ID: 1173639128

View in Genome Browser
Species Human (GRCh38)
Location 20:44587129-44587151
Sequence CAGGGTAAAGACACTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173639122_1173639128 28 Left 1173639122 20:44587078-44587100 CCATAAATGTACATTGAGGACCT 0: 1
1: 0
2: 1
3: 16
4: 170
Right 1173639128 20:44587129-44587151 CAGGGTAAAGACACTGCCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 212
1173639123_1173639128 8 Left 1173639123 20:44587098-44587120 CCTGTTAGTACTAAGCACTGAAC 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1173639128 20:44587129-44587151 CAGGGTAAAGACACTGCCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173639128 Original CRISPR CAGGGTAAAGACACTGCCTC TGG Intronic
901761999 1:11477841-11477863 CAGGGCAGGGACACTGGCTCAGG + Intergenic
902371340 1:16009008-16009030 CAGGATTAAGACTCAGCCTCCGG - Intergenic
902439292 1:16418817-16418839 CAGGGATAAGCCACTGCATCCGG + Intronic
906297094 1:44655522-44655544 CAGAGTAAAGAGACTTCCTCTGG - Intronic
906507880 1:46393691-46393713 CAGGGGAAGGACACAGCATCAGG - Intergenic
907728074 1:57038961-57038983 GTGGGTAAAGCCTCTGCCTCTGG + Intronic
908149037 1:61280837-61280859 ATGGGTAAAAACTCTGCCTCTGG + Intronic
912376016 1:109210508-109210530 CTGGGTGAAGATACTGCCTTGGG - Intergenic
915090378 1:153419890-153419912 CAGGGAAAGGACACTGCCCCTGG - Exonic
916526217 1:165611896-165611918 CAGGGTAGAGCCACTGCGCCCGG - Intergenic
917238068 1:172916132-172916154 AAGGATAAAGACACTGCTTAGGG + Intergenic
917543401 1:175937137-175937159 AAGGGTAAGGACACTGCATGGGG + Intergenic
918530506 1:185515280-185515302 AAGGTAAAAGACACTTCCTCTGG + Intergenic
918738867 1:188102354-188102376 CAAGGTCAAGAGAGTGCCTCTGG + Intergenic
918972784 1:191441297-191441319 CAAGATACAGACACTGCCTATGG - Intergenic
920347110 1:205313592-205313614 CTGGGGAGAGACACTGCCTAGGG + Intronic
1064159346 10:12930624-12930646 CAGGGCAATGACATTGCCACCGG - Intronic
1065398777 10:25271915-25271937 CAGGCATAAGCCACTGCCTCTGG + Intronic
1066262307 10:33740915-33740937 CAGGGTAAAGAGACAACCTATGG + Intergenic
1066397501 10:35040618-35040640 CAGGGCAAAGTCACAGACTCAGG + Intronic
1066486789 10:35853589-35853611 GACAGTAAAGTCACTGCCTCTGG + Intergenic
1067094989 10:43294412-43294434 CAGGGTCGAGAAACTGCTTCCGG + Intergenic
1067227135 10:44383626-44383648 CAGTGTGCAGACACAGCCTCAGG + Intronic
1067307783 10:45081163-45081185 GACAGTAAAGCCACTGCCTCTGG + Intergenic
1069585518 10:69598421-69598443 CAGGAGAGAGCCACTGCCTCTGG - Intergenic
1073291040 10:102413453-102413475 CAGGCTAAAGACTCTGCCAAGGG + Intronic
1073350892 10:102819061-102819083 CAGGGTACATGCACAGCCTCTGG - Intergenic
1076189761 10:128474860-128474882 CAGGGTCAAGACCCAGCCCCAGG + Intergenic
1077396119 11:2323025-2323047 CAGAGTAAACACACAGCCTAAGG + Intergenic
