ID: 1173642951

View in Genome Browser
Species Human (GRCh38)
Location 20:44616265-44616287
Sequence CATTATGCTCAGTGGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173642951_1173642957 10 Left 1173642951 20:44616265-44616287 CCATGAGCCCACTGAGCATAATG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1173642957 20:44616298-44616320 AGACTGAGCTTCTCCAGCACAGG 0: 1
1: 0
2: 5
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173642951 Original CRISPR CATTATGCTCAGTGGGCTCA TGG (reversed) Intronic
903416292 1:23185478-23185500 CATTTTGCTCACTGAGCTAAGGG - Intergenic
903483445 1:23671290-23671312 CAGTATTCACAGTGTGCTCATGG + Intergenic
904680793 1:32227808-32227830 CATTATACTCAGTGGTGGCAAGG - Intronic
904890110 1:33773482-33773504 CATCATGCCCACTGGGTTCAGGG - Intronic
911218289 1:95219352-95219374 CATTAGGCTGAGAGGGCTCTGGG + Intronic
912635259 1:111285928-111285950 CATTCTTGTCAGTGGGGTCAGGG - Intergenic
913031376 1:114906840-114906862 AATTAGGCTCAGTTGGCTGATGG + Intronic
916548003 1:165824997-165825019 CATTCTGCTCAGTGGGCCTGGGG + Intronic
917059895 1:171026020-171026042 CATGATGCTAACTGGGGTCAAGG - Intronic
920247219 1:204597374-204597396 GGGTTTGCTCAGTGGGCTCATGG + Intergenic
920562574 1:206949231-206949253 CAGTAGGATCAGTGGGCTCCAGG - Intergenic
921179725 1:212622463-212622485 CAGGATGCTCAGTGGGCAAATGG - Intergenic
922605761 1:226888958-226888980 CATCATGATCAGTGCGCTCATGG + Exonic
1063937160 10:11089895-11089917 CATTATCCTAAGTGAACTCATGG + Intronic
1067051873 10:43026264-43026286 CCTTCTGCTCAGAGGGCCCAGGG + Intergenic
1067772072 10:49133825-49133847 CACTCTCCTCAGTGGACTCAGGG + Exonic
1069353035 10:67552310-67552332 CATTATTCCAAGTTGGCTCAAGG - Intronic
1070043455 10:72806024-72806046 CATTCTCCTCTGTGGGCTCCAGG - Intronic
1070619882 10:78001186-78001208 CCTTATGCTCAATGAGGTCATGG + Intronic
1073283316 10:102370540-102370562 CATCTTGCTGAGTGGGCTCTGGG + Intronic
1073627088 10:105110083-105110105 CATTTTCCTCAGTTTGCTCAGGG - Intronic
1074480416 10:113815280-113815302 CATGATGATCAGAGGGTTCAGGG - Intergenic
1075248260 10:120844147-120844169 CCTTATGCTCAGTGGGCATTTGG + Intergenic
1075678613 10:124316112-124316134 CACTGTGCCCAGTCGGCTCATGG - Intergenic
1079341652 11:19616658-19616680 CATTGTGCTCCTTGGTCTCAGGG - Intronic
1079704350 11:23595411-23595433 CCTAATGCTCAGAGGGCCCAGGG - Intergenic
1080311624 11:30900063-30900085 CATTATTCTCAGTCTTCTCAAGG + Intronic
1080471388 11:32549104-32549126 CATTATTCTCAGTGGGTAAAAGG + Intergenic
1080635427 11:34119298-34119320 CATGCTGCTCATTTGGCTCAGGG - Intronic
1083944423 11:65916126-65916148 TGTTTTCCTCAGTGGGCTCAGGG + Intergenic
1083998790 11:66284944-66284966 AATGATCCTCAGTGTGCTCACGG - Exonic
1087259074 11:95990580-95990602 ACATATCCTCAGTGGGCTCAAGG + Intronic
1088923577 11:114279613-114279635 CATTTGGCTCATTTGGCTCAAGG + Intronic
1089670409 11:120052928-120052950 CATAATGCTCTGAGGGGTCAAGG + Intergenic
