ID: 1173642262

View in Genome Browser
Species Human (GRCh38)
Location 20:44612002-44612024
Sequence CTGTATCCATTCAATCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173642261_1173642262 -1 Left 1173642261 20:44611980-44612002 CCTTTGTGTATATATACATTTTC 0: 16
1: 69
2: 195
3: 328
4: 1291
Right 1173642262 20:44612002-44612024 CTGTATCCATTCAATCATGTTGG 0: 1
1: 0
2: 0
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173642262 Original CRISPR CTGTATCCATTCAATCATGT TGG Intronic
900079934 1:848726-848748 TAGTATCCATTCAAGCATGAGGG + Intergenic
904934480 1:34120027-34120049 CTTTATCCATTCATCCATGTAGG - Intronic
905938431 1:41843186-41843208 GTGTATCCATGCAGTCATCTGGG - Intronic
906571064 1:46840996-46841018 CTGTATCCATTAAATTGTGCTGG - Intergenic
906600211 1:47120308-47120330 CTGTATCCATTAAATTGTGCTGG + Intergenic
908162069 1:61420044-61420066 CAACATCCATTCCATCATGTGGG + Intronic
910622574 1:89273194-89273216 CTGTATCTATTTAATCTGGTGGG - Intergenic
912037652 1:105340920-105340942 CTTTATCCTTTTCATCATGTGGG + Intergenic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
918732196 1:188013018-188013040 CTGTATCCAGTGAATCTAGTGGG - Intergenic
918894971 1:190330736-190330758 CTTTATCCAATCAACCATATGGG - Intronic
920411428 1:205764267-205764289 CTGTCTCCATTCTGTCATTTAGG - Intergenic
921494411 1:215820973-215820995 CTTTATCCATTCATTCATGATGG + Intronic
921668063 1:217896151-217896173 CTGCATCCTTTCAATAATGTGGG + Intergenic
923433716 1:233949076-233949098 TTCTGTCCATTCCATCATGTAGG + Intronic
924078612 1:240368009-240368031 CTGTACCATTTCTATCATGTAGG + Intronic
1062933933 10:1371809-1371831 CTGCATCCACACAAACATGTTGG - Intronic
1065356683 10:24849070-24849092 CTGTATCCTTTTATTCATGTGGG - Exonic
1066240606 10:33530839-33530861 CTGCATCCATCCAATCAACTCGG - Intergenic
1067206969 10:44226350-44226372 CTTTATCCAGTCAATCAAATGGG + Intergenic
1067760773 10:49044725-49044747 CTTTATCCATTCCTTCATGTTGG + Intronic
1068381263 10:56255948-56255970 CTGTTTCTATTCAGTCATCTTGG + Intergenic
1068785826 10:60972294-60972316 CTTTATCCAGTCTATCATGATGG - Intronic
1069098004 10:64283673-64283695 CTTTATCCAATCATTCATGATGG - Intergenic
1070035211 10:72715590-72715612 CTGTTTCCATGCAATCCAGTTGG - Intronic
1073712682 10:106062610-106062632 CTTCATCCATTGAATCATTTAGG + Intergenic
1073982677 10:109172826-109172848 GTGTATACATTCCTTCATGTGGG - Intergenic
1077552229 11:3205703-3205725 CTGTGTCCATTGAATCACGGAGG - Intergenic
1079650127 11:22917690-22917712 TTTTATCCATTCATTCATTTAGG + Intergenic
1079750793 11:24193934-24193956 CTGTATACATTAAATTATTTGGG - Intergenic
1080006993 11:27419689-27419711 CTTTATCCATTCACTAATTTAGG - Intronic
1080224138 11:29941338-29941360 CTGTTTCTATTGAATCATTTAGG + Intergenic
1081060692 11:38472090-38472112 CTTTATCCAGTCTATCATTTGGG - Intergenic
