ID: 1173636908

View in Genome Browser
Species Human (GRCh38)
Location 20:44567664-44567686
Sequence GGTGCACAAGAAACACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173636908_1173636913 0 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636913 20:44567687-44567709 TTCCAGTGCCGGGCACAGGCTGG 0: 1
1: 0
2: 0
3: 28
4: 255
1173636908_1173636919 22 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636919 20:44567709-44567731 GGCAGCACACCTTCTGGGCCAGG No data
1173636908_1173636920 28 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636920 20:44567715-44567737 ACACCTTCTGGGCCAGGCCCAGG 0: 1
1: 1
2: 2
3: 47
4: 415
1173636908_1173636917 16 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636917 20:44567703-44567725 AGGCTGGGCAGCACACCTTCTGG 0: 1
1: 0
2: 2
3: 31
4: 204
1173636908_1173636910 -10 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636910 20:44567677-44567699 CTTGTGCACCTTCCAGTGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 177
1173636908_1173636918 17 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636918 20:44567704-44567726 GGCTGGGCAGCACACCTTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 142
1173636908_1173636911 -4 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636911 20:44567683-44567705 CACCTTCCAGTGCCGGGCACAGG 0: 1
1: 0
2: 3
3: 14
4: 198
1173636908_1173636914 1 Left 1173636908 20:44567664-44567686 CCAGCTTGTGTTTCTTGTGCACC 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1173636914 20:44567688-44567710 TCCAGTGCCGGGCACAGGCTGGG 0: 1
1: 0
2: 8
3: 50
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173636908 Original CRISPR GGTGCACAAGAAACACAAGC TGG (reversed) Intronic
903617467 1:24671463-24671485 GAAGCACAAAAAACACAAGAAGG + Exonic
907577925 1:55545257-55545279 GGGGCACAAGAAACAGATGGAGG - Intergenic
907625478 1:56025151-56025173 GGTCCACAGGAAACATAAGCAGG + Intergenic
909751971 1:79172616-79172638 GGTGCCAAAGGAACAAAAGCAGG - Intergenic
910209704 1:84780351-84780373 GGTGCAGAAGAAAGAACAGCAGG + Intergenic
911058227 1:93725450-93725472 GATGAACAAGAGACATAAGCAGG - Intronic
911647695 1:100353167-100353189 GGGACACAAGAAAGAGAAGCCGG - Intronic
912940521 1:114040722-114040744 GGTTCACAGGAATCACATGCTGG - Intergenic
918191810 1:182182969-182182991 GGTGCACAGGCACCACTAGCAGG - Intergenic
919627553 1:199926422-199926444 GGTGGACAAGAAGCAAAAGGGGG + Intergenic
920084674 1:203406590-203406612 GGTACCCAAGAAACATCAGCTGG - Intergenic
920971092 1:210744321-210744343 AGTGCACCAGAATCACATGCAGG + Intronic
922635736 1:227168795-227168817 GATGCTCAAGAAACACCAGGGGG - Intronic
924404175 1:243724899-243724921 GGTACACAAGAAACAAAAGTAGG + Intronic
1063613841 10:7585525-7585547 GGTGCGCACGAAACACTGGCTGG + Intronic
1066441787 10:35446607-35446629 GCTGCTCATGAAACACAAACTGG - Intronic
1068368368 10:56082157-56082179 TAAGCACAAGAAATACAAGCAGG - Intergenic
1069088430 10:64170215-64170237 GGTGCACAAAAAACAAGAACAGG - Intergenic
1070952706 10:80443931-80443953 AGTGCACAGGAAATAGAAGCTGG + Intergenic
1072617981 10:97062515-97062537 GATGCACCAGAAACACAATGCGG + Intronic
1078647097 11:13150826-13150848 TGTGGACAAGAAAAAGAAGCTGG - Intergenic
1079339552 11:19600774-19600796 GGTGTTCAATAAACACTAGCTGG + Intronic
1079922413 11:26449150-26449172 TGTGAACAAGGAACACAAGATGG - Intronic
1080090804 11:28346774-28346796 GTTGTACACGAAACACATGCTGG - Intergenic