1077995055 11:7445820-7445842 CACTGTATAGACAGTGCCTCTGG - Intronic
1078029288 11:7733032-7733054 CAGGGTAAACAGACAACCTCAGG + Intergenic
1078983109 11:16561262-16561284 GAGGGTAGATCCACTGCCTCTGG + Intronic
1079553367 11:21729554-21729576 CAGGGTAATGGGATTGCCTCTGG + Intergenic
1079626940 11:22627484-22627506 CAGGCATAAGCCACTGCCTCCGG - Intronic
1080789825 11:35512374-35512396 CAGGGTAAATAAATTGCCCCAGG + Intronic
1080885299 11:36362483-36362505 TGGGGTAAAGATACTGTCTCCGG - Intronic
1081872639 11:46390575-46390597 CAGGGGCTAGACAGTGCCTCTGG - Intergenic
1082981391 11:59126447-59126469 CAGGGTAAACACACAACCTACGG + Exonic
1083038335 11:59661361-59661383 CAGGCTTGAGCCACTGCCTCTGG + Intronic
1083922875 11:65789938-65789960 CAGGGGAAAGATTCTGCCCCGGG - Intronic
1085095840 11:73760382-73760404 CAGGGTAAAAACTCGGCCACTGG + Intronic
1088797394 11:113274930-113274952 CCAGGTAAAAACACAGCCTCTGG + Intronic
1089435287 11:118459970-118459992 CAGGCTTGAGCCACTGCCTCAGG + Intronic
1089518109 11:119046480-119046502 CAGGGGTAAGACATAGCCTCAGG + Intronic
1090228344 11:125084904-125084926 CAGGGGAAAGGCACTGCCTTGGG + Intronic
1090733693 11:129593076-129593098 CAGGCTATACTCACTGCCTCTGG + Intergenic
1092913635 12:13170379-13170401 CAGGTTGAATACACTGCTTCTGG - Intergenic
1093778049 12:23100167-23100189 CAGGGCAAAGGCCCTGCCTTGGG + Intergenic
1093935652 12:24997308-24997330 CAGGTGAAAGACACTGCACCTGG + Exonic
1095054392 12:37582340-37582362 CAGGGTCAAGAGAGTGCATCTGG - Intergenic
1096411524 12:51380047-51380069 CAGGAAAGAAACACTGCCTCCGG - Intronic
1098454386 12:70655932-70655954 CAGGTGAAAGGCACTGCATCTGG - Intronic
1101111280 12:101488693-101488715 CAGAGTAAAGAGACAGCCTATGG - Intergenic
1104309787 12:127644096-127644118 AGGGTTAAAGACACAGCCTCAGG + Intergenic
1104495054 12:129229172-129229194 CAGGGTAAACACTCAGCTTCGGG + Intronic
1107568049 13:41626968-41626990 CAGGGTAAAGAGACAACCTATGG + Intronic
1109121455 13:58462543-58462565 AGGGGAAAAGACACTACCTCTGG - Intergenic
1110455194 13:75683657-75683679 AAGGTTAAGGACACAGCCTCAGG + Intronic
1110619718 13:77581786-77581808 CAGGTTAAAGGGACTGTCTCTGG + Intronic
1111594690 13:90396550-90396572 CCAGGTGAAGACACTGCCTCTGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1114568686 14:23650529-23650551 CAGTGAATACACACTGCCTCAGG - Intergenic
1114712079 14:24788894-24788916 CAGTGTAAAGCCACTTCCTAAGG + Intergenic
1115316480 14:32029938-32029960 CTGGGTAAAGACACAGGCTCGGG + Intergenic
1115613910 14:35074762-35074784 CAGGGGTAAGCCACTGCATCTGG - Intronic
1117625607 14:57634625-57634647 CAGGGGCCAGATACTGCCTCAGG + Intronic
1117691118 14:58307540-58307562 CAGGTTAGAGCCACTGCATCTGG - Intronic
1119807402 14:77491182-77491204 CATGTTCATGACACTGCCTCAGG + Intronic
