ID: 1173628965

View in Genome Browser
Species Human (GRCh38)
Location 20:44495663-44495685
Sequence TACTGTGTAAGGAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173628965_1173628974 4 Left 1173628965 20:44495663-44495685 CCCTGCCCCCTCCTTACACAGTA No data
Right 1173628974 20:44495690-44495712 TTTGGTACCCATACACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173628965 Original CRISPR TACTGTGTAAGGAGGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr