ID: 1173622570

View in Genome Browser
Species Human (GRCh38)
Location 20:44448079-44448101
Sequence TGTATGGGTTGGTATAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173622565_1173622570 14 Left 1173622565 20:44448042-44448064 CCAGCATCCAGCACATCTGGTGA No data
Right 1173622570 20:44448079-44448101 TGTATGGGTTGGTATAGAGTTGG No data
1173622566_1173622570 7 Left 1173622566 20:44448049-44448071 CCAGCACATCTGGTGAAGCAAAA No data
Right 1173622570 20:44448079-44448101 TGTATGGGTTGGTATAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173622570 Original CRISPR TGTATGGGTTGGTATAGAGT TGG Intergenic
No off target data available for this crispr