1098418514 12:70264748-70264770 CATTATGCTGAGCGGGCAGAGGG + Intronic
1100480220 12:94970672-94970694 CCTTATCCTAAGGGGGCTCATGG + Intronic
1102020403 12:109678377-109678399 CGTGATTCTCAGGGGGCTCATGG - Intergenic
1102234738 12:111287246-111287268 CGTTTGGCTCAATGGGCTCATGG + Intronic
1103009113 12:117444406-117444428 CCTTAGGATCTGTGGGCTCAGGG - Intronic
1104749431 12:131229054-131229076 CATTCTTCCCAGTGGGCTCGTGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1114005649 14:18310363-18310385 CATTATTCTCATTGGGATTAGGG + Intergenic
1114252224 14:20971351-20971373 GATGATGCTCTCTGGGCTCATGG - Intergenic
1118169897 14:63378555-63378577 CATTATGCTCAGTTATCACACGG + Intronic
1119038999 14:71255295-71255317 CGTTCTTCCCAGTGGGCTCATGG - Intergenic
1119255524 14:73192773-73192795 CATTATGATTAGTGCCCTCATGG + Exonic
1121494843 14:94385157-94385179 AAATATGCTGAGTGGCCTCAGGG + Intronic
1122194348 14:100073970-100073992 CATTCTCTTCAGTGGGTTCAGGG + Intronic
1124002878 15:25773368-25773390 CATTGTGCTCTGTGGACACAAGG + Intronic
1128484663 15:68072948-68072970 CAGTATGCTCAGTAGGCACTGGG + Intronic
1128713529 15:69890051-69890073 CATATTGCTCAGTGGGTTCTGGG - Intergenic
1138798226 16:59995369-59995391 CAGTATTCTCAGTTGGCTTATGG - Intergenic
1138889719 16:61128038-61128060 CATTCTTCTCAGTGGGTTCGTGG + Intergenic
1140015705 16:71181625-71181647 CATTATGCTCTTTGAGCTTATGG - Intronic
1141267752 16:82512272-82512294 CAGTATCCTCAGTGGGCCCATGG + Intergenic
1142212949 16:88816965-88816987 CACTGTGCTCGGTGGGCTCTGGG + Intronic
1143001036 17:3795160-3795182 CAGGATGCTGAGGGGGCTCAGGG - Intronic
1144264481 17:13554955-13554977 CATTATTCTCAGGGGGCTTGAGG - Intronic
1146057222 17:29587542-29587564 CTGGATGCCCAGTGGGCTCAGGG - Intronic
1146500605 17:33361223-33361245 CATTATGGGAACTGGGCTCAGGG + Intronic
1147887935 17:43697170-43697192 CACTGTGCTCAGTGGGCACTGGG + Intergenic
1149548501 17:57522189-57522211 CATTATGCTCTGTAAACTCAAGG - Intronic
1152486717 17:80599362-80599384 CATTATGCTCACAGGTCCCATGG - Intronic
1152996676 18:413865-413887 AATTATGCTCAGTGGGGTTGGGG + Intronic
1154531780 18:15353520-15353542 CATTATTCTCATTGGGATTAGGG - Intergenic
1160280100 18:77481694-77481716 CATTATTCTTAGTGGGAGCAAGG - Intergenic
1167736918 19:51300409-51300431 CATTGTGTTCAGTGGGCTTCAGG + Intergenic
1168492225 19:56820711-56820733 CATCATTCTCAGTGTCCTCAAGG - Intronic
926552513 2:14317239-14317261 CAGTATGCTCACATGGCTCAAGG + Intergenic
929822605 2:45285367-45285389 CATGATGAACACTGGGCTCAAGG - Intergenic
930038165 2:47100721-47100743 CATTCCTCCCAGTGGGCTCATGG - Intronic
934945714 2:98539831-98539853 CAGTTTGCTCATTGGGATCATGG + Intronic
936172545 2:110189433-110189455 CATTCCTCCCAGTGGGCTCATGG + Intronic
936382074 2:111995200-111995222 CATTTAGCTCCGTGGGCCCAGGG - Intronic
936968626 2:118152330-118152352 TCTTATGCTCAATGGACTCAGGG + Intergenic
938530877 2:132184761-132184783 CATTATTCTCACTGGGATTAGGG - Intronic
