ID: 1173638374

View in Genome Browser
Species Human (GRCh38)
Location 20:44581024-44581046
Sequence TGCCGCAGCCAGCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173638374_1173638377 -6 Left 1173638374 20:44581024-44581046 CCTTTCCCAGGCTGGCTGCGGCA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1173638377 20:44581041-44581063 GCGGCAACCACTTTGAGAAATGG 0: 1
1: 0
2: 0
3: 7
4: 88
1173638374_1173638378 0 Left 1173638374 20:44581024-44581046 CCTTTCCCAGGCTGGCTGCGGCA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1173638378 20:44581047-44581069 ACCACTTTGAGAAATGGCATTGG 0: 1
1: 1
2: 1
3: 17
4: 184
1173638374_1173638381 17 Left 1173638374 20:44581024-44581046 CCTTTCCCAGGCTGGCTGCGGCA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1173638381 20:44581064-44581086 CATTGGCATTGGCATGTGTGTGG 0: 1
1: 1
2: 3
3: 17
4: 183
1173638374_1173638380 6 Left 1173638374 20:44581024-44581046 CCTTTCCCAGGCTGGCTGCGGCA 0: 1
1: 0
2: 2
3: 25
4: 280
Right 1173638380 20:44581053-44581075 TTGAGAAATGGCATTGGCATTGG 0: 1
1: 0
2: 0
3: 26
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173638374 Original CRISPR TGCCGCAGCCAGCCTGGGAA AGG (reversed) Intronic
900244762 1:1631883-1631905 GGCCCCAGGCAGCCCGGGAAGGG - Intergenic
901011670 1:6206000-6206022 GGCAGCAGCCACCCTGGGGAAGG + Intronic
902238251 1:15071541-15071563 CACCGCACCCAGCCTGGGTATGG + Intronic
902392580 1:16115082-16115104 TGCCGATGCCAGCCTGGAAGGGG + Intergenic
902779100 1:18693101-18693123 TGCAGAAGACAGCCAGGGAATGG - Intronic
903005175 1:20293590-20293612 TACTCCAGTCAGCCTGGGAAGGG + Intronic
903500868 1:23799662-23799684 GGCCTCAGCCTGCCTGGCAAAGG - Intronic
903542639 1:24105566-24105588 CCCCGCAGCCAGCCTGGGGCTGG - Intronic
903671790 1:25040352-25040374 TTCCACAACCATCCTGGGAAAGG - Intergenic
905309049 1:37036965-37036987 TGCCATCGCCAGCCTGGGACTGG + Intergenic
905511491 1:38524908-38524930 CACCGCACCCAGCCTGGGAAAGG - Intergenic
905802867 1:40856601-40856623 GGCCAGATCCAGCCTGGGAAGGG + Intergenic
907384759 1:54118779-54118801 GGCAGCCGCCAGTCTGGGAAGGG - Intergenic
907416635 1:54318885-54318907 TGCCGGATACATCCTGGGAAAGG - Intronic
907609087 1:55849805-55849827 GGCAGAAGGCAGCCTGGGAAAGG + Intergenic
909121646 1:71611043-71611065 TGCCGCCTCCAGCCTTTGAATGG - Exonic
910492371 1:87786677-87786699 GGCTGCAGCCAGGGTGGGAATGG + Intergenic
912720024 1:112012189-112012211 TGCAGCAGAGAGCCTGGGCAAGG + Intergenic
913331705 1:117672949-117672971 GGCCTCAGCCAGCTCGGGAATGG + Intergenic
915958526 1:160244022-160244044 TGCTGTAGCCAGCCTGGGTTTGG + Exonic
916497267 1:165356814-165356836 CCGCGCAGCCAGGCTGGGAAAGG - Intergenic
916790147 1:168117821-168117843 TGCAGCAGAGGGCCTGGGAAGGG - Intronic
919260813 1:195191101-195191123 TGCTGCATCCAACTTGGGAAAGG + Intergenic
