ID: 1173619800

View in Genome Browser
Species Human (GRCh38)
Location 20:44428368-44428390
Sequence CTGCATCAGGTGAGGGTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173619800 Original CRISPR CTGCATCAGGTGAGGGTGCA GGG (reversed) Exonic
900729150 1:4240787-4240809 CTGCATCTGGTGAGGGTCTCAGG - Intergenic
903362912 1:22788230-22788252 TTGCAGATGGTGAGGGTGCAAGG + Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
908796990 1:67840015-67840037 CTCCCTCAGGGGAGGGTGCTGGG + Intergenic
912129276 1:106581506-106581528 CTGCTCCAGGTGAGGTAGCAGGG + Intergenic
912721983 1:112028125-112028147 GTGCATCCTCTGAGGGTGCAAGG + Intergenic
913346118 1:117812828-117812850 CTGCTTCAGGAGAGAGAGCAAGG - Intergenic
913665895 1:121048700-121048722 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
914017293 1:143831976-143831998 CTGAGGCAGGTGAGGGGGCAAGG - Intergenic
915146716 1:153799942-153799964 CTGGATCTGGAGAGGGTCCAGGG + Intergenic
915363524 1:155300675-155300697 CTGCATAGGGTGAGGCTGCTGGG - Intronic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
916636083 1:166670156-166670178 CTGAAGCAGGTGAGTGTGCAGGG + Intergenic
916853459 1:168726936-168726958 CAGCAGCAGGTGAGGGTGCCGGG - Intronic
917658528 1:177153325-177153347 CTGCATCTGGTGAGGGTTTTAGG - Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920664855 1:207955836-207955858 CTGCTTCCTGTGAGGATGCATGG + Intergenic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
924020831 1:239779796-239779818 CTGCCAGAGGTTAGGGTGCAGGG - Intronic
1062769078 10:85574-85596 CTTCATTAGGTGAGCGTGGAGGG - Intergenic
1063057593 10:2521753-2521775 CCGGATAAGGTGTGGGTGCAAGG - Intergenic
1065845809 10:29742318-29742340 CTGCATCTGGTGAGGGTTTTGGG - Intergenic
1067945708 10:50686837-50686859 CTGCATCAGGAGAGGGACCGAGG + Intergenic
1069608245 10:69754197-69754219 CTGCATCTGGTGTGGGTTCGGGG - Intergenic
1070867220 10:79713710-79713732 CTGCATCAGGAGAGGGACCGAGG + Intronic
1070881012 10:79851834-79851856 CTGCATCAGGAGAGGGACCGAGG + Intergenic
1071365196 10:84892321-84892343 CTGCTTCTGGTGAGGGTGTCAGG + Intergenic
1071495037 10:86162340-86162362 CTGCATGGGGTGAGGGTCCCTGG - Intronic
1071634134 10:87235934-87235956 CTGCATCAGGAGAGGGACCGAGG + Intronic
1071647584 10:87368151-87368173 CTGCATCAGGAGAGGGACCGAGG + Intronic
1072577151 10:96710572-96710594 CTGCTTCAGGTGTGGGGGGAAGG - Intronic
1072734387 10:97869215-97869237 GGGCATCACGGGAGGGTGCATGG + Exonic
1073502180 10:103950180-103950202 CCACATCTAGTGAGGGTGCAAGG + Intergenic
1073841916 10:107507407-107507429 CTTCATCTGGTGAGGGTGTCGGG - Intergenic
1074200993 10:111235049-111235071 GTGCATTAGGTGATGGGGCACGG + Intergenic
1076065942 10:127448014-127448036 CAGCACCAGGTGAGGCTGCCTGG - Intronic
1076690433 10:132221200-132221222 CAGCATCAGGTGTGTGTGCCGGG - Intronic
1076890436 10:133280716-133280738 GTGGACCAGGGGAGGGTGCAGGG + Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077845306 11:6016256-6016278 CTGCTTCTGGTGAGGCTTCAGGG - Intergenic
