ID: 1173631837

View in Genome Browser
Species Human (GRCh38)
Location 20:44522021-44522043
Sequence GTGACTCCCCAGAAACATGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173631832_1173631837 18 Left 1173631832 20:44521980-44522002 CCTGAGGCTGCTTTCTAACACGG 0: 1
1: 0
2: 1
3: 5
4: 80
Right 1173631837 20:44522021-44522043 GTGACTCCCCAGAAACATGACGG 0: 1
1: 0
2: 0
3: 9
4: 152
1173631831_1173631837 23 Left 1173631831 20:44521975-44521997 CCGGTCCTGAGGCTGCTTTCTAA 0: 1
1: 0
2: 3
3: 21
4: 223
Right 1173631837 20:44522021-44522043 GTGACTCCCCAGAAACATGACGG 0: 1
1: 0
2: 0
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173631837 Original CRISPR GTGACTCCCCAGAAACATGA CGG Exonic
901457084 1:9369259-9369281 GTGACCCACCTGAAACAGGAGGG - Exonic
902684249 1:18065536-18065558 GGGACTCTGCAGAATCATGAAGG + Intergenic
903971148 1:27119605-27119627 GTGACTTCCCAGAACTATGGTGG - Intronic
905871340 1:41406306-41406328 GAGAGTGCCCAGAAAAATGATGG + Intergenic
908049031 1:60207583-60207605 GTCTCTCCCTAGACACATGAGGG + Intergenic
910879138 1:91906517-91906539 GCGACCCCCCAGAAACCTCAGGG - Intergenic
911404563 1:97420477-97420499 GTGGCTCTGCAGAAACTTGATGG - Intronic
913118640 1:115719524-115719546 GTCACTCCCCAGACCCAAGATGG + Intronic
914217324 1:145643921-145643943 ATCATTCCCCAGAAACCTGATGG - Exonic
914469893 1:147966606-147966628 ATCATTCCCCAGAAACCTGATGG - Exonic
915608503 1:156971067-156971089 GTAACTCTCCAGAAACTTTAAGG - Intronic
917255665 1:173113463-173113485 GTGACTTCCCAGTATCATAATGG - Intergenic
917458204 1:175203988-175204010 GGGACTCCCCAGACATAGGAAGG + Intergenic
921599500 1:217091216-217091238 GTGACTCCACCAATACATGATGG - Intronic
923144800 1:231190515-231190537 GTGACCCCCCAGAAACAGAAGGG - Intronic
1063810257 10:9696751-9696773 GTGATTCACCAGAAACAAAATGG - Intergenic
1068906393 10:62329010-62329032 GTGACTACACAGAAAGAAGATGG - Intergenic
1069658241 10:70106142-70106164 GTGACTCCCAAGAACTGTGATGG + Intronic
1070649199 10:78222691-78222713 AAGTCTCCCCAGGAACATGAGGG + Intergenic
1070903211 10:80048944-80048966 GGGACTCCCAATTAACATGATGG - Intergenic
1072118100 10:92382830-92382852 GTGGCTCCACAGAAAGATTAAGG - Intergenic
1072847128 10:98844008-98844030 GTAACTCTCCAGAAGCATCAGGG - Intronic
1077575685 11:3381442-3381464 GTTACTCTCCAGAAACTTGCAGG - Intergenic
1077921958 11:6647966-6647988 CTGACTCTCCAGGAAGATGAGGG + Intronic
1078511645 11:11988648-11988670 AAGACTCCCCAGAGGCATGAGGG - Intronic
1079508328 11:21180708-21180730 GAAACTCACCAGAAACAAGAAGG - Intronic
1083308034 11:61770886-61770908 AAGACTCCTCAGAAACCTGAGGG - Intronic
1085551431 11:77376861-77376883 GTGACTCAGCTGATACATGATGG - Intronic
1086850726 11:91804364-91804386 GTGACACAGCAGAAACAGGAGGG + Intergenic
1087272012 11:96121391-96121413 ATGATTCCCCAGTAACAGGAAGG + Intronic
1088470849 11:110186633-110186655 GTGACGCCCCAGAAACTAGGAGG + Intronic
1088624493 11:111719831-111719853 GTCACTGCCCAGCAACATGATGG + Exonic
1094452802 12:30600600-30600622 GGGATTCACCAGAATCATGAAGG + Intergenic