938752203 2:134343438-134343460 CTTTATGCACACTGGGGTCAGGG + Intronic
939391414 2:141573384-141573406 CTTTATGCTCATTGGTTTCAAGG - Intronic
940695983 2:156979220-156979242 CCTTATTCTCAGTGGCCTCCAGG + Intergenic
941769465 2:169329677-169329699 CAGCCTGCTCACTGGGCTCAGGG - Intronic
1169073510 20:2748520-2748542 CAGTGTGGTCGGTGGGCTCAAGG - Intronic
1170703402 20:18724408-18724430 CATTCTGCTCAGAAGGCTGAGGG - Intronic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1173642951 20:44616265-44616287 CATTATGCTCAGTGGGCTCATGG - Intronic
1176765579 21:13014653-13014675 CATTATTCTCATTGGGATTACGG + Intergenic
1176906415 21:14507081-14507103 CATAATGCTGAATGGGCACAAGG + Intronic
1179038122 21:37777601-37777623 TATTATGCTCAGTTGACTCAAGG + Intronic
1180430158 22:15241169-15241191 CATTATTCTCATTGGGATTAGGG + Intergenic
1180512763 22:16109404-16109426 CATTATTCTCATTGGGATTAGGG + Intergenic
1181331552 22:22096372-22096394 CATTATCCTAAGTGAACTCAAGG + Intergenic
1182984125 22:34700486-34700508 CATAATTCTCAAGGGGCTCAAGG + Intergenic
1183058476 22:35321059-35321081 CACTATGCTAGCTGGGCTCAGGG + Intronic
951531403 3:23701774-23701796 CATTGTTCACAGGGGGCTCAGGG - Intergenic
951535320 3:23735359-23735381 CATTATGCTCTGTGGGGGTAGGG + Intergenic
951988220 3:28645051-28645073 CCTAATGCTCAGTGTGCTTATGG + Intergenic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
955988156 3:64596843-64596865 CCTTGTCCTCAGTGGGCTTATGG - Exonic
960479695 3:118172601-118172623 CATTCTGCCCAGTGGGTTCATGG - Intergenic
961640749 3:128363499-128363521 CATTCAGCTCAGTGGGCCCTTGG + Intronic
961700891 3:128743587-128743609 CAATATGCTCAGTGGACTAAAGG + Intronic
968350571 3:198048780-198048802 CATGAGATTCAGTGGGCTCAGGG - Intergenic
969120830 4:4909749-4909771 CTTTAGGGTCAGAGGGCTCAAGG + Intergenic
969604899 4:8197593-8197615 CAACATGCTCAGTGAGCACACGG - Intronic
969893591 4:10281987-10282009 GATTAGGATCACTGGGCTCAGGG - Intergenic
969893811 4:10284276-10284298 CCCTATACTCAATGGGCTCATGG + Intergenic
973993753 4:56436293-56436315 CATTATCCTAAGTGGGCTGAGGG - Exonic
979186710 4:117805296-117805318 CAATATGCTAAGTGTGCTAATGG + Intergenic
981646497 4:147004505-147004527 CATTAAGCTCAGTGGGTGCTGGG + Intergenic
985542021 5:491769-491791 CGTCTTCCTCAGTGGGCTCATGG - Exonic
985887189 5:2688800-2688822 CTGTATGCTCAGTGAGATCAGGG - Intergenic
988279377 5:29126676-29126698 CATTCCTCCCAGTGGGCTCATGG + Intergenic
990626923 5:57624006-57624028 CCTTCTGCTCAGTGTCCTCATGG - Intergenic
997816967 5:137028441-137028463 CAATATGTTCAGTGGCCTCTTGG + Intronic
999549586 5:152671618-152671640 CAATATTCCCATTGGGCTCATGG + Intergenic
1002355999 5:178629181-178629203 CATTTTGCTCAGTTGGTTTAAGG + Intronic
1005315699 6:24600699-24600721 CATTATACTCAGTTTGCTTATGG - Intronic
1007153107 6:39714656-39714678 TATTTTGTTCAGTGGGCTCGTGG - Intronic
1012001852 6:93663912-93663934 CATTATGCTGATTGGACCCAGGG + Intergenic
1012927019 6:105278060-105278082 CATTATGCCCAGTGGTTTCTTGG + Exonic
