ID: 1173620577

View in Genome Browser
Species Human (GRCh38)
Location 20:44432740-44432762
Sequence CCCATCACTGCCGCCTGATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173620577 Original CRISPR CCCATCACTGCCGCCTGATG GGG Exonic
903354938 1:22740800-22740822 CCCCTCCCTGCTTCCTGATGTGG + Intronic
904295363 1:29516780-29516802 CCAGTCACTGCAGCCTGGTGGGG + Intergenic
904945094 1:34193435-34193457 CCCATCACTCCAGCCTGTGGAGG - Intronic
905254115 1:36669130-36669152 CCCTTCACAGCCGTCAGATGTGG + Intergenic
910129944 1:83891937-83891959 CCCATCTCAGCCTCCTGAGGAGG + Intronic
912796427 1:112696235-112696257 CTCATCACTGCCGGCAGGTGGGG + Exonic
923133383 1:231096615-231096637 CCCACCAATGCCACCTGATGTGG + Intergenic
1062936662 10:1395509-1395531 CCCATCACTGCCCCCTGGGCTGG - Intronic
1069634570 10:69917485-69917507 CTCATCAGTGCCCCCTGATGCGG + Intronic
1077412841 11:2411422-2411444 CCCATGACGGCCGCCTGGAGTGG - Exonic
1080605500 11:33861773-33861795 CCCTTCATAGCTGCCTGATGTGG - Intronic
1082765251 11:57162664-57162686 CCTATCACTGCAGCCAGAGGAGG + Intergenic
1088828489 11:113515668-113515690 GCCACCCCTGCCTCCTGATGGGG + Intergenic
1089382780 11:118048013-118048035 CCCATCACTGCCCCCAGAGTGGG + Intergenic
1101880613 12:108623191-108623213 CTCATCCCTGTTGCCTGATGGGG - Exonic
1102348138 12:112172627-112172649 CCCTCCCCTGCTGCCTGATGCGG - Intronic
1103686493 12:122736154-122736176 CCCATAACTCCCACATGATGTGG + Intergenic
1103946185 12:124527991-124528013 CCCTTCAGCGCAGCCTGATGAGG + Intronic
1104327249 12:127811130-127811152 CCCATCACTTTCCCCTGCTGTGG - Intergenic
1104484033 12:129133933-129133955 ACCATCTCTGCCACCTCATGGGG + Intronic
1113211683 13:107990200-107990222 ACTATCACTGCAGTCTGATGAGG + Intergenic
1113654472 13:112059128-112059150 CCCTCCACTGCCGCCCGATGGGG + Intergenic
1113848901 13:113407056-113407078 CCCATCACCTCCGGCTGATCCGG + Intergenic
1113857206 13:113453814-113453836 CCTGTCACTGCCGCCCGCTGCGG + Intergenic
1114524202 14:23358236-23358258 ACCTTCACTGCAGCCTCATGAGG - Intronic
1115444277 14:33471518-33471540 CCCATTATTGCCCCCGGATGTGG + Intronic
1122096220 14:99374881-99374903 CCCCTCACTGCAGCCTGGAGGGG - Intergenic
1122249280 14:100426826-100426848 CCCAGCAATGCCGCCTGGTATGG + Intronic
1122968758 14:105143978-105144000 CCCCTCACTGCCTGCTGGTGAGG - Intronic
1125143694 15:36440643-36440665 CCCATGAGTGATGCCTGATGGGG - Intergenic
1126695374 15:51321313-51321335 CCCATGACTGCCTACTGTTGGGG + Intronic
1130284618 15:82544619-82544641 GCCACCACAGCCCCCTGATGCGG - Exonic
1130545791 15:84857138-84857160 CCCAGCACAGCCGCCCCATGAGG + Exonic
1132326863 15:100977688-100977710 CCCTTCATTGCTGCCTGGTGGGG - Intronic
1133143450 16:3765366-3765388 CCAAGTACTGCCTCCTGATGTGG - Intronic
1134062384 16:11206857-11206879 CCAATCACTGCTGGCTTATGAGG - Intergenic
1135656721 16:24256500-24256522 CGCATCACTGCTGCCTTCTGAGG - Exonic