1078770884 11:14350482-14350504 CTGCTTCTGGTGAGGGTGTAAGG - Intronic
1079244075 11:18740615-18740637 CTGCAGCAGGAAAGGGTCCAGGG + Exonic
1079956947 11:26878098-26878120 CTGCTTCTGGTGAGGGTTCCAGG + Intergenic
1082171814 11:49013929-49013951 CTGCACCAGGTGAGGAGGGAGGG - Intergenic
1082777089 11:57254139-57254161 CTGCATCTGGTGAGGGTCTCAGG + Intergenic
1083479299 11:62933578-62933600 CTGCCTCAGCTGAGAATGCAAGG - Intergenic
1084012534 11:66360652-66360674 CTTCATCAGCTCAGGGTGCAGGG - Intronic
1084155872 11:67312199-67312221 GTGCCACAGGTGAGTGTGCAGGG - Exonic
1085444500 11:76591500-76591522 CTCCTTCAGGTGAGTGGGCATGG + Intergenic
1088389928 11:109302914-109302936 TTGCAGCAGGGGAGGGGGCAGGG - Intergenic
1088546406 11:110963844-110963866 CTTCATCAGGTGAAGGGGCAGGG - Intergenic
1091331386 11:134733812-134733834 GTGCATCAGGTGAGTGGGCCTGG - Intergenic
1093131781 12:15400358-15400380 GTGCAGCAGGTGAGGCTGCTGGG - Intronic
1094580693 12:31731349-31731371 CTAGATCAGGTGAGGGCACATGG - Intergenic
1102462258 12:113107155-113107177 CTGCAGCAGGAAGGGGTGCAGGG + Exonic
1102496087 12:113320527-113320549 AAGCAGCAGGAGAGGGTGCAGGG - Intronic
1103393748 12:120592225-120592247 CTGCATCACGTGGGGTTGCTGGG + Intergenic
1103540912 12:121665819-121665841 CTGAATCAGTTGAGGGTTCGGGG + Intronic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1106079267 13:26487138-26487160 CTGCATCAGCTGATGATGCCTGG + Intergenic
1106214054 13:27678496-27678518 CTGCATCTGGTGACTGAGCAAGG + Intergenic
1108588324 13:51890486-51890508 CTGCTTCTGGTGAGGGTCCTGGG - Intergenic
1109376420 13:61500276-61500298 CTTCATCATGTGAGGAAGCATGG + Intergenic
1110080915 13:71309987-71310009 CTGCTTTAGCTGAGGGTGAAGGG - Intergenic
1113572258 13:111366494-111366516 CAGAATCAGGTGTGCGTGCAAGG + Intergenic
1113597343 13:111542962-111542984 CTGCATGAGGTTAAGGTGCAAGG + Intergenic
1116107226 14:40525501-40525523 CTGCATCAGGTGATTGAGCAAGG - Intergenic
1118007242 14:61574455-61574477 TTCCATCAGGTGAGGTGGCAAGG + Intronic
1121712234 14:96047179-96047201 CTGCTTCAGGAGAGGGTATAAGG + Intronic
1122486827 14:102087371-102087393 CCGCGGCAGGTGGGGGTGCAGGG - Intronic
1122636712 14:103133375-103133397 CTTCACCAGGTGCAGGTGCAAGG - Exonic
1123770759 15:23526028-23526050 CTGCTTCAGGTGAGGGTCTTAGG - Intergenic
1124364467 15:29062250-29062272 CTGCATACGGGGAGGCTGCACGG + Intronic
1124687291 15:31793136-31793158 CTGCTTCCGGGGAAGGTGCATGG - Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1129599987 15:76993245-76993267 CTGCAACAGGTAAGGGTGGAAGG + Intergenic
1130051502 15:80487425-80487447 CTGATGCAGGAGAGGGTGCAGGG + Intronic
1132427391 15:101730116-101730138 CTGCATCTGGTGAGGGTTTCAGG + Intergenic
1132864424 16:2086470-2086492 CTGGAGCAGGTGGGGGTGCCAGG - Intronic
1135874061 16:26181015-26181037 CAGCATCAAGAGAGGGTGCGAGG + Intergenic
1136233796 16:28902770-28902792 CTGCATGAAGTGAGTCTGCAGGG - Exonic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1141050221 16:80754857-80754879 CTGTATCAGGGAAGGGAGCAGGG + Intronic
1141585883 16:85033329-85033351 CTGCTTCAGGTCAGGATGCAGGG + Intronic
