ID: 1173640742

View in Genome Browser
Species Human (GRCh38)
Location 20:44600236-44600258
Sequence GCTCATCTGCAGAGGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 382}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173640735_1173640742 29 Left 1173640735 20:44600184-44600206 CCAGTGTGACCAGAGCAAAATGG 0: 1
1: 0
2: 3
3: 33
4: 474
Right 1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG 0: 1
1: 0
2: 3
3: 63
4: 382
1173640737_1173640742 20 Left 1173640737 20:44600193-44600215 CCAGAGCAAAATGGACCAAGAAG 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG 0: 1
1: 0
2: 3
3: 63
4: 382
1173640734_1173640742 30 Left 1173640734 20:44600183-44600205 CCCAGTGTGACCAGAGCAAAATG 0: 1
1: 0
2: 3
3: 13
4: 183
Right 1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG 0: 1
1: 0
2: 3
3: 63
4: 382
1173640738_1173640742 5 Left 1173640738 20:44600208-44600230 CCAAGAAGAGAGTAGAAATGAGA 0: 1
1: 0
2: 1
3: 41
4: 406
Right 1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG 0: 1
1: 0
2: 3
3: 63
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173640742 Original CRISPR GCTCATCTGCAGAGGCAGGC AGG Intronic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900093465 1:930546-930568 GCTCACTGGCAGAGGCAGGTTGG + Intronic
900939186 1:5786906-5786928 GCTGGTGTGCAGAGGAAGGCAGG - Intergenic
903066863 1:20704463-20704485 GCTCATCTGCTGTGTCAGGATGG + Exonic
903182811 1:21613579-21613601 GCCCATCTGCGGAGCCAGCCCGG + Intronic
903329824 1:22591650-22591672 GGTGCTCTGGAGAGGCAGGCAGG - Intronic
903606721 1:24580325-24580347 CCCCGTCTGCAGAGGCAGCCAGG - Intronic
903925054 1:26826305-26826327 AGGCATTTGCAGAGGCAGGCAGG - Intergenic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904082229 1:27879546-27879568 GGTCATCTGCAGGGCCAGACTGG + Intronic
904562687 1:31409359-31409381 GATCATGTGCAGAGCCAGGGTGG - Intergenic
905106682 1:35567344-35567366 GCTCATCTGCTGAAGCTTGCAGG - Intergenic
905279380 1:36839186-36839208 TGTCATTTGCAGAGGCAAGCTGG - Intronic
905570171 1:38997602-38997624 GCTACTCTGCAGGGGGAGGCGGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906322737 1:44827077-44827099 GGTCAGCTGCAGAGGCAGAGAGG + Exonic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
908962514 1:69715224-69715246 GTTCATGTCCAGAGTCAGGCAGG - Intronic
911517170 1:98881209-98881231 GGTGGTCTACAGAGGCAGGCGGG + Intergenic
912587254 1:110778355-110778377 TGTCATCTGAAGAGGTAGGCAGG + Intergenic
913937124 1:125065377-125065399 CCTCATCTGTTGAGGCAGGCAGG + Intergenic
914800144 1:150955461-150955483 GCAAGTCTCCAGAGGCAGGCTGG - Intronic
915469121 1:156115217-156115239 GCTCAGCTCCAGCTGCAGGCGGG - Exonic
915601116 1:156923932-156923954 ACTCCTCTGCGGGGGCAGGCAGG - Exonic
918072571 1:181143698-181143720 GCACCACTTCAGAGGCAGGCTGG - Intergenic
919759982 1:201091787-201091809 GCAGGCCTGCAGAGGCAGGCAGG + Exonic
920275534 1:204801742-204801764 GCTCATCTGCAGGGGTCAGCAGG - Intergenic
921047917 1:211490503-211490525 GCTTCACTGCAGGGGCAGGCTGG + Intronic
921982484 1:221273664-221273686 ACTCCACTGTAGAGGCAGGCAGG - Intergenic
922397500 1:225217501-225217523 TGGAATCTGCAGAGGCAGGCAGG + Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
924456143 1:244220125-244220147 GCTCATCTGCAGGTTCAGGAAGG + Intergenic
1062776234 10:150628-150650 GGTGGTCTACAGAGGCAGGCAGG - Intronic
1063260621 10:4385384-4385406 ACTCATCTCTAGAGGAAGGCAGG - Intergenic
1064011280 10:11738411-11738433 ACTCTTCTGCAGAGGCTGTCCGG + Intergenic
1064477345 10:15705428-15705450 TTTCATCTGCAGTGGCAGGAGGG - Intronic
1066409082 10:35148441-35148463 GCTCATGTGCAGACTCAGACTGG + Exonic
1067182018 10:43995366-43995388 ACCCATGTGCAGAGGAAGGCGGG + Intergenic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1067450378 10:46378387-46378409 GCTCAGCTTCTGAGTCAGGCTGG + Intronic
1067586867 10:47481376-47481398 GCTCAGCTTCTGAGTCAGGCTGG - Intronic