920378378 1:205521736-205521758 GTCCTCAGCCAGCCTGGAAAGGG - Intronic
923676720 1:236086806-236086828 AGGCACAGCCAGCCTGGAAACGG - Intergenic
924706454 1:246506834-246506856 TGCCGCAGCGGGGCTGGGAGGGG - Intronic
1063282026 10:4640249-4640271 TGCCAAAGCCAGCCTCAGAAAGG + Intergenic
1063435054 10:6022612-6022634 GGCAGGAGCCAGCCTGGGACAGG - Intronic
1063690806 10:8285234-8285256 AGCATCAGCCAGCCTCGGAAGGG - Intergenic
1064075330 10:12264304-12264326 GGCTGCTTCCAGCCTGGGAAAGG + Intergenic
1065686314 10:28288855-28288877 AGCCACAGCCATCCTGAGAAAGG + Intronic
1067081538 10:43215262-43215284 TGCCTCTGCCAGCCTTGGCAGGG + Intronic
1067247945 10:44561818-44561840 TGCAGCAGTCAGCAGGGGAAGGG - Intergenic
1068783164 10:60943664-60943686 TGGCGCAGCCAGCCTGCTAAGGG + Intronic
1070592987 10:77813395-77813417 TGCCCCAGCCCTCTTGGGAAGGG + Intronic
1072415814 10:95245973-95245995 TGCCTCAGCCAGGCTGCAAAGGG - Intronic
1073301917 10:102476014-102476036 TGCTGCTGGCAGCCTGGGGAAGG + Exonic
1074157630 10:110812386-110812408 TGCCCCAGTCAGCCCGGGAGGGG - Exonic
1074317091 10:112370252-112370274 GGCCTCAGCCAGCCCAGGAAGGG - Intergenic
1074888880 10:117718741-117718763 TGCATCTGCCAGCCTGGAAAGGG + Intergenic
1075313538 10:121433945-121433967 ACCCACAGCCAGCCTGAGAACGG + Intergenic
1075917709 10:126183443-126183465 TGCAGTAGCCATCCTGGGACTGG - Intronic
1076589505 10:131573658-131573680 TTCAGCTGCCATCCTGGGAAAGG + Intergenic
1076589515 10:131573705-131573727 TTCAGCTGCCATCCTGGGAAAGG + Intergenic
1076692688 10:132231788-132231810 TGAAGATGCCAGCCTGGGAATGG + Intronic
1076706225 10:132303067-132303089 AGCAGCAGCCAGCGTGGAAACGG + Intronic
1078085937 11:8233057-8233079 TGCAGAGGCCAGCCTGGGCACGG - Intronic
1078864830 11:15287744-15287766 TGCCTCACGCAGCCTGGGGATGG + Intergenic
1079629149 11:22652509-22652531 GGCGGCAGCCAGGCTGGGGAAGG - Intronic
1080132143 11:28808879-28808901 TGCCTCAGCCCTCTTGGGAAAGG - Intergenic
1080461884 11:32461765-32461787 TGCCTCAGCCTCCCTGGTAACGG - Intergenic
1080503572 11:32892531-32892553 CGCCGCGGCCCGCGTGGGAAGGG - Intergenic
1080853985 11:36095805-36095827 TCACTCAGACAGCCTGGGAAAGG - Intronic
1081849514 11:46265369-46265391 TGCTGCCGCCTGGCTGGGAAAGG - Intergenic
1083147282 11:60768872-60768894 TGCTGGAGGCAGCCTGGGCAGGG - Intronic
1083305815 11:61761458-61761480 GATCGCAGCCTGCCTGGGAAGGG + Intronic
1084119875 11:67062751-67062773 GGCCGCACCCGGCATGGGAAGGG + Intronic
1084408199 11:68991168-68991190 TGCCCAAGCCCGCCTGGGAAGGG - Intergenic
1084752894 11:71215563-71215585 TGCAGGTGCCTGCCTGGGAAAGG - Intronic
1087966614 11:104422849-104422871 GGCCTCAGCCAGCCCAGGAAGGG + Intergenic
1088771016 11:113036312-113036334 TGCTGCGTCCAGCCTGGAAAAGG - Intronic
1091251908 11:134151249-134151271 TGCCGCAGGCCGCCTGGCAGAGG + Exonic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1094387425 12:29910320-29910342 TGCAGCAGCGAGGCTGGGGAAGG + Intergenic