1136778129 16:32882291-32882313 CTGGTCACTCCCGCCTGATGGGG - Intergenic
1136892492 16:33979223-33979245 CTGGTCACTCCCGCCTGATGGGG + Intergenic
1139206813 16:65037064-65037086 CACATCACTGCAGCCTGCTCTGG + Intronic
1142286362 16:89173113-89173135 CCCACCACTGTCTCCAGATGGGG - Intronic
1203080548 16_KI270728v1_random:1144400-1144422 CTGGTCACTCCCGCCTGATGGGG - Intergenic
1142597015 17:1034845-1034867 CCCCTCCCTGCCGCCGGGTGTGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145889390 17:28404531-28404553 CCACTCACTGCCCCCAGATGTGG - Intronic
1147158665 17:38558535-38558557 CCCTTCGCTGCTGCCTGAGGCGG - Intronic
1147594719 17:41709416-41709438 CCCTTCACTGCAGCCCTATGAGG + Intergenic
1150208479 17:63427770-63427792 CCCATCACTGCATCCTCAGGAGG - Intergenic
1153302413 18:3602702-3602724 CACAGCACTGCCTCCTGGTGCGG + Intronic
1156450285 18:37262815-37262837 CCCAGGGCTGCAGCCTGATGAGG + Intronic
1159559418 18:69977676-69977698 GCCATCACTGTCGCCTCAGGCGG + Intergenic
1162374980 19:10299667-10299689 CCCAGCACTGCCCTCTGATCCGG + Intergenic
1162390957 19:10389983-10390005 CCCCTCACTACGGCCTGAGGAGG + Intergenic
1163669734 19:18620549-18620571 CCCATCACTGCCAACTGCAGGGG + Exonic
1163678367 19:18666710-18666732 CCCAGCACAGCCTCCTGGTGGGG + Intronic
1165049550 19:33132654-33132676 CCCCGCACTGCCACCTGCTGGGG + Intronic
1165781062 19:38434600-38434622 CCCATCCCTGCCCCCAGCTGGGG - Intronic
1167125223 19:47544704-47544726 CCCACCACTGGCTCCTGCTGTGG - Exonic
926251735 2:11158869-11158891 CCCATCCCTGCAGCCTGGGGAGG - Intronic
928917456 2:36488323-36488345 CCCATCACAGGTGGCTGATGAGG + Intronic
931440955 2:62290139-62290161 CCCACCACAGCCTCCTGAGGTGG - Intergenic
934661699 2:96146490-96146512 CCCAGCCCTGCTGCCGGATGTGG + Intergenic
935192541 2:100790436-100790458 CCCATCTCTGCAGCATGCTGTGG + Intergenic
937863890 2:126733512-126733534 CCCCTCAGGGCCGTCTGATGGGG + Intergenic
942968162 2:181922340-181922362 CCCATCAATGCCAGCTGCTGAGG + Exonic
944527395 2:200633978-200634000 CACCTCATTGCAGCCTGATGAGG + Intronic
946170177 2:217890575-217890597 TGCATCACTGCCCCCTGCTGTGG - Intronic
946404607 2:219485531-219485553 GCCATGACTGCTCCCTGATGGGG - Intronic
947202035 2:227622388-227622410 ACCATCACTGTGGCCTGAGGGGG + Intronic
1170610351 20:17907684-17907706 TCCATCATTGCTGCCTGGTGAGG + Intergenic
1171983503 20:31643549-31643571 CCCAGGACTGCAGCCAGATGAGG - Intronic
1172447523 20:35000979-35001001 GCCATCATGGCCGCCTGTTGGGG - Exonic
1172689386 20:36779783-36779805 CCCAGCACTGCTGCCTCGTGCGG - Exonic
1173620577 20:44432740-44432762 CCCATCACTGCCGCCTGATGGGG + Exonic
1175136934 20:56831216-56831238 CCCAACACTGCTGCTGGATGTGG + Intergenic
1179608440 21:42533319-42533341 GCCATCACTCACGCTTGATGGGG + Intronic
1183779828 22:39992161-39992183 CCCATCACTGCGCCCAGCTGAGG + Intergenic