1100791403 12:98134217-98134239 GTTACTTCCTAGACACATGAGGG - Intergenic
1105617750 13:22035275-22035297 GTGACTTGGCAGAAATATGATGG + Intergenic
1106907139 13:34420866-34420888 GTGAAGCCACAGACACATGAAGG - Intergenic
1107996423 13:45865465-45865487 GTCACTCCCCAGCACCAGGAGGG - Intergenic
1109672167 13:65623442-65623464 GTGCCTCCTCAGAAAACTGAAGG + Intergenic
1112918510 13:104580726-104580748 GTGACTTCCCATTAACATAAAGG + Intergenic
1114790406 14:25651392-25651414 TTGACTCTCCAGAAACTTTAGGG - Intergenic
1116665603 14:47770437-47770459 ATGTCTCACCAGAAAAATGATGG + Intergenic
1117593519 14:57301837-57301859 TTGGCTCCCTAGAAACATGTAGG - Intergenic
1118561190 14:67085107-67085129 GAGCCTCCTCAGAAACTTGAGGG + Intronic
1122276416 14:100592983-100593005 GGGACTCCCCAGAAGGAGGAGGG - Intergenic
1122816779 14:104317991-104318013 GTGACTCCCCAGTAAAGTCAGGG - Intergenic
1123754449 15:23386029-23386051 GTGAAACCACAGAAACATCACGG - Intergenic
1126547102 15:49885795-49885817 ATCACTCCCCAGATACCTGATGG + Intronic
1127296632 15:57614540-57614562 GTGACTACCTTGAAACAAGAAGG + Intronic
1127497788 15:59528941-59528963 GTGACTCCTCTGAGACATGGAGG + Intergenic
1127853585 15:62936213-62936235 GTGACTACCCATGAGCATGAGGG + Intergenic
1134461919 16:14436964-14436986 GTGAAACCACAGAAACATCATGG + Intronic
1136407806 16:30058897-30058919 GGGACTCAGCAGAAACAAGATGG + Intronic
1138137561 16:54536660-54536682 GTGACCCCTCAGAAACAGCAGGG + Intergenic
1138618564 16:58192977-58192999 GTGACTCCCCAGTACAATGCTGG + Intronic
1139835481 16:69834954-69834976 GTGACTCAACAGGAACAAGATGG - Intronic
1140152601 16:72385834-72385856 CTGACACCACAGAAATATGAAGG + Intergenic
1140310346 16:73842349-73842371 GTGCCTCCCCAGGATCATGGTGG + Intergenic
1141015430 16:80444543-80444565 GTGACTCCATTGGAACATGAAGG - Intergenic
1142563464 17:824884-824906 GGGCCTCCCCGGAAACAAGAGGG + Intronic
1142924477 17:3222671-3222693 GTTCCTCCCCTGACACATGAAGG - Intergenic
1144019277 17:11225743-11225765 GTGACTCCCTACAAAGAGGATGG + Intergenic
1147899160 17:43772590-43772612 GTGAGTCAACAGAAACATGCTGG - Intronic
1148966266 17:51438540-51438562 CTGACTTCCAATAAACATGAAGG + Intergenic
1151505388 17:74523792-74523814 GTGACTCAGTAGAAGCATGAGGG - Intronic
1152338847 17:79713440-79713462 GAGACTCCCCAGGATCATGCAGG + Intergenic
1152783525 17:82236771-82236793 GAGACCCCCCACAAGCATGACGG - Exonic
1153162463 18:2223029-2223051 GTGACTCAGAAGAAGCATGAGGG + Intergenic
1157086985 18:44590977-44590999 GTGACAGCCCAGAAACTTAATGG + Intergenic
1159346503 18:67213420-67213442 GTGAATCCCCATAAGCCTGAAGG - Intergenic
1160610550 18:80081575-80081597 GGGAATCACCAGAAACACGAAGG + Intronic
1165104188 19:33459235-33459257 ATGACCCCCCAGAAACAAAAGGG + Intronic
1168418131 19:56182393-56182415 GTGACGGCCCAGAAGCTTGAAGG - Intronic
925133276 2:1509491-1509513 GTGGTTTCCCAGAAACAAGAGGG - Intronic
930144140 2:47984105-47984127 GTGACTTCACAGAATCAAGAAGG + Intergenic
931823071 2:65971996-65972018 GGGACTCCACAAACACATGATGG + Intergenic
932405066 2:71507226-71507248 GTGAGCCCCTAGAAACAGGAAGG + Intronic