1067633922 10:47989143-47989165 GCTCAGCTTCTGAGTCAGGCTGG - Intergenic
1067744795 10:48927649-48927671 GCACATGTGCAGAGCCACGCTGG - Intronic
1069587930 10:69620945-69620967 GCCCAGCTGCAGAAACAGGCAGG + Intergenic
1069591596 10:69645367-69645389 CCTCATCTGCAGAGGCAAACAGG + Intergenic
1069750740 10:70743744-70743766 GCTCATCTTCCCAGGCAGGAGGG - Intronic
1069753218 10:70758075-70758097 GCTCACCTCCACAGGCGGGCAGG - Exonic
1070437452 10:76407066-76407088 GCTCATATGCACAGGAAGGATGG + Intronic
1070761657 10:79027865-79027887 GCTCAGCTTCTGAGGCAGGCAGG - Intergenic
1070835762 10:79445892-79445914 GCTCATCTGCATATGCAGCACGG + Intergenic
1070921071 10:80186708-80186730 CCTGGTCTGGAGAGGCAGGCAGG - Intronic
1071549013 10:86551758-86551780 ATTCATGTGGAGAGGCAGGCTGG - Intergenic
1071894556 10:90051488-90051510 GGCCATCTGCACAGCCAGGCAGG - Intergenic
1073168965 10:101485444-101485466 GCAGATCTGCAGAGAAAGGCAGG + Intronic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1074293681 10:112161666-112161688 GCTCCTCTACAGACACAGGCAGG - Exonic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075833173 10:125428407-125428429 CCTCATCTGCCCAGACAGGCGGG + Intergenic
1076293061 10:129362310-129362332 GCTCTTCTGCAGACTCAGGTAGG + Intergenic
1076423557 10:130351431-130351453 ACTCGTCAGAAGAGGCAGGCAGG - Intergenic
1076426090 10:130368604-130368626 GCCTATTTGCAAAGGCAGGCTGG - Intergenic
1076767110 10:132642192-132642214 GCCCATCTGCAGAGGAGGCCTGG + Intronic
1077029928 11:460761-460783 GTTTATCTCCACAGGCAGGCAGG + Intronic
1077242640 11:1518588-1518610 GCTCGTCTGCACAGCCAGCCGGG + Intergenic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1078774435 11:14381380-14381402 GCTCCGCTGCAGCGGCACGCGGG - Intergenic
1081199672 11:40201050-40201072 GCTCATGTGCACATGCATGCAGG + Intronic
1081711291 11:45217678-45217700 GCTCATCTGGAGAGCCTGGGAGG - Intronic
1083719786 11:64598540-64598562 GCTCCTCACCACAGGCAGGCTGG + Exonic
1083730198 11:64648663-64648685 GGCCAGCTGCAGAGGCAGACCGG - Intronic
1083856144 11:65394024-65394046 GCTCATCTGGGGAGAGAGGCTGG - Exonic
1085126561 11:74006236-74006258 GCTCATCTGGCGCTGCAGGCCGG + Exonic
1087243444 11:95806761-95806783 GTTAGTCTACAGAGGCAGGCAGG - Intronic
1088541567 11:110919043-110919065 GCTGGTCTCCAGAGGCAGGAGGG + Intergenic
1089253574 11:117181741-117181763 GCTCCTCTGGAGGGGCAGGCCGG + Intronic
1090704367 11:129323109-129323131 GCTGATCTGCAGAGGCACGCAGG + Intergenic
1090858863 11:130635188-130635210 GCTTCCCTGCAGAGTCAGGCAGG + Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1091052322 11:132383947-132383969 TGGCATCTACAGAGGCAGGCAGG - Intergenic
1091057794 11:132435154-132435176 CCTCATCAGCAGTGGCAGGTGGG - Intronic
1091071672 11:132570433-132570455 CCTCATCTTCAGGAGCAGGCAGG + Intronic
1091711500 12:2743688-2743710 GCTGCTGTGCAAAGGCAGGCGGG + Intergenic
1092143898 12:6201491-6201513 GTTCATCTGGAGAGGCCAGCGGG + Intronic
1092857236 12:12685423-12685445 GCTGAACTGGAGAGGCAGGGAGG + Intronic
1095038981 12:37421901-37421923 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1095049058 12:37541281-37541303 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1095049447 12:37543472-37543494 CCACATCTGCTAAGGCAGGCAGG - Intergenic
1095322401 12:40845646-40845668 TCTCATCTCCAGAGGCTGGCGGG - Intronic
1095584486 12:43835758-43835780 GCCGCTCTGCAGAGGCGGGCCGG + Intergenic
1096576960 12:52558875-52558897 GTTCATCTGCTGAGGAGGGCTGG - Intergenic
1096617236 12:52840399-52840421 GCTCATCAGAAGAGAGAGGCAGG + Intronic
1096840332 12:54375949-54375971 GTCCATCTGTGGAGGCAGGCTGG + Exonic
1097987472 12:65799114-65799136 CCTCATCTGCATAGCAAGGCAGG + Intergenic
1098301120 12:69055145-69055167 GCTCTCCTGCAGGAGCAGGCGGG + Intergenic
1099005980 12:77235274-77235296 GTTCCTCTGGAGAGGCAGGATGG + Intergenic
1100273121 12:93045150-93045172 GGTCATCTGCAGAGGTAGTGAGG - Intergenic