1095225064 12:39669759-39669781 GGCGGCAGCCAGGCTGGGAGGGG - Intronic
1096037811 12:48488226-48488248 TGCCGCAGCCATCCAGAGACTGG + Intronic
1096867109 12:54571146-54571168 TCCCGAAGCCGGCCTGGGAGGGG - Intronic
1103623914 12:122204636-122204658 TTCCGCAGCCCACCAGGGAAGGG + Exonic
1103902995 12:124313018-124313040 TGCCCCTGCCAGCCAGGCAATGG + Intronic
1104946202 12:132415862-132415884 GGCCACAGCCAGGCTGGGGAGGG + Intergenic
1105533355 13:21240911-21240933 TGCCACAGCAAGCCGGGGACTGG - Intergenic
1106322106 13:28650356-28650378 AGCTGCAGCCAGCTTGGGATGGG + Intergenic
1106468420 13:30033427-30033449 TGCCAAAGGCAGCCTGGCAAAGG + Intergenic
1107031836 13:35861460-35861482 GCCTGGAGCCAGCCTGGGAAAGG + Intronic
1113378997 13:109786299-109786321 GGCCGCAGGCAGCCGGGGAGGGG - Exonic
1113424087 13:110193650-110193672 TGCGGCTGCCAGCCAGGGCAGGG - Intronic
1113425886 13:110208115-110208137 TGCTGTAGCCAGCCTGTGGAAGG - Intronic
1114195070 14:20469701-20469723 TGCGGCAGCCAGCGCGGGCAGGG + Intronic
1118259712 14:64235617-64235639 TGCCGCAGCCAGCCATGGCAGGG + Intronic
1118401258 14:65381685-65381707 TGTAGTAGTCAGCCTGGGAAAGG - Intergenic
1119357425 14:74018976-74018998 TGCCGCAGCCAGCGTGGCCGCGG - Intronic
1120229820 14:81829868-81829890 GGCCTCAGCCAGCCCAGGAAGGG + Intergenic
1121115480 14:91339844-91339866 TGGCCCGGTCAGCCTGGGAAGGG - Intronic
1121313462 14:92947375-92947397 TGTCGCAGCTGGCCTGGGACAGG + Intronic
1121419501 14:93802748-93802770 TGCCCCAGCCAGCCTGCCAGAGG + Intergenic
1122057934 14:99117784-99117806 TGCGGCAGGCAGCCTGGCAGAGG - Intergenic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122625660 14:103084294-103084316 TGCCGGGGCCAGGCTGGGGAGGG - Intergenic
1122770939 14:104097389-104097411 TGCAGCAGGCAGCCTGGAGATGG - Intronic
1122775653 14:104116031-104116053 CACCGCAGCCACCCTGGAAAGGG - Intergenic
1124642120 15:31402257-31402279 TGCCCCCGCCAGCCTCTGAAAGG + Intronic
1125535987 15:40441401-40441423 CGCCCCCGCCAGCCCGGGAAGGG + Intronic
1126096768 15:45095715-45095737 TCCCAAAGCCAGCCTGGGAGAGG - Intronic
1127303868 15:57683211-57683233 AGCTGCAGCCTGGCTGGGAAAGG + Intronic
1127975046 15:63990901-63990923 AGCCACAGCCTGCCTGGGGATGG + Intronic
1127984706 15:64060792-64060814 GGCCTCAGCCAGCCCAGGAAGGG - Intronic
1128536298 15:68493174-68493196 TGCTGCTGACAGACTGGGAAGGG + Intergenic
1129385800 15:75195682-75195704 CGCCTCAGCCAGCCTTAGAAAGG + Intronic
1129737470 15:77974214-77974236 TGGTGCAGGCAGCCTGGGCATGG + Intergenic
1132233072 15:100199547-100199569 AGCCTCAGCCCACCTGGGAAGGG + Intronic
1132607332 16:799093-799115 TGAAGCAGCCAGCCTGGGGCTGG + Exonic
1132695990 16:1202241-1202263 TGCCGCTGCCAGCCTCAGACTGG + Exonic
1132855281 16:2042202-2042224 GCCCGCAGCCAGGCAGGGAACGG - Intronic
1133047891 16:3099257-3099279 AGCCTCCGCCAGCCTGGGGAAGG + Intronic