1141722639 16:85765314-85765336 CTGCCTCAGCTGAGGATGGAGGG + Intergenic
1142418011 16:89953664-89953686 CTGCCACAGGTGAGTGAGCAGGG - Intronic
1143439283 17:6955943-6955965 CTGCATCAGGTGAGGGCCTCAGG - Intronic
1143706013 17:8698147-8698169 ATGCATCAGGTGTGGATGCTGGG - Intergenic
1146456763 17:33014906-33014928 CTGCATCAGATCAGACTGCAGGG - Intronic
1147326914 17:39673979-39674001 CTGCGTCAGGTGAGCCTGCCTGG - Exonic
1149624402 17:58069874-58069896 CTGGATCAGTTGAGGGTTGAGGG + Intergenic
1151504330 17:74516622-74516644 CTGCCTCAGGAGAGGGTGTGAGG + Intergenic
1151717742 17:75840051-75840073 CTGCAGGAGGTGGAGGTGCACGG + Exonic
1152314617 17:79572870-79572892 CTGCATGGGGTGAGGGTGGGTGG - Intergenic
1152423861 17:80208485-80208507 CTGCACGTGGTGAGGGTTCAAGG - Exonic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153212850 18:2787098-2787120 CTGCATCTGGTGAGGGCGTCAGG + Intronic
1153308580 18:3655186-3655208 CTTAATCAGGGGAGGCTGCATGG - Intronic
1155767164 18:29650075-29650097 CTGCATGAGGGGAGGGTTCCAGG + Intergenic
1158077347 18:53545967-53545989 CTACATCTGATGAGGGTTCAAGG + Intergenic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1161133896 19:2608458-2608480 CTGCGTCATTTGGGGGTGCAGGG - Intronic
1161657326 19:5524336-5524358 CTGAATCAAGTGAGGGTGGAAGG + Intergenic
1162131720 19:8530131-8530153 CTGGGCCAGGTGAGGGTGCCAGG + Intronic
1163396061 19:17062240-17062262 CTACTTGGGGTGAGGGTGCAGGG - Intronic
1163722746 19:18905989-18906011 CTGCTGCAGGTGCAGGTGCAGGG - Intronic
1164871424 19:31647506-31647528 CTGCTTCTGGGGAAGGTGCAGGG + Intergenic
1164934479 19:32200415-32200437 CTGCAGCAGCTGAGGCTCCAGGG - Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1166831389 19:45641822-45641844 CTCCAGCAGCAGAGGGTGCAGGG - Intronic
1167697383 19:51023265-51023287 CTGCATTAGGGGAGGTGGCAGGG - Intronic
1168561442 19:57387152-57387174 CTGCATCTGGTGAGGGTCTTCGG - Intronic
1168636098 19:57998757-57998779 CTGCATCTGGTGAGGAGGCTGGG + Intronic
925296408 2:2780289-2780311 GTGAATCCTGTGAGGGTGCAGGG - Intergenic
925296485 2:2780618-2780640 GTGAATCCTGTGAGGGTGCAGGG - Intergenic
925296494 2:2780665-2780687 GTGAATCCTGTGAGGGTGCAGGG - Intergenic
926767476 2:16334944-16334966 CTGTATCAGGTGCCTGTGCAAGG + Intergenic
927859367 2:26550908-26550930 ATGCATCAGGGGAGTGTGGAGGG - Intronic
928438568 2:31272495-31272517 CTGCAGCAGGAGAGGCTTCATGG + Intergenic
929580572 2:43079530-43079552 CTGTATCACATGAAGGTGCATGG + Intergenic
929937703 2:46306288-46306310 CTGCCTCTGGTTAGGGGGCAGGG + Intronic
932706886 2:74032781-74032803 CTGCAGCAGGTGGGGGTGAAGGG - Intronic
933767023 2:85716611-85716633 CTTCATCAGATGCAGGTGCATGG - Intergenic
936160876 2:110083385-110083407 CTGCAACAGCTGTGGGTGGATGG + Intergenic
936183787 2:110287969-110287991 CTGCAACAGCTGTGGGTGGATGG - Intergenic
936399530 2:112154953-112154975 CTGCATCCTGTGGGGCTGCATGG + Intronic
936724548 2:115297205-115297227 CTGCATCAGATAATGCTGCATGG + Intronic