1121031822 14:90664728-90664750 CATGGTAAAGGCACTGGTTCTGG + Intronic
1121315978 14:92961238-92961260 CAGGGCAAAGACAAGGCCCCAGG + Intronic
1122473668 14:101990595-101990617 CAGGGGTAAGCCACTGCGTCTGG - Intronic
1122771107 14:104098370-104098392 TTGGGTAAAGCCACTGCCCCAGG - Intronic
1124714272 15:32044683-32044705 CTGGGGAGAGACACTGCCCCTGG - Intronic
1125907449 15:43406299-43406321 CAGGTTATAGTCACTGCATCTGG + Exonic
1125975078 15:43944162-43944184 CAAGGTTAAGGCACTGCATCTGG + Intronic
1127843695 15:62851185-62851207 CAGGGGGAAGACATTTCCTCGGG + Intergenic
1128145752 15:65331663-65331685 CAGGGGAGAGAGACAGCCTCAGG + Intronic
1128198896 15:65787697-65787719 CAGGAAAAAGATACTGCCTAAGG + Intronic
1129139238 15:73582114-73582136 CAGGCTCAAGACACTGCGCCTGG + Intronic
1130105122 15:80923170-80923192 CTGGGAAATGACACTGCCTGGGG - Intronic
1131189791 15:90305257-90305279 CAGGGAATAGACACTACCTTAGG + Intronic
1133936924 16:10276906-10276928 CAGGCAAACGCCACTGCCTCCGG - Intergenic
1135262974 16:20997385-20997407 CATGGTCAATCCACTGCCTCAGG + Exonic
1137334032 16:47530427-47530449 CAGGGGAAAGCCACTGCGCCTGG + Intronic
1138228212 16:55317200-55317222 AAGGGTTAAGCCACTGGCTCAGG - Intergenic
1143288814 17:5812933-5812955 AAGGTTAAGGACACAGCCTCAGG - Intronic
1145740674 17:27271623-27271645 CAGGGGTAAGCCACTGCATCTGG + Intergenic
1146696553 17:34913047-34913069 CATGGGAAAGACACTGCCCTTGG + Intergenic
1147202394 17:38811680-38811702 CAGGGTTAAGACCCTTCCCCTGG - Intronic
1149121216 17:53168076-53168098 AAGCGTAAAGACACAGCCTTCGG + Intergenic
1149635518 17:58165724-58165746 CAAAATAAAGACTCTGCCTCTGG - Intergenic
1151535658 17:74737486-74737508 GAGGGTCAGGACACAGCCTCTGG + Intronic
1152473075 17:80500936-80500958 AAGGGTGAAGGGACTGCCTCCGG + Intergenic
1152605715 17:81288715-81288737 CAGGGGAAGGACACAGCCACTGG + Intronic
1153774163 18:8438206-8438228 CAGAGTAAAGACATGGCCTTGGG - Intergenic
1153980744 18:10307464-10307486 CAAGGTAAAGGGACTGCATCTGG - Intergenic
1155088551 18:22482996-22483018 CAGGGATAAGTCACAGCCTCTGG + Intergenic
1155747186 18:29370996-29371018 CAGGCTTAAGACACTGCATCTGG + Intergenic
1156951168 18:42899839-42899861 CAAGGTAAAGAAGCAGCCTCAGG + Intronic
1157076245 18:44470925-44470947 CAGAGTAAAGAAAATGCCTTGGG + Intergenic
1157592682 18:48845047-48845069 TAGGGGAAAGACACTGGCACAGG - Intronic
1157968020 18:52231001-52231023 AAGGGTAAAGGTACAGCCTCTGG + Intergenic
1158561154 18:58514975-58514997 CAGGGTAAACACACTTACTCAGG + Exonic
1158791715 18:60787966-60787988 GAGGGTAAAGTTACTGACTCAGG + Intergenic
1165815351 19:38638680-38638702 CAGGGGAAAAGCACTGCCTAAGG - Intergenic
1167151318 19:47711907-47711929 CAGGGCAAAGACAGTCCCTTAGG + Intergenic
926233175 2:11020172-11020194 CAAGGTCAAGAGGCTGCCTCTGG + Intergenic