1084399469 11:68935283-68935305 GGTCCACCTGAAACACCAGCCGG - Exonic
1087033324 11:93728672-93728694 GGTTCACAGGAAACAGAAACTGG + Exonic
1088036898 11:105328382-105328404 GTTGCCCAAGAAACAAAAGTTGG + Intergenic
1088059072 11:105623515-105623537 GGTGAACAAGACAAAGAAGCAGG - Intronic
1088196200 11:107276749-107276771 GGTGAATAAGAAGCACAAGAGGG - Intergenic
1096323307 12:50634707-50634729 GGTGAATAAGACACACAAACAGG - Intronic
1097482456 12:60147111-60147133 GGTGTTCATAAAACACAAGCTGG + Intergenic
1098978036 12:76924037-76924059 GGATCACAAGAACCAAAAGCAGG - Intergenic
1099213410 12:79822115-79822137 GTTGCAAAAGAAACAAAATCTGG - Exonic
1099827516 12:87796677-87796699 GGTGCACAAGAAAGACTACCAGG + Intergenic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1104319616 12:127738432-127738454 GGGGCACCAGGAACCCAAGCCGG - Intergenic
1107611507 13:42118233-42118255 AGTAAACAAGAAACACAGGCTGG - Intronic
1111898548 13:94171692-94171714 GGGCCTCAAGAAACTCAAGCTGG - Intronic
1114134602 14:19834001-19834023 GGTCCTCAAGACACAAAAGCTGG + Intergenic
1116178229 14:41501005-41501027 TGTGCAGAAGAAACACAAGAAGG + Intergenic
1116937005 14:50750936-50750958 TGTGCAAAAGAAACACAAGAAGG - Intronic
1117025277 14:51613254-51613276 GGTGACAAAGAAACACAAACAGG + Intronic
1118953736 14:70459908-70459930 TATGCACAAGAAACACAACAAGG - Intergenic
1119474518 14:74919482-74919504 GGTTCACAAGAGACAGAATCAGG + Intronic
1122009466 14:98733893-98733915 GGTGCACACAGGACACAAGCAGG + Intergenic
1123577651 15:21689573-21689595 GGTCCTCAAGACACAAAAGCTGG + Intergenic
1123614275 15:22132054-22132076 GGTCCTCAAGACACAAAAGCTGG + Intergenic
1125042893 15:35212411-35212433 GCAGCAAAAGAAATACAAGCAGG + Intergenic
1126698958 15:51350683-51350705 GGTGCACAAGGAAGACAGGAGGG + Intronic
1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG + Intergenic
1131477040 15:92748770-92748792 GGTTCAGAAGAAACACCAACAGG - Intronic
1202986520 15_KI270727v1_random:423818-423840 GGTCCTCAAGACACAAAAGCTGG + Intergenic
1137473323 16:48782740-48782762 GAGGCACAAGGAAGACAAGCAGG - Intergenic
1137683194 16:50368744-50368766 GAAGCACAAGAAGCACAAGTCGG - Exonic
1137828967 16:51525857-51525879 GGTGCACAAGAACCATCTGCTGG - Intergenic
1138552892 16:57756998-57757020 GGTGCACAAGGAACAGGAGTGGG - Exonic
1138722153 16:59094878-59094900 ATTGCAGAAGAAACACAAGGAGG + Intergenic
1140271378 16:73469231-73469253 GGAGAACAAGCAACAAAAGCTGG + Intergenic
1144064005 17:11608096-11608118 GGTGCACAGGAAAGAAAGGCAGG - Intronic
1145034584 17:19532368-19532390 GGTGGGCAAGAAACCTAAGCAGG + Intronic
1146754217 17:35412431-35412453 GGTGCTCAGGAAACACAGACTGG + Intronic
1152258429 17:79253763-79253785 GGTGCTCAACAAACAGCAGCTGG - Intronic
1152520212 17:80851642-80851664 GGTGCTGATGAAACACACGCGGG - Intronic
1163848658 19:19651422-19651444 AGTGCACAGGAAACCCGAGCTGG + Intronic
1167565751 19:50255546-50255568 AGTGCTCAAGAAACGCGAGCTGG - Intronic
1168534048 19:57154461-57154483 GGTGCAGAAGATACACAAAATGG - Exonic
925073947 2:995861-995883 TGTGGAAAAGAAACACAATCAGG + Intronic
925309649 2:2873570-2873592 GGTGCAGAAGAAGCACCAGGTGG + Intergenic
927655925 2:24946422-24946444 GGTTCAGAAAAAACACAAGACGG + Exonic
929063581 2:37949162-37949184 GGAGCACAAGAAGCCCAAGGAGG - Intronic
934164609 2:89282701-89282723 GGTGCCCAAGAAACCAAAGGAGG + Intergenic
934202665 2:89899823-89899845 GGTGCCCAAGAAACCAAAGGAGG - Intergenic
937179173 2:119974647-119974669 GGGGCACAAGATGTACAAGCTGG - Intronic