937818801 2:126284860-126284882 CTGCATCTGGTGAGGGTCTCAGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938015616 2:127864699-127864721 CTTCATCTGGGGAGGCTGCAGGG + Exonic
939318364 2:140582051-140582073 CTGAATCAGGTGAGAGAACATGG + Intronic
941027426 2:160473233-160473255 CTGCACCAAGTCAGTGTGCATGG - Intronic
941277861 2:163513536-163513558 TTTCATCATGTGAGGGTACAAGG - Intergenic
941564383 2:167088225-167088247 CTGCTTTAGGGGATGGTGCAGGG - Intronic
941570714 2:167166571-167166593 CTGCTTCTGGTGAGGGCTCAGGG + Intronic
942151761 2:173082702-173082724 TTGAATAAAGTGAGGGTGCACGG - Intronic
945186954 2:207148909-207148931 GGGAATCAGGTGAGGGTGGAGGG - Intronic
946161433 2:217838343-217838365 CTGCAGCAGCTTGGGGTGCAGGG + Intronic
948070332 2:235116246-235116268 CAGCATCAGGTGGGGGTGTGCGG - Intergenic
948266480 2:236638763-236638785 CAGCATGAGTTGAGAGTGCAGGG - Intergenic
1168750126 20:276287-276309 CTGAAACAGGTGAGGGATCATGG + Intronic
1172225521 20:33302798-33302820 CTGGAACACGTGAGGGAGCAGGG + Intronic
1173026871 20:39315748-39315770 CTCCATCCTGAGAGGGTGCAGGG - Intergenic
1173255574 20:41392355-41392377 GTGCAGCAGGAGAGGGTGCTGGG + Intergenic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1174663573 20:52236534-52236556 CTGCTTCTGGTGAGGGTGTCAGG - Intergenic
1175305768 20:57974507-57974529 CTGCATAAGATGCGGATGCACGG - Intergenic
1175853043 20:62104055-62104077 GTGCACCAGGTGAGGGGCCAGGG + Intergenic
1177553795 21:22662304-22662326 CTGCATCATGTGATGCAGCATGG - Intergenic
1178098770 21:29243429-29243451 CTGCATCTGGTGAGGGTCTCAGG + Intronic
1178627580 21:34231096-34231118 TTGCATCAGAGGAGGGTGGAGGG + Intergenic
1179098296 21:38335086-38335108 CTGCAGCAGGTCTGGGTGGAAGG - Intergenic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179366944 21:40767455-40767477 GGGCATCAGGCGAAGGTGCAGGG - Intronic
1180044947 21:45301055-45301077 CTGGGACAGGTGAGGGTGTAGGG - Intergenic
1180058408 21:45372029-45372051 CGACATCACGTCAGGGTGCAGGG - Intergenic
1180120275 21:45741347-45741369 CAGCATCAGGTGTGGGTACCAGG + Intronic
1180935230 22:19620992-19621014 CTGCATCCGGTGCCGGTGAATGG + Intergenic
1183136016 22:35888589-35888611 CTGCATCTGGTGAGGGTCTCTGG + Intronic
1184259966 22:43309120-43309142 CTGGAGCTGGTGAAGGTGCAGGG - Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950104173 3:10377821-10377843 CAGCAGCTGGAGAGGGTGCAGGG - Intronic
950465947 3:13153678-13153700 CTGCAGCAGGTGGGCATGCACGG + Intergenic
950965039 3:17140155-17140177 CTGCAGAAGGTGAGGATGCTGGG + Intergenic
951246705 3:20349780-20349802 CTGAATCAAAGGAGGGTGCAGGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
954317106 3:49807177-49807199 GTGCATCAGATGGGAGTGCAGGG - Intronic
956178719 3:66499341-66499363 CTGCTTCAGGAGAGGGTGCCAGG - Intronic
957931167 3:86880076-86880098 CTCCACCAGGTGAGGCTACACGG + Intergenic
959517992 3:107291184-107291206 CTGCATCTGGTGAGGGTCTCAGG + Intergenic
960513591 3:118578694-118578716 CTGCTTCAGGTTAGGGTGGGTGG + Intergenic
962412940 3:135157184-135157206 CTGCAGCAGGTGGTGGTGCTGGG + Intronic