933569964 2:83998688-83998710 GTCAATCCACAGAACCATGAGGG - Intergenic
935463655 2:103368788-103368810 GTGAGTACCCAGAAATAAGATGG - Intergenic
937921742 2:127136299-127136321 GAGAGTCCCCAGCAGCATGAAGG + Intergenic
938130782 2:128714364-128714386 GTGACTCCACTGAGACCTGAGGG + Intergenic
938981864 2:136534693-136534715 ATTACACCCCAGAAGCATGAGGG - Intergenic
942552021 2:177129643-177129665 GTTCCTGCCCAGCAACATGAAGG + Intergenic
944345309 2:198658056-198658078 GTGACTCCCAAGGAACATAAAGG - Intergenic
946707804 2:222475898-222475920 GTGCCTCCCCAGAATCATCGTGG + Intronic
949057288 2:241934988-241935010 TTGACTCTCCAAAAACATTAAGG + Intergenic
1168804732 20:665737-665759 GTGATTCCACAGAACAATGAAGG + Intronic
1170826483 20:19800555-19800577 CTGGCTTCCCAGAAACATGGTGG - Intergenic
1171206075 20:23282618-23282640 GACAATCCCCAGAAACAGGAGGG + Intergenic
1173631837 20:44522021-44522043 GTGACTCCCCAGAAACATGACGG + Exonic
1173919129 20:46730877-46730899 ATGACTTCCCAGAAACAGAATGG - Intronic
1175985802 20:62763699-62763721 GGGTCTCCCCAGGGACATGAGGG + Intergenic
1176029308 20:63003826-63003848 GTGGCTCCCGAGAAACGTGGGGG - Intergenic
1176277366 20:64279931-64279953 GAGACTCCCCACAAACCTCAGGG - Intronic
1177180015 21:17734965-17734987 TTGACTCCCCAGATACAATAAGG + Intergenic
1177207547 21:18027911-18027933 GTCCCTCCCCAGAAACTGGATGG + Intronic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1179566251 21:42250904-42250926 GAGACCCACCAGACACATGAAGG + Intronic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1182425231 22:30268085-30268107 CTGACTCCCCAGACTCCTGAGGG - Intergenic
1182508395 22:30802124-30802146 GTTTCTCCTCTGAAACATGAGGG - Intronic
1184032540 22:41903436-41903458 GTGCCTCCCCAGGCACATGCTGG + Intronic
949645452 3:6088555-6088577 GTGTGTCCCCAGAAAAGTGAAGG - Intergenic
951023093 3:17801800-17801822 CTGACTCCCCAGGAACAAGCAGG - Intronic
952362176 3:32641662-32641684 GTCAATCCACAGAATCATGAGGG + Intergenic
954189456 3:48946841-48946863 TGGACTACCCAGAAACTTGAGGG + Intronic
957152368 3:76502161-76502183 GAGACAGCCCAGAATCATGAAGG + Intronic
957864768 3:86007169-86007191 GTAACTGCCCAGGAACAGGATGG + Intronic
958684868 3:97379217-97379239 GGGAGTCCTCAGAATCATGATGG - Intronic
959526263 3:107380814-107380836 GTGCCTCTCTAGAAACATTAAGG - Intergenic
960284179 3:115809048-115809070 GTAAATCCCCAGAAACAGGAAGG - Exonic
963942079 3:151105425-151105447 GTGTCTCAGCAGAAAGATGAGGG - Intronic
963986529 3:151601762-151601784 TAGACACCCCAGGAACATGAGGG + Intergenic
969714637 4:8862348-8862370 GTGACTACCAAGAAACATTAGGG - Intronic
974527360 4:63061170-63061192 GTGACTCTCCAAAACCATCAAGG + Intergenic
978892147 4:113842734-113842756 GTGACCCACCAGAAGCAAGAAGG - Intergenic
981071705 4:140547384-140547406 GTAACTTCCCAGAATCATGGCGG - Intronic
986256292 5:6103650-6103672 AAGACTCCTCTGAAACATGAAGG + Intergenic
988221154 5:28348698-28348720 GTTACTCCCTAGATACATGAGGG + Intergenic
991115038 5:62945512-62945534 GTGAATACGGAGAAACATGATGG - Intergenic