1134246991 16:12547445-12547467 TGCCTCAGGCAGCCTGGGAAGGG + Intronic
1135700148 16:24625323-24625345 TGCCGCACCCGGCCTGGCATGGG - Intergenic
1136244000 16:28962893-28962915 CCCCGCACCCAGCCTGGGACTGG - Intronic
1137000444 16:35225186-35225208 TGCAGCAGCCAGCCTGGGCGAGG + Intergenic
1138720366 16:59072675-59072697 GGCAGCAGCGAGCCTGGGGAAGG + Intergenic
1138762832 16:59564881-59564903 GGCGGCAGCAAGGCTGGGAAAGG - Intergenic
1139402787 16:66696124-66696146 TGAGGCTGCCGGCCTGGGAAGGG + Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142806898 17:2376075-2376097 TCCTGCCCCCAGCCTGGGAAGGG + Intronic
1142863460 17:2776970-2776992 TTCCGCAGCCAGCCTGGATCGGG + Intergenic
1143408461 17:6694096-6694118 TTCCGCAGCCAGACTGAGGAAGG - Exonic
1145302391 17:21649777-21649799 GGCTGCAGCCAGGCAGGGAAAGG - Intergenic
1146945524 17:36870610-36870632 GGCTGCAGCCAGGCTAGGAAGGG + Intergenic
1147788673 17:42998866-42998888 CGCCGCAGCCAGCCTGGTCCCGG - Intronic
1148148048 17:45378489-45378511 GCCAGCAGCCAGACTGGGAAAGG - Intergenic
1148769368 17:50057924-50057946 TGCTGGGGCCAGGCTGGGAAGGG - Intronic
1150690996 17:67366672-67366694 TGCCGCGGACAGCCTGGGGGTGG + Intergenic
1151064872 17:71137430-71137452 TGCATCAGCCAGCCTTTGAAAGG - Intergenic
1151502690 17:74501743-74501765 TGCAGCTGTAAGCCTGGGAATGG - Intergenic
1151794588 17:76335237-76335259 AGCCACAGCCAGCCTGGGTGTGG - Intronic
1152095530 17:78269696-78269718 AGCTGCAGCCAGGCCGGGAAGGG - Intergenic
1152324918 17:79630299-79630321 TGCCGTATCCAGTCTGGGCACGG - Intergenic
1152765324 17:82134182-82134204 TGCAACAGCCACCCTGGGAATGG + Intronic
1152938245 17:83152876-83152898 TGCCGCAGCCAGGCTGGCCGTGG + Intergenic
1153690223 18:7585036-7585058 TGCCAAGGCCAGCCTGGGGAAGG - Intronic
1155979874 18:32168902-32168924 TCCCGCACCCAGCCTGGCAGTGG + Intronic
1156234053 18:35183925-35183947 TTTAGGAGCCAGCCTGGGAACGG + Intergenic
1157281326 18:46348116-46348138 TGCGGCAGACATCCTGGGGAGGG + Intronic
1157858426 18:51121337-51121359 GGCCTCAGCCAGCCCAGGAAGGG + Intergenic
1158391969 18:57051535-57051557 GGCCCCAGCCTGCCAGGGAAGGG + Intergenic
1159235486 18:65667306-65667328 TGCCGCACCCTGCAGGGGAATGG + Intergenic
1160156074 18:76434731-76434753 TCCAGCTTCCAGCCTGGGAAAGG - Intronic
1160876056 19:1296688-1296710 AGCCGCACCCAGACTGGGTAGGG + Intronic
1161625544 19:5324486-5324508 AGCTGCCGCCAGCCTGGGACAGG - Intronic
1163885742 19:19963246-19963268 TGCCGGAGGCTGCCTGGGATGGG + Intergenic
1164428957 19:28170075-28170097 TGCCTCTTCCAGCCAGGGAAGGG - Intergenic
1166968853 19:46548589-46548611 TGCCGGAGCTACACTGGGAAGGG - Intronic
925853743 2:8109494-8109516 TGCTGCTGACAGCCAGGGAAAGG - Intergenic
925870545 2:8266073-8266095 TAGCACAGCCAGCCTGGGGATGG - Intergenic
926101768 2:10122582-10122604 CCCCGCGGCCAGCCTGGGTAGGG + Exonic