1100563854 12:95775723-95775745 TGGAATCTGCAGAGGCAGGCAGG - Intronic
1102028023 12:109724474-109724496 ATTCATCGGCAGAGCCAGGCTGG - Intronic
1102418562 12:112785999-112786021 GCTCATCTCCTGAAGCAGCCAGG - Intronic
1102701992 12:114847478-114847500 CCCCATCTTCAGAGGCAGACCGG + Intergenic
1103507569 12:121452399-121452421 GCTCATCTGCAGGCCCAGCCTGG - Intronic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1103920427 12:124396596-124396618 CCTGACCTGCAGCGGCAGGCAGG + Intronic
1104097529 12:125571207-125571229 GCTAAGCTGCAGAGCCAGGATGG - Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1104769789 12:131354172-131354194 ACTCCTCAGCAGAGGCAGGATGG - Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1105012586 12:132765665-132765687 GCCCAGCTGCAGGGACAGGCAGG + Intergenic
1106236174 13:27862410-27862432 GCTCAGCTGCTGAAACAGGCTGG - Intergenic
1106457227 13:29937992-29938014 GCCCAGATGCAGAGGCAGGTGGG + Intergenic
1106756526 13:32827860-32827882 TCTCCTCTGCAAAGGCAGACTGG + Intergenic
1106881606 13:34138070-34138092 CCTCATCAGCAGAGGCAGACAGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1112330776 13:98475620-98475642 GGTCAGCTGCAGGCGCAGGCGGG - Intronic
1112330803 13:98475708-98475730 GGTCAGCTGCAGGCGCAGGCCGG - Intronic
1112555227 13:100461714-100461736 GAGCAGCTGCAAAGGCAGGCAGG - Intronic
1113101731 13:106727504-106727526 CCTCATCTGAGGAGTCAGGCTGG - Intergenic
1113481543 13:110625513-110625535 GCCCAGCTCCAGAGGCAGGGAGG + Intronic
1113509968 13:110845934-110845956 GCTTATCTCCAGTGGAAGGCAGG + Intergenic
1117275862 14:54192691-54192713 TCTCATCTCCAGGGACAGGCGGG - Intergenic
1118503542 14:66386581-66386603 GCACATCTTCAGAAACAGGCTGG - Intergenic
1121050992 14:90818812-90818834 GCAAATCTGGAGAGGCAGACTGG - Intergenic
1121249940 14:92491980-92492002 GCTCATCTGAGGAGACAGCCTGG - Intronic
1121347219 14:93144943-93144965 GCTTATCTGGGGAGTCAGGCAGG + Intergenic
1122722427 14:103729830-103729852 GCTGACCTTCAGAGGCAGGCTGG - Exonic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1123909676 15:24954907-24954929 GCGCGGCCGCAGAGGCAGGCTGG + Intronic
1123938468 15:25205335-25205357 GATGACCTCCAGAGGCAGGCGGG - Intergenic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1127866783 15:63040012-63040034 GGTCCTCTCCAGAGGTAGGCTGG - Intergenic
1128217744 15:65945859-65945881 GCTCACAGGCAGGGGCAGGCGGG + Intronic
1129461113 15:75700482-75700504 GCCCTTCTGCAGGGGCTGGCGGG + Intronic
1129743063 15:77999551-77999573 CCTGGTCTGCAGAGCCAGGCAGG - Intronic
1131324085 15:91425818-91425840 GCTCATCTGCAGGGCCAAACAGG + Intergenic
1131524178 15:93139555-93139577 GCACATTTGCAGAGGATGGCGGG + Intergenic
1132329824 15:101004499-101004521 GTTGAGCTGCAGAGGCAGCCAGG + Intronic
1132331469 15:101015052-101015074 GCTGGTCTCCAGAGGCTGGCTGG - Intronic
1132353193 15:101153230-101153252 GCAGGTCAGCAGAGGCAGGCAGG - Intergenic
1132543992 16:524738-524760 GCCCTTCAGCAGAGGCAGGATGG - Intergenic
1132544021 16:524833-524855 GCCCTTCAGCAGAGGCAGGCTGG - Intergenic
1133328808 16:4958481-4958503 GCTCAGCTCCCGAGCCAGGCGGG + Intronic
1134227075 16:12399530-12399552 GCATCTCTTCAGAGGCAGGCTGG + Intronic
1135938112 16:26798183-26798205 GCTCATCTCTACAGGGAGGCAGG - Intergenic
1137594291 16:49713607-49713629 GCCCATTTGCAGAAGCGGGCAGG - Intronic
1137661313 16:50209308-50209330 GCTCTTCTGCACAGGTTGGCTGG - Intronic
1138734063 16:59230177-59230199 TGGCATCTACAGAGGCAGGCTGG - Intergenic
1139949974 16:70663959-70663981 GCCCATCCCCAGAGGCAGCCGGG - Exonic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1141740678 16:85890233-85890255 GCACATCTGCAAAGGTAAGCTGG + Intergenic
1141948018 16:87323568-87323590 GTTCATCAGCAGAGCCAGGCAGG + Intronic
1142404904 16:89882941-89882963 GCTCCTCTCCAGCAGCAGGCAGG - Intronic
1142682490 17:1558528-1558550 CCTCATCTACAGACACAGGCAGG + Exonic
