCTTCTCTGGAGCGGGCACAGGG + Intergenic
1061968013 9:134026756-134026778 CCTTCTCTGCCAGGGGGACACGG - Intergenic
1062503906 9:136863171-136863193 CATTCCCTGCAGGGGAACCAGGG + Intronic
1186416517 X:9387720-9387742 TTTTCTCTGCAGGGGGGCCATGG - Intergenic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1188986209 X:36770625-36770647 GATGCTCAGCAGAGGGTACATGG - Intergenic
1191183472 X:57586234-57586256 CATTCTCTGAAGGGGTCGCAGGG + Intergenic
1192069523 X:67922496-67922518 CATTCTCAGCAGTGGCTGCATGG + Intergenic
1199335984 X:146619713-146619735 CATCCTCTGCACGGCGTTCAGGG + Intergenic
1200142627 X:153909570-153909592 CCTTCCCTGCACGGGGTCCAGGG + Intronic
1201404438 Y:13635636-13635658 GATTTGCTGCAGGGGGTCCAGGG - Intergenic
1201796065 Y:17897623-17897645 CATTCAAAGCAGTGGGTACAGGG + Intergenic
1201805490 Y:18008362-18008384 CATTCAAAGCAGTGGGTACAGGG - Intergenic
1202337088 Y:23823979-23824001 CATTTTCTGCAGGGCCTACAGGG + Intergenic
1202357470 Y:24066689-24066711 CATTCAAAGCAGTGGGTACAGGG + Intergenic
1202513308 Y:25603424-25603446 CATTCAAAGCAGTGGGTACAGGG - Intergenic
1202533677 Y:25846092-25846114 CATTTTCTGCAGGGCCTACAGGG - Intergenic