926202605 2:10812588-10812610 GGCCGCGGCCCGCCGGGGAACGG + Intronic
927714703 2:25343784-25343806 TGGCGCACCCAGCTTGGCAAAGG + Intergenic
932702736 2:74002505-74002527 TGCCCCAGCCTGCCGGGGAGCGG + Intronic
933151371 2:78919177-78919199 TGCAGAAGCCAGCCTGGGCTGGG + Intergenic
935129913 2:100253966-100253988 TGCAGCAAGCAGCCTGGGACAGG - Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
938581298 2:132648868-132648890 TGGAGCGGCCAGCCTGGCAATGG - Intronic
940342712 2:152598398-152598420 CACCGCACCCAGCCTGAGAATGG - Intronic
940640828 2:156342649-156342671 GGCCGCGGGCGGCCTGGGAAGGG - Intergenic
941183331 2:162288264-162288286 TTGCCCAGCCAGCCTTGGAAGGG - Exonic
941470538 2:165880173-165880195 TGCAACATCCAGCCTGGGACTGG + Intronic
942193978 2:173498791-173498813 TGCTCCAGCCAGCATGGAAAGGG + Intergenic
945285575 2:208078276-208078298 TGCCGCAGCCACCTTGGGGGAGG - Intergenic
945379710 2:209125673-209125695 TACCTCAGCCAGCCTAGGAGAGG - Intergenic
946047247 2:216831439-216831461 TGGAGGAGCCAGCCTGGGCAGGG + Intergenic
948321238 2:237071575-237071597 TGCCAGAGACAGCCTGGAAATGG - Intergenic
948419660 2:237849158-237849180 GGCGGCAGCGAGGCTGGGAAGGG - Intergenic
948430780 2:237917396-237917418 GGCCACAGACAGCCTGGGAGCGG + Intergenic
948603673 2:239121503-239121525 ATCCGCAGCCAGCCGGGGAAGGG - Intronic
1168858851 20:1030279-1030301 GGGCTCTGCCAGCCTGGGAAAGG - Intergenic
1169073558 20:2748709-2748731 TGACCCTGCCACCCTGGGAAAGG + Intronic
1171518974 20:25761204-25761226 GGCTGCAGCCAGGCAGGGAAAGG - Intergenic
1172701688 20:36857086-36857108 TGCCTGGGCCAGCCTGGCAAGGG + Intronic
1173524170 20:43719421-43719443 TGCTGCGGTCAGCCTGGGAGAGG + Intergenic
1173638374 20:44581024-44581046 TGCCGCAGCCAGCCTGGGAAAGG - Intronic
1173754141 20:45500113-45500135 TGCTGCTGCCAGCCTGGGACTGG + Intergenic
1173907068 20:46637160-46637182 TGCCCCAGGCATCCTGGGAGGGG + Intronic
1174830696 20:53809432-53809454 GGCAGCAGGCTGCCTGGGAAGGG + Intergenic
1176125227 20:63472079-63472101 CGCCGCAGCCAGCCTGGCCGGGG + Intronic
1179017105 21:37603416-37603438 TGCCCCTGCCAGCCTTGGCAGGG + Intergenic
1179164915 21:38927798-38927820 TGGGGCAGCCAGTCTGGAAATGG - Intergenic
1180848017 22:18995023-18995045 GGTGGCAGCCAGCCTGGGAGTGG + Intergenic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1181077717 22:20392776-20392798 GGCCGCAGCCAGCCCAGGAAGGG + Intergenic
1181636003 22:24175207-24175229 GGCCTCAGCCAGCCTGGGGCAGG + Intronic
1181807582 22:25384374-25384396 TGCAGGAGCCAGGCTGGGAGGGG - Intronic
1182391742 22:30003062-30003084 TGCTGCTGCTAACCTGGGAAGGG + Intronic
1182740938 22:32567085-32567107 TGCCACAGTGAGACTGGGAAAGG + Intronic
1183210804 22:36449998-36450020 ATCCGAAGCCAGCCTGGCAAGGG + Intergenic
1183479772 22:38057166-38057188 CGCCGCCGCCATCTTGGGAAGGG - Intronic
1184258783 22:43302633-43302655 TGACAGAGCCAGGCTGGGAACGG + Intronic