929666683 2:43838974-43838996 CAGAGTGAAGACACTGGCCCTGG + Exonic
930196058 2:48511582-48511604 CAGGCTTAAGCCACTGCCCCTGG - Intronic
932789265 2:74639483-74639505 CTTTGTAAAGACACTGCCCCTGG + Intronic
934528969 2:95073347-95073369 CAGGGGTAAGCCACTGCATCTGG + Intergenic
937245934 2:120493155-120493177 CAGGGTATACACATTGCCTTTGG + Intergenic
939906953 2:147928367-147928389 CTGGGTAACGACACTTCCTGAGG - Exonic
942141963 2:172985809-172985831 CTGGGAAAAGGTACTGCCTCAGG - Intronic
942872104 2:180747506-180747528 CTGTGTAAGGACACTGCTTCGGG + Intergenic
942947983 2:181690242-181690264 AAAGGTTAAGACACTGCCACAGG - Intergenic
944299419 2:198106217-198106239 CAGGTTAAAGACACAGGGTCTGG - Intronic
946104357 2:217356124-217356146 CAGGCTAAAGATACAGACTCAGG + Intronic
948308189 2:236965537-236965559 CAGGTCAAAAACACGGCCTCAGG - Intergenic
948726775 2:239939019-239939041 CGGCGGAAAGACGCTGCCTCAGG + Intronic
948790741 2:240375423-240375445 CAGGGTAAAGCCGCTGAGTCAGG + Intergenic
1169771369 20:9204725-9204747 CATGTTAAAGAGACTGCCACTGG + Intronic
1172043819 20:32064889-32064911 CCTGGTAAAGATACTTCCTCGGG - Intronic
1172396343 20:34608727-34608749 CAGGGTACAGCCACTCACTCTGG + Intronic
1173639128 20:44587129-44587151 CAGGGTAAAGACACTGCCTCTGG + Intronic
1174691687 20:52512473-52512495 CAGGGAAAGGACACTGACTTGGG - Intergenic
1177381249 21:20347247-20347269 CAGAGCAAAGACACTGACTTTGG - Intergenic
1178741051 21:35201636-35201658 CAGGCTCAAGACCCTCCCTCTGG + Intronic
1179320348 21:40285450-40285472 CAGGGTAATTACACTTCCTTAGG + Intronic
1179419204 21:41222472-41222494 CAGGGGAAAGGCCCTGCCCCTGG + Intronic
1179842866 21:44088623-44088645 TAAGGGAAAGACACTTCCTCAGG - Intronic
1180070595 21:45434178-45434200 CCCGGTGAAGCCACTGCCTCTGG - Intronic
1182934458 22:34207949-34207971 CAGGCTTAAGCCACTGCATCTGG + Intergenic
1183191174 22:36322862-36322884 CAGGGTGGAGACACTGTCCCAGG - Intronic
1183684700 22:39354986-39355008 CAGGGTAGAGACAGAACCTCTGG + Intronic
1184148167 22:42623542-42623564 CCGGGAAAGGACTCTGCCTCTGG + Intronic
950607441 3:14095556-14095578 CAGGATTAAGCCACTGCATCTGG - Intergenic
951682668 3:25310822-25310844 CAGAGTAAAAACACTGACACGGG - Intronic
951908277 3:27724193-27724215 CAGGGTCAAGGCACAGCCACAGG + Intergenic
952963224 3:38605786-38605808 CTGGGTAAAGCCAGTGCCTGTGG - Intronic
954044318 3:47916464-47916486 CAGGGACATGACACTGCCCCCGG - Exonic
954099746 3:48360785-48360807 CATGGGAAAGACCCGGCCTCAGG - Intergenic
954401990 3:50323779-50323801 CAGGGCAGGGACACTTCCTCAGG + Intronic
956213932 3:66828603-66828625 AAGGGTAAAGTCTCTGCCTGTGG + Intergenic
956765714 3:72482698-72482720 ATGGTTAAAGACACGGCCTCTGG + Intergenic
960611123 3:119555639-119555661 CAGGGCACAGGCACTGCCTGAGG - Intronic