1081291414 11:41330079-41330101 TTGTATCCATGCAATCATGCAGG + Intronic
1082983729 11:59147614-59147636 CTTTATCCATTCATGCATGGAGG - Intronic
1085536621 11:77224303-77224325 CTGTTTCTATTCAGTCATCTTGG + Intronic
1087388346 11:97502841-97502863 ATTTATCGATTCAATCATTTGGG + Intergenic
1087399300 11:97644438-97644460 CTTTCTCCATTAAATCGTGTTGG - Intergenic
1088021066 11:105120190-105120212 CTGTACCCATTTAATCACATTGG + Intergenic
1088440328 11:109863715-109863737 CTGAATCAATTCATTCATTTTGG - Intergenic
1090854778 11:130601957-130601979 CTGTCTCCCATCAATCATGGAGG + Intergenic
1091249915 11:134135275-134135297 CTTTCTCCATTAAATGATGTTGG + Intronic
1091832876 12:3562815-3562837 CTGTATACATTCCCTCAGGTGGG + Intronic
1092167727 12:6353286-6353308 CTGTATCCATTCAATAGTAGAGG - Intronic
1100007505 12:89911712-89911734 CTGTATTCATCCATTCATGAGGG + Intergenic
1100630422 12:96383682-96383704 CTCTATTCAATAAATCATGTTGG + Intronic
1104011886 12:124936826-124936848 TTGTGTCCTTTCAATCATTTAGG - Intergenic
1109743997 13:66596590-66596612 ATGCATCCATTTAATTATGTTGG - Intronic
1110020486 13:70463160-70463182 CTTTATCCAGTCTATCATGATGG - Intergenic
1111390178 13:87583786-87583808 ATGTATACATTGAATCATATTGG + Intergenic
1111845397 13:93501555-93501577 CTTTATCCATTCAGAAATGTGGG + Intronic
1114944693 14:27664974-27664996 CTTTATCCAGTCAATCATTGAGG + Intergenic
1117154734 14:52927438-52927460 CTGTATCCAAACAGTCAAGTAGG - Intronic
1117719030 14:58610421-58610443 CTTTATCCATTCAACCATGGTGG - Intergenic
1117924267 14:60760500-60760522 CTGTATTCTTACAATCATATTGG - Intronic
1119951242 14:78747915-78747937 TTGTAGTCATTCACTCATGTAGG + Intronic
1119966470 14:78921731-78921753 ATGTATCCATTAATCCATGTGGG - Intronic
1120861299 14:89257178-89257200 CTATTTCCATTCCATCATGAGGG + Intronic
1121003320 14:90468072-90468094 CTTTATCCAGTCTATCATGATGG + Intergenic
1125127549 15:36241853-36241875 CTGATACCATGCAATCATGTGGG - Intergenic
1125415722 15:39450376-39450398 CAGTATCCATTGCCTCATGTTGG - Intergenic
1128269996 15:66300717-66300739 CTCTCTCCATCCAGTCATGTAGG - Intronic
1129587856 15:76886758-76886780 CTTTATCCAGTCAATCATTGAGG - Intronic
1130171480 15:81519252-81519274 CTGTCTCCATTCAAACATCTGGG - Intergenic
1130236863 15:82143565-82143587 CTGTATCCTGTCAACCACGTTGG - Intronic
1131389986 15:92039822-92039844 CTTTATCCAGTCTATCATGATGG - Intronic
1132582628 16:692340-692362 CTGTTTCCATTCTACCATGTCGG + Intronic
1134597791 16:15509768-15509790 CTGTGGCCATTCATTCTTGTGGG + Intronic
1139496365 16:67322129-67322151 CTTTGTCCATTGAATCATCTTGG - Intronic
1139581648 16:67877405-67877427 CAGTATCCATTCCTTCCTGTGGG + Exonic
1142299108 16:89246434-89246456 CTTTATCCAGTCTATCATGATGG - Intergenic
1144431649 17:15198196-15198218 CTGTTTCTATTCAACCATTTTGG - Intergenic