1185029248 22:48433037-48433059 TGCAGCACACAGCCTGGGAGGGG + Intergenic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1185366956 22:50441168-50441190 CGCCTCAGCCAGCCTCTGAAGGG - Intronic
949928789 3:9061829-9061851 TGGCTAAGCCAGCCTGGGAATGG + Intronic
952898883 3:38096755-38096777 TGCCTCGGCCAGCCTAGGCAGGG - Intronic
953556724 3:43951978-43952000 TGCCCCAGCAATTCTGGGAATGG + Intergenic
953636978 3:44672065-44672087 GGCTTCAGCCAGCCTGGGTAAGG + Intergenic
954302368 3:49706707-49706729 TCCTGCAGGCAGCCTAGGAAGGG - Intronic
955824088 3:62926653-62926675 TGCTGCAGCCATCCAGAGAATGG + Intergenic
956690698 3:71875535-71875557 TGCTGCAGCCTGCCTGGGGATGG - Intergenic
961464136 3:127071319-127071341 AGCCGCAGTCATCCTGAGAAGGG + Intergenic
962266064 3:133945130-133945152 TGCTGCAGCCGGCATGGCAAGGG + Exonic
964548195 3:157858373-157858395 TGGAGCTTCCAGCCTGGGAAAGG + Intergenic
967896046 3:194396970-194396992 TGCCGCAGCCACCCCAGGAAGGG + Exonic
967963073 3:194940668-194940690 TGCAGCAGCCTGCTTGGGAGTGG + Intergenic
968073776 3:195804640-195804662 TGCCCGAGGCAGCCTGGCAAGGG - Intronic
968261012 3:197324155-197324177 GGCAGGAGCCAGGCTGGGAATGG + Intergenic
968659607 4:1793631-1793653 TGCAGCAGCCAGGGAGGGAAGGG + Intronic
969243860 4:5919672-5919694 TGCAGCAGCCAGCCTCGCAAAGG - Intronic
969308588 4:6339460-6339482 AGCCTCAGCCAGCCTGGGGGTGG + Intronic
969694431 4:8726548-8726570 TGCCCCAGCCAGCCTGAGCCTGG - Intergenic
969706317 4:8794146-8794168 TGGAGCAGCCGGCCTGGGAGGGG - Intergenic
970182544 4:13415340-13415362 GGCCTCAGCCAGCCCAGGAAGGG - Intronic
973190367 4:47378473-47378495 AGCCTCAGCCAGCCCAGGAAGGG + Intronic
974299300 4:60042637-60042659 TGCCTCAGCCAGCCCAGGGAGGG + Intergenic
974945245 4:68519153-68519175 GGTTGCAGCCAGCCAGGGAAAGG + Intergenic
975665955 4:76735349-76735371 TTCCCCAGGCAGCTTGGGAATGG + Intronic
975898375 4:79121874-79121896 GGCCTCAGCCAGCCCAGGAAGGG - Intergenic
976899763 4:90158590-90158612 GGCGGCAGCCAGGCTGGGGAGGG - Intronic
976977269 4:91180518-91180540 GGCAGCAGCCAGGCTGGGGAAGG - Intronic
978565482 4:110077018-110077040 GGCCGCAGCGAGGCTGGGAGAGG + Intronic
978677519 4:111337362-111337384 TGCGGCAGCCAGGCTGGGGGAGG + Intergenic
979224131 4:118265490-118265512 GGCCTCAGCCAGCCCGGAAAGGG - Intergenic
979310527 4:119198067-119198089 GGCGGCAGCCTGGCTGGGAAGGG + Intronic
980181761 4:129409826-129409848 TGCCACAGCCAGCCTGCAACTGG - Intergenic
983786729 4:171741055-171741077 TTCAGCAGCCAGGCTTGGAAAGG + Intergenic
984466044 4:180101221-180101243 TACCGCAGGCAGGCTGGAAAAGG - Intergenic
985606960 5:862992-863014 TGCTGCAGGGAGGCTGGGAAAGG - Intronic
985629400 5:1006918-1006940 TGCCCCAGCCAGGTGGGGAAGGG - Intergenic
987318328 5:16745049-16745071 TACCGCGCCCGGCCTGGGAAAGG - Intronic
987899839 5:23997445-23997467 GGTTGCAGCCAGCCAGGGAAAGG + Intronic