938366800 2:130740985-130741007 GGTGCAGGGGAAACAGAAGCTGG + Intergenic
941351715 2:164445768-164445790 AGTGTACAAGAAACAAGAGCTGG + Intergenic
942080049 2:172391740-172391762 GGTGCAGAGGAAAAACAAGGGGG + Intergenic
942112427 2:172695446-172695468 GGGGAAAAAGAAACTCAAGCAGG + Intergenic
946927825 2:224643406-224643428 GGTGCAGAAGAAGCAGAAGTGGG - Intergenic
1169558312 20:6771158-6771180 GGTGCACATGAAAAAAAAACAGG - Intronic
1170312993 20:15012852-15012874 GGTGCACAGGAAACCCACCCAGG - Intronic
1170896561 20:20420209-20420231 GGTGCAGCTGAAAGACAAGCTGG + Intronic
1172147054 20:32763964-32763986 GGTGAACAAGAAGCCCCAGCAGG - Intronic
1172453100 20:35042945-35042967 GGTACACAAGAAACATAAAGTGG - Intronic
1173027125 20:39318730-39318752 GGTGCTCAAGAATCAAAACCTGG + Intergenic
1173636908 20:44567664-44567686 GGTGCACAAGAAACACAAGCTGG - Intronic
1174090710 20:48044675-48044697 TGTGCACAAGCAACACATCCTGG + Intergenic
1178277414 21:31251793-31251815 GGTGCACAAGAAGAACAAGAAGG - Exonic
1179092714 21:38282244-38282266 GGTACACCAGTAACCCAAGCAGG - Intronic
1180762661 22:18221684-18221706 GGTGCAGAAAACACACAAGGAGG + Intergenic
1180773006 22:18402924-18402946 GGTGCAGAAAACACACAAGGAGG - Intergenic
1180806389 22:18716937-18716959 GGTGCAGAAAACACACAAGGAGG + Intergenic
1181217335 22:21342718-21342740 GGTGCAGAAAACACACAAGGAGG + Intergenic
949807816 3:7974788-7974810 AGTCCAAAAGAAACAGAAGCTGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954541667 3:51397074-51397096 AGTAAACAAGAAACACAAGACGG - Exonic
957897546 3:86443339-86443361 AGTGGACAAGAAACACAATAAGG + Intergenic
959722101 3:109503669-109503691 AATGCACAACAAAAACAAGCAGG - Intergenic
962858080 3:139368179-139368201 GCTGCACAGGAAACACATGAGGG - Exonic
963260589 3:143187638-143187660 TTTGCACTAGGAACACAAGCTGG + Intergenic
964757404 3:160100859-160100881 GAAGCACAAGAAGCACAAGTCGG + Intergenic
967936996 3:194736920-194736942 GTTGCAGAAGAAGCACCAGCAGG - Intergenic
969213229 4:5703998-5704020 GGTGTTCAAGGAACACAAGGAGG + Intronic
970032582 4:11693537-11693559 GCTTCACAAGAAACTCAAGGTGG + Intergenic
972669094 4:41196369-41196391 GGTACTCAATAAACACATGCTGG + Intronic
972701132 4:41494739-41494761 GCTAGACAAGAAACACAAGTCGG + Intronic
975711722 4:77167600-77167622 GGTCCACAAGAGCCAGAAGCTGG - Exonic
976656425 4:87493310-87493332 AGTGCAGAAGTAACACAAGAAGG - Intronic
977614635 4:99074552-99074574 GGTCCACAAGAAACACACCATGG + Intronic
977839602 4:101686665-101686687 GATGAACAAGATAGACAAGCTGG + Intronic
983262131 4:165468725-165468747 GCTGGACATGAAACACAAGTAGG - Intronic
983505458 4:168548094-168548116 GGTGTTCAAGAAGCACATGCTGG - Intronic
986013342 5:3736853-3736875 AGTGAAAAAGAAACACAAGTGGG + Intergenic
986992379 5:13569519-13569541 GGTGGACAAGAAATACCAGCTGG - Intergenic
988919664 5:35928740-35928762 TCTGCACAAGATACACAAGATGG + Intronic
989114048 5:37934806-37934828 AGTGCAAGAGAAACCCAAGCAGG + Intergenic
995181265 5:109232749-109232771 GGATCACAAAAAACAAAAGCTGG + Intergenic
995648897 5:114345271-114345293 GGTACAAAAGAAATACAAGCAGG + Intergenic
997481804 5:134191040-134191062 AGTGCACTGGAAACCCAAGCTGG + Intronic
1000018912 5:157302258-157302280 CGGGCACAGGGAACACAAGCAGG - Intronic
1000125362 5:158238521-158238543 GGTCCAGAAGGAAAACAAGCTGG - Intergenic
1000216429 5:159161493-159161515 GGGCCACAAGAAACTCCAGCAGG + Exonic
1000580700 5:163032404-163032426 GGGGGCCAAGAAACACAACCAGG + Intergenic
1004131656 6:12926510-12926532 CGTGGACAAGTAACACAAGTTGG - Intronic