961742242 3:129040127-129040149 CAGGGGAAAGATACAGCATCAGG - Exonic
962116181 3:132510498-132510520 CAGGTTCAAGCCACTGCCCCTGG + Intronic
965013014 3:163121269-163121291 CAGGTTAAAAACACAGCCTTAGG + Intergenic
965867934 3:173228401-173228423 CAGGCATAAGCCACTGCCTCTGG - Intergenic
966439418 3:179927288-179927310 CAGGGTAAAGACAGAGGCTGTGG + Intronic
969929900 4:10620800-10620822 GAGGGTAAAAACTCTACCTCAGG + Intronic
974423586 4:61710457-61710479 CAGGTAAAAGACAATGGCTCTGG - Intronic
974671390 4:65034790-65034812 CAGGAAAAAGCCAATGCCTCTGG + Intergenic
974731619 4:65873941-65873963 CAGTGTAAAGACAGAGCCTACGG - Intergenic
975324531 4:73044372-73044394 CAAGGTAAATACATTGCCACGGG - Intergenic
975863052 4:78698418-78698440 CAGGCTTGAGACACTGCCCCTGG - Intergenic
980353582 4:131715450-131715472 CAGTGTAAAGACAGTGCCCAAGG - Intergenic
982094810 4:151912121-151912143 CAGGGTAATGGCTCAGCCTCAGG - Intergenic
983634539 4:169883648-169883670 CAGGGTCAAGGGACTGCATCTGG - Intergenic
984647779 4:182238113-182238135 CAGGGTGAAGAAACAGTCTCAGG + Intronic
986982961 5:13470018-13470040 CAGGGTAAAGAGACTGAAACAGG + Intergenic
989229408 5:39069516-39069538 CAGGGTAAAGACAGTAAGTCTGG + Intronic
990734397 5:58844331-58844353 CTGGCTAAAGACACAGACTCAGG + Intronic
990920971 5:60966313-60966335 CAGAGTAAAGACACAACCTTTGG - Intronic
994493057 5:100473054-100473076 CAGAGTAAAGACACAGCCTATGG - Intergenic
998379373 5:141713117-141713139 CAGGGAAAAGAGAAGGCCTCTGG - Intergenic
1000298074 5:159929514-159929536 CAGAATAAAAACCCTGCCTCGGG + Intronic
1002791527 6:441014-441036 AAGAGTAAAGACAGTGCCACTGG - Intergenic
1003832017 6:10021990-10022012 CAGTGTAATGTCACTTCCTCTGG + Intronic
1005328507 6:24725606-24725628 CAGGCTAGAGACACTGCACCCGG - Intergenic
1005452565 6:25987950-25987972 CGGAGTAAAGTCCCTGCCTCCGG - Intergenic
1006824571 6:36925212-36925234 CAGGGTAAGGACACTGCAGAAGG - Intronic
1008295825 6:49775405-49775427 CAGGGTATGGAGACAGCCTCAGG + Intergenic
1010031896 6:71279935-71279957 CAGGGTAGAGAGGCTGCCTTCGG - Intergenic
1017838541 6:158202513-158202535 CAGGGTTGAGCCACTGCGTCCGG - Intergenic
1018741114 6:166729263-166729285 CAGGGAACGCACACTGCCTCAGG + Intronic
1020036796 7:4968689-4968711 CAGGGAAAGGAGACTGGCTCAGG - Intergenic
1020526955 7:9274380-9274402 CAGGGGAAAGTCACTCCCTTGGG - Intergenic
1022234083 7:28444549-28444571 CAGGGGAAAGACTCTTCCACTGG + Intronic
1022568417 7:31427116-31427138 CAGGTTAGAGACACAGTCTCAGG - Intergenic
1022864520 7:34404060-34404082 CAGGGGAAAGCCACAGCCTGAGG + Intergenic
1023561469 7:41477760-41477782 CAGTGCAAACACACTGCCCCTGG - Intergenic
1025968635 7:66300666-66300688 CAGGTTTAAGACACTGCACCTGG - Intronic
1026356177 7:69559375-69559397 CAAGGTAGAGGCACAGCCTCAGG - Intergenic