991535602 5:67666540-67666562 AGCGGCAGCCAGGCTGGGGAGGG - Intergenic
992093246 5:73338273-73338295 TGCCGCTTCCATCCTGGAAAAGG - Intergenic
995392816 5:111657560-111657582 GGCTGCAGCCAGACTGTGAAGGG - Intergenic
997955487 5:138275492-138275514 TTCCACAGCCAGCCTGGCAGAGG + Intergenic
998424002 5:142012141-142012163 TGGCTCAGACAGCTTGGGAAGGG - Exonic
1000109536 5:158094635-158094657 TGCCACAGCCAGCCTAGGGGAGG - Intergenic
1000609097 5:163355811-163355833 AGCCTCAGCCAGCCCAGGAAGGG - Intergenic
1001426212 5:171624185-171624207 TGCCACAGCCACCCTGGGGTGGG + Intergenic
1001523511 5:172412719-172412741 TGCTGCAGACAGCCTGGGCCTGG - Intronic
1002174882 5:177396316-177396338 TGACGGAGCCAGGCTGAGAAAGG + Intronic
1003160005 6:3626386-3626408 TGCCGCAGGCAGCAAAGGAAGGG - Intergenic
1003388899 6:5695316-5695338 TGCCACAGCAAGCCAGGGACTGG + Intronic
1006002057 6:30972772-30972794 TGCTGCAGCCATCCTGTGACGGG + Intergenic
1006184848 6:32175846-32175868 TGCCGCAGCCTGGCTGGGGAGGG - Intronic
1006288986 6:33119797-33119819 TCCCTAAGCCAGGCTGGGAAGGG - Intergenic
1006921161 6:37628067-37628089 TGCTGCAGTCAGAGTGGGAAGGG - Intergenic
1007252317 6:40504144-40504166 TGCAACAACCAGCCTTGGAATGG - Intronic
1007383397 6:41504493-41504515 TCCCCCAGCCAGACTAGGAATGG + Intergenic
1007531593 6:42547735-42547757 TGCGGAGGCCAGCCTGGGCAAGG + Intergenic
1007701182 6:43767441-43767463 TGCAGCAAGCAGCCTGGGGAGGG + Intergenic
1010152989 6:72758082-72758104 TCCCCCAGGCAGCCAGGGAAGGG + Intronic
1010778233 6:79910956-79910978 TGCAGCAGCCAGTCTGTCAAAGG + Intergenic
1012247664 6:96943782-96943804 TGCCCCAGCCATCTGGGGAAGGG + Intronic
1012434884 6:99204700-99204722 GGCCGCAGCCAGGCTGGGGGAGG + Intergenic
1018860703 6:167708929-167708951 TGTCGCATTCAGGCTGGGAAGGG + Intergenic
1019561858 7:1663465-1663487 TGCCGCAGCCTCACTGGGACAGG - Intergenic
1019921096 7:4163690-4163712 AGCCGCAGCCTTCCTGGGCATGG + Intronic
1020212470 7:6166832-6166854 TGCCACCGCCAGCCTGGAACAGG + Intronic
1022027946 7:26466299-26466321 TGTTGCAGCCAGCCTGGCGAGGG + Intergenic
1022537342 7:31106398-31106420 TGGCACTGCCAGCCTGGGAAGGG + Intronic
1024031849 7:45468202-45468224 TGCAGCAGCCAGCCTGGGGGAGG - Intergenic
1024465847 7:49711196-49711218 GGCCGCGGCCAGCCCAGGAAGGG - Intergenic
1027819395 7:83024509-83024531 TGCAGCAGCCAGGCTGGGGGAGG + Intronic
1030046548 7:105502223-105502245 TCCTGCAGCCTGCCTGGCAAGGG - Intronic
1030102171 7:105956175-105956197 GGCCTCAGCCAGCCCAGGAAGGG + Intronic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1032388360 7:131539759-131539781 TGCAGCACCCAGACTGGGCACGG - Intronic
1034428628 7:151028555-151028577 GGTAGCAGCCTGCCTGGGAATGG - Exonic
1035877469 8:3206996-3207018 GGCCACAGCCAGCATGGTAAGGG - Intronic
1036580865 8:10074368-10074390 TGCCGCACCCAGCCTGTCTAAGG + Intronic