1144613100 17:16742287-16742309 CTGTATGTTTTCACTCATGTGGG - Intronic
1144899702 17:18573432-18573454 CTGTATGTTTTCACTCATGTGGG + Intergenic
1145132758 17:20372364-20372386 CTGTATGTTTTCACTCATGTGGG - Intergenic
1152299149 17:79485250-79485272 CTGTTTCCATTCCTTCCTGTGGG - Intronic
1153920739 18:9786990-9787012 CTGCATCCCTTCTATCATGTTGG - Intronic
1155295846 18:24384054-24384076 CTGTATCTAATCACTAATGTTGG - Intronic
1157410176 18:47457112-47457134 CTGTATGCATGCATACATGTGGG + Intergenic
1161916813 19:7234506-7234528 CTGTATACTTTAAATCATCTTGG - Intronic
1163037732 19:14580817-14580839 CTGTACCCATTCCAACCTGTAGG - Intergenic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
1165965703 19:39577804-39577826 CTTTATCCAGTCTATCATTTGGG + Intergenic
928536412 2:32245841-32245863 CTGTATGTGTTCAATAATGTTGG + Intronic
933388378 2:81639915-81639937 CTTTATCCAGTCTATCATTTAGG - Intergenic
934189798 2:89778131-89778153 ATGAATCCATTCAATTAAGTTGG + Intergenic
936861821 2:117028767-117028789 CTGTTTCTAATCAATCATCTTGG - Intergenic
941309351 2:163910098-163910120 CTGTATCCAGTTAATCTGGTGGG + Intergenic
945613624 2:212038309-212038331 CTGAATCCAATTAATCATGAAGG - Intronic
945956867 2:216094469-216094491 CTATACCCATTAAATCATGGGGG - Intronic
1168983620 20:2028422-2028444 CTTTATCCATTCATTCTTGCTGG + Intergenic
1171239429 20:23552962-23552984 CTGTATCCTTTATAACATGTAGG - Intergenic
1173642262 20:44612002-44612024 CTGTATCCATTCAATCATGTTGG + Intronic
1175065991 20:56289224-56289246 CTGTACCAACTCAATGATGTTGG - Intergenic
1175233212 20:57489256-57489278 GTGTATCCCTCCAATCATTTAGG - Intergenic
1175463913 20:59176539-59176561 CTGCAGCCATAGAATCATGTTGG + Intergenic
1177574723 21:22937751-22937773 ATGTAGCCATCCAATCATGCAGG + Intergenic
1179993655 21:44962405-44962427 CTGTATAAATGGAATCATGTAGG + Intronic
1183796533 22:40123076-40123098 CTATTTCCATTCTAACATGTTGG + Intronic
951332857 3:21386998-21387020 CTGTATCTATTTAATCCGGTAGG - Intergenic
951461225 3:22953793-22953815 CTTAATCCAGTCTATCATGTTGG + Intergenic
951976961 3:28521844-28521866 CTTTATTCATTCATTCATTTAGG + Intronic
953142746 3:40244716-40244738 CTGTATCCACGCAAACATGCTGG - Intronic
956807897 3:72835323-72835345 CTCAATACATTCAATAATGTCGG + Intronic
958075640 3:88674019-88674041 CTGTATGCATTCCATACTGTAGG + Intergenic
958783364 3:98569539-98569561 CTTTATCCATTCTATCATTGAGG + Intronic
959907306 3:111724110-111724132 CTGTATCCATGAAATCCTGGTGG - Intronic
960015838 3:112886302-112886324 CTGCATCTATTCAACCATCTTGG + Intergenic
960278703 3:115756627-115756649 CTTTATCCAGTCTATCATTTGGG - Intergenic
960297682 3:115963732-115963754 CTCTATCCATTCTTTAATGTTGG + Intronic
960764721 3:121112590-121112612 CTATTTCCAGTCAATCATCTTGG + Intronic
961671370 3:128533994-128534016 CTGTATCCAATCAATCAGTAGGG - Intergenic