1026836824 7:73645303-73645325 CAGGCTTGAGCCACTGCCTCTGG + Intergenic
1031413911 7:121472863-121472885 AATTTTAAAGACACTGCCTCAGG - Intergenic
1032097466 7:128946736-128946758 CAGGGTAATGACAATGCCCTGGG - Intronic
1035892232 8:3357558-3357580 CAGTGTAAAGATAATGACTCTGG + Intronic
1036652422 8:10653936-10653958 AGGAGCAAAGACACTGCCTCAGG - Intronic
1037699793 8:21263859-21263881 CAGGATGAAGACACTGTCTGTGG - Intergenic
1039148706 8:34479314-34479336 CAGCCTCAAGACACTGCCTCCGG - Intergenic
1041126372 8:54644343-54644365 GAGGGTAAAGCCACTGCCCTTGG - Intergenic
1042408452 8:68433608-68433630 CAGGTTAAAAACCCTGGCTCTGG - Intronic
1042525355 8:69758918-69758940 CTGGGAAAAGAAACTGACTCCGG - Intronic
1043084649 8:75813561-75813583 CAGGGTAAATATTCTGACTCAGG - Intergenic
1043351247 8:79363199-79363221 TAGGGGAGAGACACTGCATCTGG + Intergenic
1047313109 8:123708788-123708810 CAAGGAACAGACACTGCCCCGGG - Intronic
1048159020 8:131994224-131994246 CAGAGAAGAGACACTGTCTCAGG + Intronic
1049147986 8:141016012-141016034 CAAGGTTAAGAGACTGCCTAGGG + Intergenic
1052458204 9:28728187-28728209 CCTGGGAAAGAAACTGCCTCTGG + Intergenic
1057359219 9:94357996-94358018 CAAGGTTAAGGGACTGCCTCTGG - Intergenic
1057648542 9:96899594-96899616 CAAGGTTAAGGGACTGCCTCTGG + Intronic
1057880184 9:98787240-98787262 CAGGGCCAACACACTCCCTCAGG + Intronic
1057952707 9:99382653-99382675 CAGAGAAAGGACACTGGCTCAGG + Intergenic
1059215736 9:112560341-112560363 CAGGTTCATGCCACTGCCTCTGG + Intronic
1059352272 9:113673851-113673873 CAGGGCACAGACTCTGCCTTAGG - Intergenic
1061067645 9:128288565-128288587 CAGGGCAGTGACACTGGCTCGGG + Intronic
1061426298 9:130500521-130500543 CAGGGACAAGAGACTGGCTCTGG - Intronic
1062058655 9:134482710-134482732 AAGGGCAAAAACACAGCCTCTGG - Intergenic
1062142759 9:134968875-134968897 CAGGACAAAGACACTTCCTGAGG + Intergenic
1062231172 9:135482078-135482100 TAGTGTAAAGACACTGACTTGGG + Intronic
1062246334 9:135568796-135568818 CAGAGGAAAGAAACTGCTTCAGG + Intergenic
1186414194 X:9369349-9369371 CAGGGAAAAGGCACTGCCTGTGG + Intergenic
1189884656 X:45529027-45529049 CAGGGTATAGGAGCTGCCTCTGG - Intergenic
1191784937 X:64907250-64907272 CAGGGAAATGACACTGACTCAGG - Intergenic
1193040980 X:77003457-77003479 CATGGTAAAGACCATGCCACGGG - Intergenic
1193139902 X:78016821-78016843 CAGGGTACAGCCCCTGCCACTGG + Intronic
1195069821 X:101267964-101267986 CAGGGCAAACAAACTCCCTCGGG - Intergenic
1196287139 X:113896123-113896145 GAGGATAAAGACTCTACCTCGGG + Intergenic
1196326022 X:114403888-114403910 CAGAGTAAATACAGTGCATCTGG - Intergenic
1196746655 X:119077169-119077191 CAGGGTTAATTCACTGGCTCGGG + Intergenic
1197080361 X:122406050-122406072 TAGGGTAAAAACACTGGCTTTGG - Intergenic
1200090801 X:153635077-153635099 CTGGGCAAGGACACTTCCTCTGG + Intergenic