991961615 5:72050405-72050427 GTGATTTCCCTGAAAAATGAGGG + Intergenic
994770137 5:103971659-103971681 GTCACCTGCCAGAAACATGAGGG - Intergenic
995482721 5:112609135-112609157 ATGACTCACAAGAAACAAGAGGG + Intergenic
995764849 5:115603408-115603430 GAGACTCCCAGGAAAAATGAGGG - Intronic
996595975 5:125203244-125203266 GTGACTCAGAAGAAACAAGAAGG - Intergenic
997427852 5:133816498-133816520 GTCACTCCACAGAAGCCTGAAGG + Intergenic
1000677144 5:164135317-164135339 GTTACTCCACAGAAGCATTAAGG + Intergenic
1003316271 6:5014917-5014939 GTCACTCTCCAGAATCTTGAAGG - Intergenic
1004849120 6:19678076-19678098 GTGACTCCCCAGACACACACTGG + Intergenic
1008540974 6:52546216-52546238 GTGACTCCCTGGGAAAATGAGGG + Intronic
1010285534 6:74073562-74073584 ATGACTCACCTGAAAGATGATGG - Intergenic
1011628557 6:89302792-89302814 GTGGATCCCCAACAACATGAAGG + Intronic
1023277838 7:38539532-38539554 GCCATTCCTCAGAAACATGAAGG + Intronic
1025006826 7:55362114-55362136 GAGACTCCCCATCAACAAGAAGG - Intergenic
1026667575 7:72357000-72357022 GAGACTTCCAGGAAACATGACGG + Intronic
1028873712 7:95796808-95796830 GGGGTTCCCCAGAAACATTAGGG + Intronic
1030679185 7:112416236-112416258 GTGACACCCTAGCAGCATGAAGG + Intergenic
1031273549 7:119687538-119687560 ATGACTCCCAGGGAACATGATGG + Intergenic
1031826821 7:126575935-126575957 GTTACTAACAAGAAACATGATGG + Intronic
1034502925 7:151462615-151462637 GTGTAACCCCAGAAACATAATGG - Intergenic
1040296551 8:46151936-46151958 GTCCCTTCCCAGAAGCATGAGGG - Intergenic
1040649742 8:49434468-49434490 GTGACTCTCCAAAACCATGGAGG + Intergenic
1046250392 8:111623789-111623811 GAGAGTCCCCACAAACAAGAAGG - Intergenic
1047566399 8:126048110-126048132 GGGAATCCACAGAAACATGAAGG - Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1049470568 8:142773431-142773453 GTGACTCCCCAGAGGGAAGATGG - Intronic
1049946417 9:600915-600937 GTGACCCTCCTGAAAAATGAAGG - Intronic
1051524814 9:18031800-18031822 GTAACTCCCCAGGAACCTGCTGG + Intergenic
1052162472 9:25282741-25282763 GTGAGCCCCCAGAAATATCATGG - Intergenic
1059920716 9:119157264-119157286 GGGAGTCCTCAGAATCATGATGG - Intronic
1062401902 9:136376513-136376535 GTGACACCCCCGAGCCATGATGG + Intronic
1186589720 X:10917205-10917227 GTCACTCCCCTGAAGTATGAGGG - Intergenic
1192855270 X:75003466-75003488 GTGTCTCCACATAAGCATGAGGG + Intergenic
1198398215 X:136244181-136244203 GTGACTCCCCAGCCAAATCAGGG - Intronic
1199076917 X:143535432-143535454 GTGAGTCCCCAAAAATATGAGGG + Intergenic
1200183504 X:154166518-154166540 GTGACTGCCCAAAGACATGTTGG - Intergenic
1200189158 X:154203646-154203668 GTGACTGCCCAAAGACATGTTGG - Intergenic
1200194913 X:154241455-154241477 GTGACTGCCCAAAGACATGTTGG - Intergenic
1200200563 X:154278576-154278598 GTGACTGCCCAAAGACATGTTGG - Intronic
1200367056 X:155677806-155677828 ATGACTCCCCAGATACACAATGG - Intergenic
1200544536 Y:4503528-4503550 GGCACTGCCCAGGAACATGAAGG - Intergenic
1201581589 Y:15516009-15516031 GTCACTGCACAGAGACATGATGG - Intergenic
1201588870 Y:15591728-15591750 ATGACTCCCCAGAATCAAGATGG - Intergenic