961851925 3:129828764-129828786 CTGTATATATTGAATCTTGTAGG - Intronic
963636003 3:147796866-147796888 CTGTTACCATTCAATGAGGTGGG - Intergenic
964829226 3:160864570-160864592 TTGTCTCCATTTAGTCATGTTGG + Intronic
966449815 3:180045499-180045521 ATGTATTCATTCAATAATGCTGG - Intergenic
966473902 3:180322712-180322734 CTCTAGCTATTCAGTCATGTAGG - Intergenic
970782182 4:19750785-19750807 CTGTAACCAGGAAATCATGTAGG + Intergenic
970948259 4:21720901-21720923 CTGAATCCAGTCTATCATGATGG + Intronic
971839984 4:31838455-31838477 CTTTATTCATTAAATCATCTAGG + Intergenic
972901376 4:43688304-43688326 ATGTATCCCTTCAACCATGTAGG - Intergenic
981383742 4:144102888-144102910 CTGTATACAATCAATTAGGTGGG + Intergenic
983145683 4:164211906-164211928 CTATAAGCATTCAAACATGTTGG - Intronic
983169688 4:164521445-164521467 CTGTTTCTATTCAACCATCTTGG + Intergenic
984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG + Intergenic
987355944 5:17062803-17062825 CTGTATCCAGTTAATCTGGTGGG + Intergenic
987594693 5:19982003-19982025 TTGTATTCATTCATTCATGGAGG - Intronic
989512757 5:42307358-42307380 CTGTATCCATTAAAACAAATAGG - Intergenic
992740039 5:79764385-79764407 CTTTATCCAGTCTATCATTTGGG + Intronic
992767741 5:80016954-80016976 ATTGATCCATTCAATTATGTTGG + Intronic
996557606 5:124795290-124795312 CTGTATTCTTACAATGATGTAGG + Intergenic
997281441 5:132649861-132649883 CAGTTCCCTTTCAATCATGTAGG - Intergenic
999928080 5:156401387-156401409 CTGTATTCATTCAACAAGGTAGG + Intronic
1002621028 5:180488382-180488404 ATGAATTCATTCATTCATGTGGG + Intergenic
1002885546 6:1290482-1290504 CTGTCTCCATTTATTGATGTGGG + Intergenic
1003483508 6:6554735-6554757 CTGTATCCAGTTAATTATATTGG - Intergenic
1004325129 6:14667603-14667625 CTGGATCCATTTACTCATTTGGG + Intergenic
1004433343 6:15566347-15566369 GTGGATCCATTCAATCATTTGGG - Intronic
1005872088 6:29982093-29982115 CTGTCTCCATTCAATAGTGCAGG + Intergenic
1009279411 6:61728045-61728067 CTATATCCAGTCTATCATGTTGG - Intronic
1010366184 6:75054590-75054612 CTTTATCCATTCATCCATGAAGG + Intergenic
1010523186 6:76867012-76867034 CTGTATCCATTGACCTATGTAGG - Intergenic
1011912999 6:92465772-92465794 TTGAATCCATTCAATCATCTTGG + Intergenic
1013830895 6:114271676-114271698 TTGAATGAATTCAATCATGTGGG - Intronic
1014066344 6:117131141-117131163 CTTTATCCAGTCTATCATTTGGG - Intergenic
1015325611 6:131919790-131919812 CTGTATTCATTAAATGATGCTGG + Intergenic
1018286407 6:162243849-162243871 CTGTTTCCTTCCAATCATGAAGG + Intronic
1018776015 6:167016707-167016729 ATGTATCCATTCATTCAGGATGG - Intronic
1020544388 7:9505580-9505602 CTGAATCAATTTAATAATGTTGG + Intergenic
1020937779 7:14489131-14489153 CTGTATCTATTGAATAATGTAGG + Intronic
1021273321 7:18619341-18619363 CTGTATACATCCAAGCATGAAGG - Intronic
1022305147 7:29140131-29140153 CTTGATCCATTCAAACATGCAGG + Intronic