966210617 3:177449838-177449860 CCACAGCAGGTGACGGTGCAGGG - Intergenic
967119599 3:186371185-186371207 CTGCGTCAGGTGTGGGAGAATGG + Intergenic
968598628 4:1498447-1498469 CTGCATCAGTTGAGGGGGGTGGG + Intergenic
968731270 4:2270457-2270479 CTGCCTCAGGGCAGGGTGCCTGG - Exonic
968917699 4:3504033-3504055 CAGCCTCAGGTGAGAGTGAAGGG + Intergenic
970488582 4:16548584-16548606 CTGCATAAAGTAGGGGTGCAGGG + Intronic
971160158 4:24125800-24125822 CTTCTTGAGGTGAGGCTGCAAGG + Intergenic
972258766 4:37386928-37386950 CTGCTTCTGGTGAGGCTTCAGGG - Intronic
972345364 4:38188380-38188402 CTGCAGCAGGTGTGGGTGGCTGG + Intergenic
975247608 4:72138408-72138430 CTGCATTGGGTGGGGGGGCAGGG - Intronic
975735941 4:77381156-77381178 CTAGATCAGGTGATGGTGTATGG - Intronic
978779787 4:112538996-112539018 CTATATCAGGTATGGGTGCAAGG + Intergenic
979669496 4:123347161-123347183 CTGCATCTGGGGAGGGGCCAAGG - Intergenic
980000872 4:127486237-127486259 CTGCAGAGGGTGAGGGTGCTTGG + Intergenic
981551973 4:145951213-145951235 CTGCATCTGGTCCGGGTGCAGGG - Intergenic
981642849 4:146965745-146965767 GTGGATCATGTGAGGGAGCATGG + Intergenic
981809155 4:148753823-148753845 CTGCAGCAGATGAGGCTGTATGG + Intergenic
982106520 4:152016205-152016227 CGGCATCTGATGAGGGTGGAAGG - Intergenic
985222604 4:187723745-187723767 CTGGGTCAGGTGACTGTGCAGGG + Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
988514115 5:31890325-31890347 CAGCATGTGGTGAGGGTGTATGG + Intronic
991960248 5:72037085-72037107 CTGGAGCTGCTGAGGGTGCAGGG - Intergenic
993298917 5:86182468-86182490 CTGCATCTGGTGACAGGGCAAGG - Intergenic
994349239 5:98725504-98725526 CTGGATCAGGGGAGTGTACAGGG - Intergenic
998232896 5:140372835-140372857 CAGCATGAGGTGAGGGTGTGAGG + Exonic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999189523 5:149736511-149736533 CTGCATCAGCTGAGTGTCAATGG - Intronic
1001247896 5:170118786-170118808 CTGTCACAGGTGAGGGGGCAAGG + Intergenic
1001326900 5:170735007-170735029 CTGCATCTGGTGAGGGTTTCAGG - Intronic
1002049602 5:176562601-176562623 CAGGACCAGGTGAGGGTGCTTGG + Intronic
1002092656 5:176814117-176814139 CTGCTGCAGGTGAGGGAGAAAGG - Intronic
1002773015 6:305260-305282 CTCCATCAGGTGATGGTCAAGGG - Intronic
1003935196 6:10968742-10968764 CAGCATCAGGTGAGGGTGTGGGG + Intronic
1005962312 6:30703090-30703112 CTGCATCAGGTGAGAGGCCAAGG - Exonic
1006298296 6:33179711-33179733 CTGCAGCAGGCGAGGGTGAGTGG - Exonic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1007070672 6:39035900-39035922 CCGCATGGGGTGAGGGGGCACGG + Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1008294766 6:49761998-49762020 CTGCACCTGGTGAGGGTTCTAGG + Intergenic
1008646567 6:53520474-53520496 CTGCCGCAGGCGAGGGTGGAGGG - Intronic
1010058037 6:71588548-71588570 CTGCTTCAGTTGATGTTGCATGG - Intergenic
1012753586 6:103193519-103193541 CTGCATCTGGTGAGGGTCTCAGG + Intergenic
1013088395 6:106876067-106876089 CTGCATCTCCTGAGGCTGCACGG + Intergenic
1019201482 6:170319800-170319822 CTGCATCACGCGGGGGCGCAGGG + Intronic
1019779207 7:2929758-2929780 CTGCAGCAGGAGAGGGTGTTGGG + Intronic