952225419 3:31370582-31370604 CCTATCACAGCTGCCTGAGGTGG + Intergenic
953389101 3:42524283-42524305 CCCATCATTGCAGCCAGAGGTGG - Intronic
955333002 3:58063009-58063031 CGTATCACCGCAGCCTGATGAGG + Intronic
962715187 3:138119551-138119573 CCCATCACTGCCAGCCAATGAGG - Intergenic
967605620 3:191442266-191442288 CAAATCACTGAGGCCTGATGAGG - Intergenic
969369774 4:6724232-6724254 CCCATCACAGTCTCCAGATGAGG - Intergenic
971641979 4:29146090-29146112 CCCATCAATGGGGCCTGTTGGGG - Intergenic
973879118 4:55250933-55250955 CCTCTCACAGCCGCCTTATGAGG - Intergenic
973892862 4:55385377-55385399 CCCCTCACTGCCCCCTCCTGTGG + Intergenic
982358290 4:154491974-154491996 CCCCTCCCTGCCGTGTGATGCGG + Intergenic
990522440 5:56593117-56593139 CCCAGCTCTGTGGCCTGATGTGG - Intronic
994548846 5:101205803-101205825 CCCATCATTCCCACCTGTTGTGG + Intergenic
997430073 5:133831439-133831461 CCACTCACTGCCTCCTAATGAGG - Intergenic
1000979243 5:167798977-167798999 CCCATCAAAGCCTCCTGATTAGG - Intronic
1002649970 5:180684214-180684236 CCCATCCCTCCAGGCTGATGTGG - Intergenic
1006506032 6:34489416-34489438 CCCAGCACTGCTGCTGGATGGGG - Intronic
1006992494 6:38227500-38227522 CCTATCCCTTCCGCCTGATGAGG + Intronic
1007410461 6:41658373-41658395 CCCAGCCCTGCCCCCTGCTGTGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1018674449 6:166206827-166206849 CCCATCACTCCCACTTGTTGTGG + Intergenic
1019548079 7:1587981-1588003 CACCTCACAGCCACCTGATGGGG + Intergenic
1023266504 7:38411618-38411640 CCCAACACTGCCACCTGTAGGGG + Intronic
1023983255 7:45081649-45081671 CTCCTCACTGCCGCCTGCTGGGG + Exonic
1029323435 7:99785251-99785273 CCCATCATTGCTGGCTGAGGTGG - Intergenic
1032469958 7:132171010-132171032 CCCACCACTGGGGGCTGATGAGG + Intronic
1035304647 7:157924029-157924051 CCCATCCCTGCCGTCTGCTATGG - Intronic
1037737883 8:21581542-21581564 CCCATCACTGCCTCTAGAAGAGG + Intergenic
1049167706 8:141136905-141136927 CCCCTCACTGCCTCCTCTTGTGG + Intronic
1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG + Intronic
1054144261 9:61550598-61550620 TCCAGCACTGCCCCCTGCTGAGG + Intergenic
1054463947 9:65481557-65481579 TCCAGCACTGCCCCCTGCTGAGG + Intergenic
1054830215 9:69616719-69616741 CCAATCACTTCCTTCTGATGTGG + Intronic
1055487253 9:76768093-76768115 CCCAGCACGGCTGCCTGGTGAGG + Intronic
1057334068 9:94142236-94142258 CCCCTCACTGCCTCCTGGGGAGG + Intergenic
1058798081 9:108517835-108517857 CCCAGCTCTGCAGCCAGATGAGG + Intergenic
1060312421 9:122474403-122474425 TTTATCACTTCCGCCTGATGTGG + Intergenic
1060925987 9:127455440-127455462 CTCAGCACTGCCACCTGCTGTGG + Intronic
1061294261 9:129668207-129668229 CCCACCACTGCCACTTGCTGTGG + Intronic
1062358662 9:136177188-136177210 CCCATCTCTGCCATCTGAGGAGG + Intergenic
1192448465 X:71227569-71227591 CCCACCACTGCCCCCTGGAGAGG - Intergenic
1197491813 X:127126965-127126987 TCCATCACTGCTGCCAGCTGTGG - Intergenic