1142884396 17:2903767-2903789 GGTCAACTGCAGGGGCAGGCAGG + Intronic
1144717688 17:17445794-17445816 ATTTTTCTGCAGAGGCAGGCGGG - Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1144787247 17:17838713-17838735 GTCCCTCTGCAGAGGCAGGGAGG + Intergenic
1145378947 17:22376633-22376655 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379426 17:22379003-22379025 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379904 17:22381373-22381395 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380384 17:22383748-22383770 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380863 17:22386095-22386117 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145381342 17:22388470-22388492 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382075 17:22392244-22392266 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382550 17:22394609-22394631 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382830 17:22395972-22395994 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383403 17:22398795-22398817 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383917 17:22401263-22401285 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384355 17:22403465-22403487 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384674 17:22404927-22404949 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145385456 17:22409000-22409022 CCACATTTGCTGAGGCAGGCAGG - Intergenic
1145785803 17:27593178-27593200 GCTTCTCTGCTGAGGCAGACGGG + Intronic
1145918040 17:28588204-28588226 GCTCAGCTGGACAGTCAGGCAGG + Intronic
1146541718 17:33701836-33701858 ACTGATGTGCAGAGGCAGGCTGG - Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1147184853 17:38707550-38707572 GCTCATCTGCTGAGGTCAGCAGG + Intronic
1147427772 17:40354493-40354515 CCTCATCTGCGGAGGTGGGCAGG + Exonic
1148079123 17:44957822-44957844 GCTCAGCTGGAGAGACAGGAAGG - Intergenic
1151215849 17:72575857-72575879 ACTCACTTGCAGAGGCAGGAGGG + Intergenic
1151767508 17:76139990-76140012 GCTCATCTGCATGGCCATGCAGG - Exonic
1151830578 17:76547045-76547067 GCCCACTTGCAAAGGCAGGCTGG - Intronic
1153611742 18:6892816-6892838 GCTCATCTGCAAAGACTGGGAGG - Intronic
1153620429 18:6972593-6972615 GTTCCTCTGCAGAGTTAGGCTGG - Intronic
1153750663 18:8226907-8226929 CCTCATCTCCAAAGGCAGGAAGG + Intronic
1155761400 18:29572474-29572496 GGTGAACTGCAGAGGAAGGCTGG + Intergenic
1157575766 18:48742060-48742082 GCTCATCCCTGGAGGCAGGCAGG - Intronic
1158634936 18:59148162-59148184 GGTGATCTGCAGAGCCAGGTGGG - Intronic
1158665483 18:59429025-59429047 GTGAAGCTGCAGAGGCAGGCGGG + Intergenic
1160374719 18:78402827-78402849 GAGCACCTGCAGAGTCAGGCAGG - Intergenic
1160374728 18:78402915-78402937 GAGCACCTGCAGAGTCAGGCAGG - Intergenic
1160374733 18:78402959-78402981 GAGCACCTGCAGAGTCAGGCAGG - Intergenic
1160374743 18:78403047-78403069 GAGCACCTGCAGAGTCAGGCAGG - Intergenic
1160374756 18:78403179-78403201 GAGCAGCTGCAGAGTCAGGCAGG - Intergenic
1160730064 19:637832-637854 GCCCATCCACAGAGGCAGGAAGG + Intergenic
1160913996 19:1488087-1488109 GCTGTTCTGCAGGGGGAGGCGGG + Exonic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1164820907 19:31250693-31250715 GTTCATTTGCAGAAGCCGGCTGG + Intergenic
1165294452 19:34915464-34915486 GCCACTCTGCAGAGGCATGCAGG + Intergenic
1165595661 19:37009744-37009766 CCTCATCTGGTGAGGCAGGCAGG - Intronic
1166224905 19:41388879-41388901 GCTGATGTGCAGAGAAAGGCAGG + Intronic
1166324258 19:42039441-42039463 GCTCTGCTGCCCAGGCAGGCTGG - Intronic
1166775067 19:45307468-45307490 CCTCTTCTGCAGACGCAGGCGGG + Exonic
1166918635 19:46213333-46213355 GCCCTCCTGCAGAGACAGGCTGG - Intergenic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
925984008 2:9200571-9200593 GCTGATGTGCACAGGCAGGGAGG + Intergenic
926333142 2:11841916-11841938 GCTCAAGTCCAGAGGCAGTCAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928754870 2:34511854-34511876 GCTCATTAGCAGGTGCAGGCTGG - Intergenic
