ID: 1173626154

View in Genome Browser
Species Human (GRCh38)
Location 20:44474469-44474491
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173626146_1173626154 16 Left 1173626146 20:44474430-44474452 CCTGGATTATCTGGCTGAGCCCA No data
Right 1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG No data
1173626148_1173626154 -4 Left 1173626148 20:44474450-44474472 CCAATGTAATCCCAAGAGTCCTT No data
Right 1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG No data
1173626147_1173626154 -3 Left 1173626147 20:44474449-44474471 CCCAATGTAATCCCAAGAGTCCT No data
Right 1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173626154 Original CRISPR CCTTATAAGAAGAGGGAAGC AGG Intergenic
No off target data available for this crispr