1018734679 6:166678802-166678824 CATGAAGCACAGGGGGCTCAAGG - Intronic
1019375206 7:687308-687330 AATTATGCTCAGTATGTTCAAGG + Intronic
1022497859 7:30864559-30864581 CCTTCTGCACGGTGGGCTCAAGG + Intronic
1023128106 7:36974847-36974869 CATTCTTCCCGGTGGGCTCATGG - Intronic
1023611508 7:41976483-41976505 CATTCTGCTCAGTGGACTTTTGG - Intronic
1024963124 7:54998568-54998590 TAGTATACTCAGTGGGCCCAAGG + Intergenic
1027345741 7:77257832-77257854 CACTATGCTCTGTGGATTCATGG - Intronic
1029528784 7:101111698-101111720 CACCATGCCCAGTGGGCTCCAGG - Intergenic
1030819160 7:114076221-114076243 CGTTCTTCTCGGTGGGCTCATGG + Intergenic
1031082748 7:117274459-117274481 CATGAGGCCCACTGGGCTCAGGG - Intergenic
1032062733 7:128738637-128738659 AATTATGCTTAGTGAGGTCAGGG + Intergenic
1032347066 7:131126210-131126232 CATTATTCTCATGGGTCTCACGG - Intronic
1033676678 7:143546785-143546807 CAGTATCCTGAGTGGGCTGAAGG + Intergenic
1033695155 7:143782648-143782670 CAGTATCCTGAGTGGGCTGAAGG - Intergenic
1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG + Intergenic
1035634508 8:1134109-1134131 CATTATCCTCAGTGAACTAATGG - Intergenic
1036016181 8:4787312-4787334 CATTATCCTGAGTGGGCTGAGGG - Intronic
1037625557 8:20603373-20603395 CGTTGTTCTCAGTGGGCTCCGGG - Intergenic
1039131644 8:34271663-34271685 TATTATTTTCAGTGGGCTCAAGG - Intergenic
1041435960 8:57841967-57841989 TATTCTGCTCAGAGGGCACATGG - Intergenic
1041458773 8:58088806-58088828 CTTTTTGATCAGAGGGCTCATGG + Intronic
1043606115 8:82002513-82002535 AATTATGCTCAGTGGGAGTATGG - Intergenic
1043777462 8:84287667-84287689 CATTATCCTCTGTGGACACATGG + Intronic
1047916592 8:129590648-129590670 CTTGAGGCTCAGAGGGCTCAAGG - Intergenic
1048028100 8:130605250-130605272 AATAATGCTCACTGGGCTCATGG - Intergenic
1049290197 8:141797708-141797730 CACTGTGCTCAGTGAGCACAGGG + Intergenic
1049515651 8:143053584-143053606 GATTTTACTGAGTGGGCTCATGG + Exonic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1049926000 9:407664-407686 CCCTATGCTCCGTGAGCTCATGG + Intronic
1053495428 9:38545315-38545337 CATCAGGCGCAGTGGGCTCCAGG - Intronic
1053709484 9:40791277-40791299 CATTATTCTCATTGGGATTAGGG - Intergenic
1054419389 9:64912068-64912090 CATTATTCTCATTGGGATTAGGG - Intergenic
1056032256 9:82565180-82565202 CATTAAGCTAGGTGGGCTCGTGG + Intergenic
1057123027 9:92594275-92594297 CATTCTTATCAGTGGGATCACGG + Intronic
1057720401 9:97527682-97527704 GACTTTGCTCAGTGGGTTCAGGG + Intronic
1059862572 9:118481314-118481336 GAATACACTCAGTGGGCTCAAGG - Intergenic
1189985486 X:46549797-46549819 CAATATGCTAAATGGGATCAGGG + Intergenic
1194497899 X:94639570-94639592 CATTGTCCTGAGTGGGCTGAGGG + Intergenic
1197009522 X:121544547-121544569 CAGTATTCCCACTGGGCTCATGG - Intergenic
1197314440 X:124947221-124947243 CATTAAGTGCAGAGGGCTCAGGG + Intronic
1198730464 X:139722481-139722503 CAGTATGCTCAGTGCGGGCAAGG - Intergenic
1199454635 X:148014505-148014527 GATTATGCTCTGTGCTCTCAAGG + Intronic