930017312 2:46979784-46979806 CCTCTGCTGCAGAGACAGGCAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930661007 2:54053248-54053270 GCTGCTCTGCATAGGCATGCTGG + Intronic
931848378 2:66228422-66228444 GAACACCTCCAGAGGCAGGCTGG - Intergenic
932490376 2:72116250-72116272 GCTCCTTGGCAGTGGCAGGCTGG - Intergenic
935007061 2:99089424-99089446 GCTCAAGTGCAGATGCAGGCAGG + Intronic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
938931773 2:136092871-136092893 GCTCATGGTCAGAGCCAGGCTGG - Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
941568010 2:167132624-167132646 GATGGCCTGCAGAGGCAGGCCGG - Intronic
942708490 2:178804222-178804244 GCTCAGCTGCAGAGCCAGACTGG - Intronic
943018775 2:182547414-182547436 GCTCATCATCAAAGGCAGGAAGG - Intergenic
946028793 2:216689232-216689254 CCTGATGTGGAGAGGCAGGCAGG - Intronic
947466104 2:230347839-230347861 GCCCAACTGCAGAGGCAAGCTGG - Intronic
947474550 2:230431081-230431103 GTCCACCTGCAGAGGCAAGCTGG - Intronic
948602764 2:239116686-239116708 GCTCTTCAGCAGAGGCAGGATGG - Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948645931 2:239404549-239404571 GCTGATCTTCACAGGCAGGAGGG + Intergenic
949060477 2:241953728-241953750 GCTCAGCTGCACAGCCCGGCCGG + Intergenic
1168978962 20:1988822-1988844 GCTCATGTGATTAGGCAGGCTGG - Intronic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1169388890 20:5173594-5173616 TATCATCTGCAGAGACTGGCAGG - Exonic
1169410945 20:5369884-5369906 GCTTATCTGCAGTGACAGGAGGG - Intergenic
1170483607 20:16793436-16793458 TGGCATCTACAGAGGCAGGCAGG + Intergenic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1171524178 20:25796650-25796672 CCACATCTGCTGAGGCAGGCAGG + Intronic
1171524573 20:25798899-25798921 GCACATCTGGTGAGGCAGGCAGG + Intronic
1171531464 20:25856166-25856188 CCACATCTGTTGAGGCAGGCAGG + Intronic
1171532229 20:25860339-25860361 CCACATCTGCTGGGGCAGGCAGG + Intronic
1171532882 20:25863665-25863687 CCACATCTGGTGAGGCAGGCAGG + Intronic
1171533314 20:25866166-25866188 CCACATCTGGTGAGGCAGGCAGG + Intronic
1171543594 20:25984784-25984806 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1171543978 20:25986987-25987009 CCACATCTGCTAAGGCAGGCAGG - Intergenic
1171552254 20:26056984-26057006 GCACATCTGGTGAGGCAGGCAGG - Intergenic
1171552649 20:26059233-26059255 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1171793386 20:29548276-29548298 GCACATCTGGTGAGGCAGGCAGG - Intergenic
1171807040 20:29689453-29689475 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1171855072 20:30336103-30336125 GCACATCTGGTGAGGCAGGCAGG + Intergenic
1172238336 20:33393940-33393962 GCTCATCTCCATAGACAGCCAGG + Intronic
1172598339 20:36166058-36166080 AATCATCAGGAGAGGCAGGCTGG + Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1175771860 20:61629054-61629076 TCTGATCTGCACAGGCAGGCAGG + Intronic
1176235357 20:64051174-64051196 GCTTTTCTGGGGAGGCAGGCAGG + Intronic
1176685115 21:9839786-9839808 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1178343513 21:31805857-31805879 GATGACATGCAGAGGCAGGCTGG + Intergenic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180065232 21:45409004-45409026 GGTCAGGTGCAGAGGCTGGCAGG + Intronic
1180898419 22:19353851-19353873 GCTGGTCAGCACAGGCAGGCTGG - Intronic
1181084267 22:20432073-20432095 GCGCAACTGCAGAGGCAGGGAGG - Intronic
1181383016 22:22521870-22521892 GCGCTTAGGCAGAGGCAGGCAGG + Intergenic
1182161007 22:28121717-28121739 CCCCATAGGCAGAGGCAGGCAGG - Intronic
1182283407 22:29231003-29231025 GGTCATCTGAAGAGGAAGACAGG - Exonic
1182517544 22:30867551-30867573 TCTGTTCTGCAGAGACAGGCAGG - Intronic
1183536611 22:38405286-38405308 GGCCATTTGCAGAGGCAGGCTGG - Intergenic
1184047300 22:41979439-41979461 GCTCAGCTGCAGAGGCATAAGGG + Intronic
1184310434 22:43637731-43637753 GCTCCTCTGCAGAGCTGGGCCGG - Intronic