1031346897 7:120678258-120678280 CTGTATGCATTCAATTATATAGG + Intronic
1034781191 7:153884393-153884415 CTTAATCCAGTCTATCATGTTGG + Intergenic
1035525571 8:310190-310212 TAGTATCCATTCAAGCATGAGGG - Intergenic
1040376215 8:46827025-46827047 GTGAATCCATACAAGCATGTAGG + Intergenic
1041033475 8:53762334-53762356 GTATATCCCTTCATTCATGTAGG - Intronic
1043242518 8:77953358-77953380 CTGTATTTATTGAATCTTGTGGG - Intergenic
1043585095 8:81759642-81759664 CTCTTTCCATTCCACCATGTTGG - Intergenic
1048894542 8:138978623-138978645 CTGTATCAAAACAATTATGTCGG - Intergenic
1050503518 9:6323493-6323515 CTGCATTCATTCATTCATGAGGG + Intergenic
1051751382 9:20345711-20345733 CTGTATCCATGTAATGATCTTGG - Exonic
1051875848 9:21792565-21792587 CTTTATCCATTCATTCATAATGG - Intergenic
1052152236 9:25131350-25131372 CTTAATCCAGTCCATCATGTTGG - Intergenic
1052582976 9:30384995-30385017 CTGTTTCCAGTCTATCATGATGG + Intergenic
1052848759 9:33362370-33362392 CTTTATCCATGCAGCCATGTTGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055820986 9:80263609-80263631 CTGTATCCATTCATCCATCAAGG - Intergenic
1057124467 9:92605527-92605549 CTTTCCCCATTCAATCATCTTGG - Intronic
1057571378 9:96206780-96206802 CTCTATCCCTTCATTCATTTAGG - Intergenic
1059885776 9:118743257-118743279 CTGGACACATTCAACCATGTTGG + Intergenic
1060002769 9:119973527-119973549 CTGAATGATTTCAATCATGTGGG + Intergenic
1188171934 X:26938353-26938375 CTTTATCCAGTCTATCATTTAGG - Intergenic
1188356400 X:29197059-29197081 CTGTGTCCCTTCAGTCTTGTTGG + Intronic
1188867080 X:35326602-35326624 CTGTATCCCTACAGCCATGTAGG + Intergenic
1190383279 X:49860353-49860375 GTTTATCCATTCACTCATGAAGG + Intergenic
1192911830 X:75612796-75612818 CTGTATCCAGTCTATCTTGATGG + Intergenic
1194181997 X:90722634-90722656 CTGAATCAATCCAATCATTTGGG + Intergenic
1195541079 X:106063626-106063648 CTTTATCCAGTCTATCATTTGGG + Intergenic
1197319009 X:125005594-125005616 CTGTTTCCATTCAGCCATCTTGG - Intergenic
1198410994 X:136368002-136368024 CTGTATCCATTCCACCATCAGGG + Intronic
1198999443 X:142616867-142616889 GTGTCTCAATTCAGTCATGTGGG + Intergenic
1199792581 X:151169058-151169080 TTGTATCCATGCCATCTTGTAGG - Intergenic
1200528624 Y:4304544-4304566 CTGAATCAATCCAATCATTTGGG + Intergenic
1200867708 Y:8062882-8062904 GTGAATCCATACAAGCATGTAGG + Intergenic
1201398026 Y:13570722-13570744 CTGTTCCTATTCAGTCATGTTGG - Intergenic
1202260113 Y:22961437-22961459 ATGAATCCATACAAGCATGTTGG + Intergenic
1202262788 Y:22987148-22987170 ATGAATCCATACAAACATGTAGG + Intronic
1202413100 Y:24595178-24595200 ATGAATCCATACAAGCATGTTGG + Intergenic
1202415778 Y:24620889-24620911 ATGAATCCATACAAACATGTAGG + Intronic
1202455009 Y:25049197-25049219 ATGAATCCATACAAACATGTAGG - Intronic
1202457682 Y:25074890-25074912 ATGAATCCATACAAGCATGTTGG - Intergenic