1036730200 8:11256186-11256208 TCTGGCATCCAGCCTGGGAATGG - Intergenic
1037615562 8:20515931-20515953 TTCCGCTGCCAGCGTGGGAGAGG + Intergenic
1038415686 8:27393599-27393621 TTCCGCAGCCTGGCTGGGCAGGG - Intronic
1038641598 8:29333514-29333536 TCCCTCAGCCAGGCTGGGACTGG + Exonic
1039322674 8:36449902-36449924 TGCTGGAGCCAGGCTGGGAAAGG - Intergenic
1040062296 8:43114323-43114345 GGCCGCAGCGAGCCTGGGGGAGG - Intronic
1041969988 8:63729501-63729523 GGCCTCAGCCTGCCTGGGAGTGG - Intergenic
1042944979 8:74145370-74145392 AGGTGAAGCCAGCCTGGGAAAGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044746379 8:95375296-95375318 GGCGGCAGCCAGGCTGGGAGAGG - Intergenic
1044853047 8:96447633-96447655 TGCTGCCGCAGGCCTGGGAAAGG - Intergenic
1045040275 8:98217101-98217123 TGCAGCAGACAGGCTGGGAAAGG + Intronic
1045141667 8:99292217-99292239 TGCCTCAGCCAGCCTGTGAAAGG + Intronic
1047303619 8:123635788-123635810 TGCTGCAGGCAGCTGGGGAAAGG - Intergenic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1048908237 8:139109209-139109231 TTTCCCAGTCAGCCTGGGAATGG + Intergenic
1049564122 8:143329079-143329101 ATCCACAGCCTGCCTGGGAAGGG + Intronic
1049772724 8:144391208-144391230 TGCTGCCGCCAGCCTGGCACAGG + Exonic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1051339823 9:16100975-16100997 TGCTGCACACAGCCTGGGAACGG + Intergenic
1051367306 9:16330088-16330110 TGCCCCACCCTGCGTGGGAAGGG - Intergenic
1052903662 9:33816750-33816772 CTCCGCAGCCATCCTGGGACGGG - Intergenic
1052992921 9:34532273-34532295 TGCAGCAGCCAGGCTGGGGGAGG - Intergenic
1053119851 9:35538452-35538474 TGGGGCAGTCAGCCTGGGAGGGG - Intronic
1053382042 9:37656873-37656895 TTTAGCAGCCAGCTTGGGAAAGG - Intronic
1057132395 9:92663341-92663363 TGCCCCACACAGCCTGGGCATGG + Intronic
1059116138 9:111601224-111601246 CACAGCACCCAGCCTGGGAATGG - Intergenic
1060240215 9:121896792-121896814 TGCTGCGGCTAGCCTGGGAATGG + Intronic
1061408014 9:130403338-130403360 CCTGGCAGCCAGCCTGGGAAGGG + Intronic
1062514642 9:136926457-136926479 TCCCACAGCCAGCCTGGCCAAGG - Exonic
1187446698 X:19366819-19366841 GGCAGCAGCCAGTCTGTGAATGG - Intronic
1188985506 X:36765167-36765189 GGCTGCAGCCAGCCTAGGAGAGG - Intergenic
1192186712 X:68952102-68952124 GGCCTCAGCCAGCCCAGGAAGGG - Intergenic
1192805673 X:74506408-74506430 TGGGGCAGGGAGCCTGGGAAGGG + Intronic
1192941880 X:75921089-75921111 TGCTGCATTCAGACTGGGAAAGG + Intergenic
1195735869 X:108011830-108011852 GGCAGCAGCGAGGCTGGGAAAGG + Intergenic
1196828498 X:119758830-119758852 TGCATCAGCGTGCCTGGGAAGGG - Exonic
1198468067 X:136921372-136921394 TGCCTCAGCCAGCGCAGGAAGGG - Intergenic
1199585083 X:149406147-149406169 GGCTGCAGCCAACCTGAGAAAGG - Intergenic
1200001878 X:153066367-153066389 AGGGGCAGCCAGCCAGGGAATGG + Intergenic
1200005855 X:153083658-153083680 AGGGGCAGCCAGCCAGGGAATGG - Intergenic