1184313917 22:43667495-43667517 GCCCATGTACAGTGGCAGGCTGG + Intronic
1184979155 22:48084035-48084057 GAGGGTCTGCAGAGGCAGGCAGG - Intergenic
949491113 3:4589888-4589910 GCCCACTTCCAGAGGCAGGCAGG - Intronic
950489258 3:13293396-13293418 GCTCATCTGGAGATGCACACGGG - Intergenic
955085822 3:55701766-55701788 TCTCATGTGCAATGGCAGGCTGG - Intronic
956630272 3:71310472-71310494 GCTTTTCTGCAGGGGCATGCTGG + Intronic
959949718 3:112165869-112165891 TGGCATCTGCAGAAGCAGGCAGG + Intronic
960121030 3:113948446-113948468 GCTCACCTGCGGGTGCAGGCTGG - Intronic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
961727795 3:128944364-128944386 GCCCATCAGCACAGGAAGGCAGG + Intronic
962696345 3:137951190-137951212 TGCCATCTGCAGATGCAGGCAGG - Intergenic
963514670 3:146293502-146293524 TGGCATCTACAGAGGCAGGCAGG + Intergenic
963567351 3:146946265-146946287 GGTGGTCTACAGAGGCAGGCAGG + Intergenic
963844481 3:150141340-150141362 GCTGATCTTATGAGGCAGGCTGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966411805 3:179652982-179653004 GCCCAGCTGCAGCGTCAGGCGGG - Exonic
966880430 3:184346850-184346872 GCTCACCTGGGGAGGAAGGCGGG - Intronic
966881389 3:184353142-184353164 GTTCACCTGCATAGGCAGGAAGG + Exonic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967194968 3:187018120-187018142 GCTGAGATGGAGAGGCAGGCTGG + Intronic
967980166 3:195060856-195060878 GCTGACCTGCACAGGCAGCCTGG + Intergenic
968573199 4:1353247-1353269 GGTGGCCTGCAGAGGCAGGCAGG - Exonic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
969128016 4:4968427-4968449 GGTCATCTGCAGAGGCACATGGG - Intergenic
969570580 4:8005972-8005994 GTGCATCTGCACAGGCAGCCTGG + Intronic
970864117 4:20739125-20739147 TGGCATCTACAGAGGCAGGCAGG - Intronic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
974947246 4:68542983-68543005 GTGGATCTACAGAGGCAGGCAGG - Intronic
975812938 4:78188431-78188453 GCTCATCTGATGATGGAGGCTGG + Intronic
976370394 4:84281192-84281214 TCTCATCTGCAGATACAGCCTGG + Intergenic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
978349949 4:107811196-107811218 CCTCATATGCCAAGGCAGGCTGG - Intergenic
979482032 4:121230529-121230551 GCTCATCTTCAGAGACAAGTTGG - Intergenic
980740121 4:136939358-136939380 GCTGATCAGCAGAAGCTGGCAGG + Intergenic
984040999 4:174733673-174733695 TTTCTTCTGCAAAGGCAGGCAGG - Intronic
985737847 5:1594807-1594829 GCTCGTCCGCGGAGGCGGGCGGG + Intergenic
985747031 5:1653516-1653538 GCTCAGATGCAGAAACAGGCTGG - Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
985964469 5:3329531-3329553 GCCACTCTGCAGAGGCTGGCAGG + Intergenic
986009405 5:3698656-3698678 GCTCAGCTGGAGAGGCTGGCTGG - Intergenic
987379989 5:17275819-17275841 GCTCTTCTGCAGAGGCTGCGGGG - Exonic
989674077 5:43953414-43953436 TGGCATCTACAGAGGCAGGCTGG - Intergenic
991516170 5:67438006-67438028 GTACATCTGCAGAAGTAGGCTGG + Intergenic
992023508 5:72648721-72648743 ACTGAACTGCAGAGGCTGGCTGG + Intergenic
994266555 5:97723377-97723399 TGGCGTCTGCAGAGGCAGGCAGG + Intergenic
994387249 5:99146736-99146758 TGGCATCTACAGAGGCAGGCAGG - Intergenic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995933736 5:117483733-117483755 GGCCCTCTGCAGAGACAGGCAGG - Intergenic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
996873101 5:128213642-128213664 ACTCATCTGAGGAGGCAGGCAGG + Intergenic
997735491 5:136209737-136209759 CTTCATTTGCGGAGGCAGGCAGG - Intergenic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
998292003 5:140925072-140925094 GCTCATCTGGAAAGGAAGGAAGG + Intronic
999095442 5:148973917-148973939 GTGCAGCTGGAGAGGCAGGCAGG - Intronic
999239820 5:150120956-150120978 GCTCATCTGTGAAGGCAAGCTGG - Exonic
1000285077 5:159819862-159819884 GCTCCACTCCAGAGGCAGGGAGG + Intergenic
1001787594 5:174427007-174427029 GCCAAGCTGCACAGGCAGGCAGG - Intergenic
1001843799 5:174903362-174903384 ACTCATTTTCAGAGACAGGCTGG - Intergenic