1021068550 7:16208560-16208582 CTGCACCAGGTGAGAGAGCATGG + Intronic
1022788165 7:33659905-33659927 CTGTATAAGATGAAGGTGCAAGG - Intergenic
1023840230 7:44092950-44092972 CTGACTCAGGTGAGTGTGGACGG + Intergenic
1024056120 7:45660757-45660779 AGGGCTCAGGTGAGGGTGCAGGG + Intronic
1024056125 7:45660776-45660798 AGGGCTCAGGTGAGGGTGCAGGG + Intronic
1024927008 7:54627775-54627797 CTGCATTGGGGGAGGCTGCATGG - Intergenic
1029532668 7:101135808-101135830 CTGGCTCAGGTGAGGCTCCACGG + Intronic
1029925255 7:104308954-104308976 CTGCATCTGGTGAGGGCTCCAGG - Intergenic
1031456551 7:121987548-121987570 TTGCATCTAGTGAGGCTGCAGGG - Intronic
1032066426 7:128774972-128774994 CTGGAGCCGGTGAGAGTGCAGGG - Exonic
1032264675 7:130362676-130362698 CTGCAAAAGGTAAGAGTGCACGG - Intronic
1032281736 7:130508682-130508704 CTGCATCAGTGGGGAGTGCAAGG + Intronic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1035635244 8:1139301-1139323 CTGTCTCAGCTGAGGCTGCAGGG + Intergenic
1035902240 8:3469727-3469749 CTGCCTAAGGTGAGGATGTAGGG - Intronic
1036674559 8:10819132-10819154 TTCCATCTGCTGAGGGTGCAGGG + Intronic
1036685252 8:10905135-10905157 CAGCTTCAGGAGAGGATGCAGGG - Intronic
1037935576 8:22913168-22913190 GTGCATCAGGTGAGGGTTTAGGG - Intronic
1038358045 8:26848461-26848483 CTTCATCAGGTGAGAATGCAGGG + Intronic
1038572925 8:28678583-28678605 CTGCATCTGGTGAGGGTCTCAGG - Intronic
1038599678 8:28927438-28927460 CTGCATCTGGTGAGGGTATCAGG + Intronic
1039886975 8:41660404-41660426 CAGCAGGAGGTGAGGGGGCATGG - Intronic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1041272445 8:56122479-56122501 CTGCCTCAAGTGGGGCTGCAGGG + Intergenic
1041438352 8:57866659-57866681 CTGCATCAGGGGTGGCAGCAGGG + Intergenic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044441650 8:92230922-92230944 CAGCATCTGCGGAGGGTGCACGG + Intergenic
1044459855 8:92430786-92430808 CTGCTTCTGGTGAGGGTGTCAGG - Intergenic
1049410929 8:142473728-142473750 CTGCAGCAGGTGTGGGGGCCTGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1052769133 9:32671508-32671530 CTGCAGATGGTGAGGGTGCCAGG - Intergenic
1055908385 9:81319412-81319434 CTGCATCAGGGGATGGTGAGGGG - Intergenic
1057897977 9:98924805-98924827 GAGCATCAGGAGAGGGTGCCAGG + Intergenic
1059170838 9:112123216-112123238 CTGCTTCAGGTGAGGGCCCTGGG + Intronic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1186093563 X:6075786-6075808 CTGCTTCTGGTGAGGGTGTCAGG - Intronic
1189005276 X:36987576-36987598 CTACATCAAGTAAGGGTGGAGGG - Intergenic
1189043751 X:37570366-37570388 CTACATCAAGTAAGGGTGGAGGG + Intronic
1189192070 X:39118916-39118938 CTGCATCAGCTGAGGCTGTGAGG - Intergenic
1190904157 X:54709633-54709655 CTGCTTCAGGGAAGGGGGCAAGG - Intergenic
1199724612 X:150568501-150568523 CTGCATCACGTGACGGGGCAGGG - Intergenic
1199764549 X:150931400-150931422 CTGCCTCAGGAGAGGATGAAGGG + Intergenic
1202073240 Y:21014329-21014351 CCACATCAGGAGAGGCTGCAAGG - Intergenic
1202077940 Y:21056183-21056205 CCACATCAGGAGAGGCTGCAAGG - Intergenic