1004561620 6:16758393-16758415 TGTTCACAATAAACACCAGCAGG + Intronic
1006512655 6:34530017-34530039 GGTACTCTAGAAACACATGCTGG + Intronic
1007276746 6:40679707-40679729 GGTGGACAAGAAATATAAACAGG - Intergenic
1010568480 6:77448360-77448382 GGTGCACAAGAAGGCCTAGCTGG + Intergenic
1011053898 6:83185139-83185161 GGTGAACATGAGACAGAAGCAGG + Intronic
1013289532 6:108708453-108708475 GGTGAACAAGAACCACAAGAAGG + Intergenic
1013753229 6:113431364-113431386 GGTTCATAAGAAACATAATCAGG - Intergenic
1017631008 6:156396694-156396716 GATGCACCGGAAACAAAAGCTGG + Intergenic
1021994502 7:26166655-26166677 AGTGCTCAATCAACACAAGCTGG + Intronic
1024527708 7:50362892-50362914 GGTGGACAGGAAACACAGGCAGG + Intronic
1024603719 7:51008601-51008623 GCTGCCCTAAAAACACAAGCAGG + Intergenic
1025186813 7:56867037-56867059 TGTGCTCAAGAACCACTAGCAGG + Intergenic
1025685109 7:63709879-63709901 TGTGCTCAAGAACCACTAGCAGG - Intergenic
1025835710 7:65091633-65091655 TGTGCTCAAGAACCACTAGCAGG - Intergenic
1025905489 7:65781097-65781119 TGTGCTCAAGAACCACTAGCAGG - Intergenic
1027442372 7:78233225-78233247 GGTTAACAAGCAACACAAGCTGG + Intronic
1029436985 7:100569001-100569023 GGTGCACCAGACAAACCAGCAGG - Intergenic
1032982606 7:137301202-137301224 GTTGCATAAGAAACTAAAGCAGG + Intronic
1033026171 7:137774854-137774876 GGAGAACGAGAAAGACAAGCAGG + Intronic
1039412024 8:37362971-37362993 GGTGCATAAGAAACACCTGAGGG - Intergenic
1043890050 8:85644314-85644336 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043891591 8:85656228-85656250 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043892663 8:85663065-85663087 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043892894 8:85714270-85714292 GGTGCCCCAGATGCACAAGCAGG + Intergenic
1043895581 8:85735724-85735746 GGTGCCCCAGATGCACAAGCAGG + Intergenic
1043897098 8:85746084-85746106 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043899424 8:85764452-85764474 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043901032 8:85776645-85776667 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043902996 8:85791920-85791942 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043904606 8:85804113-85804135 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043906218 8:85816304-85816326 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1043907826 8:85828494-85828516 GGTGCCCCAGATGCACAAGCAGG - Intergenic
1045610898 8:103839931-103839953 GGAGCATAAGAAACACAGTCCGG - Intronic
1047665421 8:127086451-127086473 GAAGCACAAAAAACACAAGAAGG - Intergenic
1048103845 8:131385451-131385473 TGTGCACAAGAAATGAAAGCAGG + Intergenic
1048257300 8:132914778-132914800 AGGGGACAAGAAACAGAAGCAGG + Intronic
1048844019 8:138589450-138589472 GGAGCAAAAGAAACAGAAGGTGG + Intronic
1059776102 9:117476797-117476819 GGTGCCCAAGGAAGTCAAGCAGG - Intergenic
1060972357 9:127745394-127745416 GTGGCACAAGAAACTCCAGCAGG - Intronic
1061825416 9:133255680-133255702 GGTGCCCAAGAACCACCAGGCGG - Exonic
1062666067 9:137673190-137673212 GGTGCTCAATAAACACCTGCTGG - Intronic
1187242226 X:17523689-17523711 GGAAGCCAAGAAACACAAGCAGG - Intronic
1188219177 X:27518947-27518969 GGTGCATAAAAAACAAAATCAGG - Intergenic
1189250968 X:39600529-39600551 GGTGCAGAAATAACACAAGTGGG - Intergenic
1192118175 X:68431371-68431393 GCTGCACAAGAAATACCAGCTGG + Intronic
1201603686 Y:15760990-15761012 GTAACACAAGAAACTCAAGCTGG - Intergenic