1002608646 5:180399344-180399366 GCACCTCTGCAGGGTCAGGCTGG - Intergenic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002861773 6:1085768-1085790 GCCCATAGGCTGAGGCAGGCTGG - Intergenic
1003924507 6:10864275-10864297 GCCCAGCTGCAGAGGCAGAGGGG - Intronic
1004047250 6:12038339-12038361 GCTAAACTGCAGAGGCATACAGG + Intronic
1004426747 6:15511888-15511910 GCTCATCTCCAGAGCCAAGTAGG - Intronic
1004503449 6:16228846-16228868 GCTCATCTGCTCGGGCTGGCAGG - Intergenic
1004555034 6:16688395-16688417 GCTCAACTCCAGAGGCAAGGTGG + Intronic
1005398466 6:25407449-25407471 GTACAGCTGCAGATGCAGGCAGG + Intronic
1006641416 6:35491583-35491605 ACTCCTCTGCAGAGGCAGATGGG - Intronic
1007371313 6:41428308-41428330 GCTCACCTGCAGGGCCAGCCAGG - Intergenic
1007720853 6:43884764-43884786 GGTCAGCAGCAGGGGCAGGCAGG - Intergenic
1008598434 6:53065674-53065696 GCTCCGCTGCAGAGACAGGCAGG + Intronic
1013118232 6:107119168-107119190 ACACAGCTGCAGGGGCAGGCAGG + Intergenic
1014422970 6:121267654-121267676 TGGCATCTACAGAGGCAGGCAGG - Intronic
1015247107 6:131086857-131086879 TGGCATCTACAGAGGCAGGCAGG - Intergenic
1015459000 6:133466827-133466849 GCACATTTGCAGAGATAGGCGGG + Intronic
1018093978 6:160368534-160368556 GCTCAGCTGCAGAGGAACACAGG - Intronic
1018199729 6:161383752-161383774 GATGACCTGCAGAGGCGGGCTGG - Intronic
1018686817 6:166309626-166309648 GCCCACCGGCAGAGACAGGCTGG - Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019171022 6:170133287-170133309 TCTCATCTACCTAGGCAGGCAGG + Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019428576 7:988402-988424 GCTGACCTGCAGAGAAAGGCAGG - Exonic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1020217067 7:6201310-6201332 ACTGAGCTGCAGGGGCAGGCAGG + Intronic
1022237002 7:28471691-28471713 GATCATCTGCAGAGTGAGGCAGG + Intronic
1024587653 7:50855513-50855535 GCTCTGCTGCAGAGTGAGGCTGG - Intergenic
1024629167 7:51233205-51233227 GAGCATCTGCAGAGACAGGCTGG + Intronic
1024709447 7:51999059-51999081 GCTCATCTGAAGGGGCAGCAAGG - Intergenic
1024975806 7:55112640-55112662 ACTGATCTCCAGAGGCCGGCAGG - Intronic
1025014015 7:55424297-55424319 GGTCAGCTGCAGAGACAGGCAGG - Intronic
1025093186 7:56079572-56079594 GCTGTGCTGCAGACGCAGGCCGG + Exonic
1025284165 7:57649109-57649131 TCACATCTGGTGAGGCAGGCAGG + Intergenic
1025284601 7:57651550-57651572 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1025285043 7:57653966-57653988 CCACATCTGAGGAGGCAGGCAGG + Intergenic
1025294969 7:57769855-57769877 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1025295356 7:57772066-57772088 CCACATCTGCTAAGGCAGGCCGG - Intergenic
1025301366 7:57821688-57821710 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1026824684 7:73574050-73574072 GATCATCTGCACAGGTAGCCAGG + Exonic
1027340504 7:77202744-77202766 GCTCATCTGCAAGTGCAGGGAGG - Intronic
1028485016 7:91348156-91348178 TCTCAAAGGCAGAGGCAGGCTGG + Intergenic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1029218483 7:98969643-98969665 GCCCAACTGCAGAGGCAGGCAGG + Intronic
1029364104 7:100106399-100106421 GCTCAGCTCCTGAGACAGGCTGG - Exonic
1029473275 7:100767814-100767836 ATTCAGCTGCAGAGGCAGGGAGG - Exonic
1032320984 7:130886538-130886560 TCTTCTCTGCAGTGGCAGGCTGG - Intergenic
1032391214 7:131556520-131556542 GCTCTGCTGCAGCGGCAGGGAGG - Exonic
1035055415 7:156031985-156032007 GTTCACCGGCAGAGGCAGGGAGG - Intergenic
1035309498 7:157956273-157956295 GCACATCTGGAGGGGGAGGCTGG + Intronic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1036719128 8:11156408-11156430 GCCCAGCTGAAGAGGCAGGCAGG - Intronic
1036927207 8:12918658-12918680 GCTTAACTGCAAAGGCAGCCGGG + Intergenic
1037638815 8:20724161-20724183 GTTCATCTGAAAAGGCAGGCAGG + Intergenic
1037981828 8:23259778-23259800 GCTCATCTGCGGGAGCAGTCAGG + Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1038641973 8:29336153-29336175 GCTCATCTTGAGAAGCAGGCGGG - Exonic
1038870574 8:31489411-31489433 TGGCATCTACAGAGGCAGGCAGG + Intergenic
1038944680 8:32345450-32345472 GCACAGCAGCAGAGGCAGTCTGG - Intronic
1040383376 8:46894474-46894496 TGGCATCTGCAGAGGCAGGTGGG - Intergenic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1042740319 8:72036339-72036361 GCTCATCTGCAGTGGCAATGTGG - Exonic
1043517088 8:81004904-81004926 GCCCATCCTCAGAGGCCGGCTGG - Intronic
1044225014 8:89708711-89708733 TGGCATCTACAGAGGCAGGCAGG - Intergenic
1045046313 8:98282251-98282273 GCTGGTCTGGAGAGGCAAGCAGG + Intronic
1045326121 8:101119006-101119028 GCTCATCTCCCCAGGGAGGCTGG + Intergenic
1046166165 8:110438925-110438947 GCTCATCAGCTGTCGCAGGCTGG - Intergenic
1048975570 8:139671172-139671194 GCTCATGTGCAGAGGAGGCCTGG + Intronic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049345737 8:142137654-142137676 GCTGGGCTTCAGAGGCAGGCTGG + Intergenic
1049624231 8:143612960-143612982 TCACCGCTGCAGAGGCAGGCAGG + Exonic
1050241995 9:3646409-3646431 GCTCAGCAGCAGAAGCAGGAAGG - Intergenic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1053044648 9:34905220-34905242 GACCAGCTGCAGAGGCAGGGAGG + Intergenic
1053784309 9:41643621-41643643 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1053784926 9:41646726-41646748 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1053792899 9:41699392-41699414 GCACATCTGGTGAGGCAGGCAGG + Intergenic
1053822621 9:41983665-41983687 GCTCTTCTGAAAAGGCTGGCGGG + Intronic
1054152278 9:61615433-61615455 GCACATCTGGTGAGGCAGGCAGG - Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054172266 9:61853754-61853776 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054172749 9:61856223-61856245 CCACATCTGGAGAGGCCGGCAGG - Intergenic
1054173651 9:61860671-61860693 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054181311 9:61911413-61911435 GCACATCTGGTGAGGCAGGCAGG + Intergenic
1054447123 9:65382781-65382803 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054447597 9:65385226-65385248 CCACATCTGGAGAGGCCGGCAGG - Intergenic
1054448506 9:65389736-65389758 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054472049 9:65546576-65546598 GCACATCTGGTGAGGCAGGCAGG - Intergenic
1054656283 9:67669729-67669751 GCACATCTGGTGAGGCAGGCAGG - Intergenic
1054663889 9:67720110-67720132 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054664791 9:67724578-67724600 CCACATCTGGAGAGGCCGGCAGG + Intergenic
1054665271 9:67727051-67727073 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1055329370 9:75167549-75167571 GCACATATACAGAGGCAGTCTGG - Intergenic
1056450383 9:86710962-86710984 AGTGATCTGCAGAGCCAGGCTGG + Intergenic
1058412329 9:104747681-104747703 GATCATTGGCAGACGCAGGCTGG - Exonic
1060848653 9:126857431-126857453 CCTCCTCTGCAGAGGCAGCCAGG + Intergenic
1060907773 9:127323406-127323428 ACTCAGCTGTAGAGGCAGGAGGG - Intronic
1061093908 9:128443358-128443380 ACTCATCCTCAGAGCCAGGCTGG + Intergenic
1062414639 9:136442100-136442122 GCTGCTCTGCAGAGCCAGCCTGG + Intronic
1062500925 9:136851652-136851674 GCCCGTCTGGAGAGGCTGGCCGG - Intronic
1062593617 9:137287275-137287297 GCTCATCCTCAGAGGCAGAAGGG - Intergenic
1062607407 9:137354372-137354394 GCTCTTCTGCAAAGGCAAACAGG + Exonic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1187020239 X:15373904-15373926 GAACATCTGCTGAGGAAGGCCGG - Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1191120104 X:56894455-56894477 TGGCATCTACAGAGGCAGGCAGG - Intergenic
1193713986 X:84915391-84915413 GCTGAAGTGCAGTGGCAGGCAGG + Intergenic
1198688920 X:139259257-139259279 TCTACTCTGCTGAGGCAGGCTGG + Intergenic
1201063786 Y:10070209-10070231 GCTCTGCTGGAGAGGAAGGCCGG + Intergenic
1201296494 Y:12467713-12467735 GCTAATTTGCAAAGGCAGACTGG - Intergenic
1202020782 Y:20462860-20462882 GGTGGTCTACAGAGGCAGGCTGG + Intergenic