ID: 1173643158

View in Genome Browser
Species Human (GRCh38)
Location 20:44617429-44617451
Sequence GGAGTGCCAAACTCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173643158_1173643164 5 Left 1173643158 20:44617429-44617451 CCTGGGTGTGAGTTTGGCACTCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1173643164 20:44617457-44617479 ACCTGCACTGCTGGTCCAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 135
1173643158_1173643166 8 Left 1173643158 20:44617429-44617451 CCTGGGTGTGAGTTTGGCACTCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1173643166 20:44617460-44617482 TGCACTGCTGGTCCAGTGGGTGG 0: 1
1: 0
2: 1
3: 7
4: 161
1173643158_1173643167 12 Left 1173643158 20:44617429-44617451 CCTGGGTGTGAGTTTGGCACTCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1173643167 20:44617464-44617486 CTGCTGGTCCAGTGGGTGGCAGG 0: 1
1: 0
2: 4
3: 23
4: 255
1173643158_1173643159 -4 Left 1173643158 20:44617429-44617451 CCTGGGTGTGAGTTTGGCACTCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1173643159 20:44617448-44617470 CTCCCCTCAACCTGCACTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 238
1173643158_1173643163 4 Left 1173643158 20:44617429-44617451 CCTGGGTGTGAGTTTGGCACTCC 0: 1
1: 0
2: 1
3: 10
4: 162
Right 1173643163 20:44617456-44617478 AACCTGCACTGCTGGTCCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173643158 Original CRISPR GGAGTGCCAAACTCACACCC AGG (reversed) Intronic
900765772 1:4504216-4504238 GGAGAGCCAACACCACACCCCGG - Intergenic
901481823 1:9530434-9530456 GGAGTGCCTAACTCAGAGCTGGG - Intergenic
902692049 1:18116100-18116122 GCAGAGCCAGATTCACACCCAGG + Intronic
903203743 1:21764684-21764706 GGAGTGCCACTCTGTCACCCAGG - Intronic
903294179 1:22333198-22333220 GCAGAGCCCAACCCACACCCAGG + Intergenic
904311967 1:29634909-29634931 GCAGAGCCAGACTCAAACCCAGG + Intergenic
904349151 1:29893750-29893772 GCAGAGCCAGACTCAAACCCAGG + Intergenic
905863587 1:41365389-41365411 GGTGTGCCAGACTCAAACCAAGG + Intronic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
910632017 1:89364971-89364993 GGGGTGGGAAACTCACACACTGG - Intronic
910731332 1:90400411-90400433 GGAGGGGCACACTCACACCATGG - Intergenic
913218884 1:116643653-116643675 AGAAGGCCAAGCTCACACCCAGG - Intronic
915252676 1:154601818-154601840 GGATCCCCAAACTCAGACCCAGG - Exonic
917469697 1:175315920-175315942 GGAGGCCCAGACTCACACCATGG - Exonic
922067315 1:222156873-222156895 TGAGTGCCAGGCACACACCCAGG - Intergenic
922705205 1:227787013-227787035 ATAGTGCCACACTCACCCCCTGG + Intergenic
923946718 1:238896190-238896212 GGTGTGACTGACTCACACCCAGG - Intergenic
924875020 1:248093432-248093454 TCAGTGCAAAACTCAAACCCAGG - Intronic
1062874552 10:932764-932786 GAAGTCCCAACCCCACACCCGGG + Intergenic
1062916561 10:1244758-1244780 GGAGAGACGGACTCACACCCAGG + Intronic
1063958695 10:11288268-11288290 GGAGAGCCCAGCTCCCACCCAGG + Intronic
1070361550 10:75694994-75695016 GGTGTGGCAAACTCACACCCAGG - Intronic
1070697435 10:78573414-78573436 TGAGTGTCTAACTCACATCCAGG + Intergenic
1074160173 10:110830273-110830295 GGAGTGACAATGTCACAGCCAGG - Intronic
1075527873 10:123201545-123201567 GGAATGTCAAACAGACACCCTGG + Intergenic
1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG + Intronic
1083863960 11:65443572-65443594 GCAGTGACAACCTCTCACCCTGG - Intergenic
1090344738 11:126061187-126061209 ACACTGCCAAACACACACCCAGG + Intronic
1093025644 12:14242937-14242959 GGAGTGTCACACTCTCGCCCAGG - Intergenic
1095206004 12:39442131-39442153 GTATTTCCAGACTCACACCCTGG + Intronic
1097524219 12:60710349-60710371 GAAGTGCCAAACTCTGACTCTGG + Intergenic
1100271414 12:93028976-93028998 GGAGAGCCAAGCTCAGGCCCAGG + Intergenic
1100698075 12:97117148-97117170 GGAGTGACATACTTACATCCTGG - Intergenic
1103632457 12:122273273-122273295 GGAGTCTCAGACTCTCACCCAGG + Intronic
1104822377 12:131684552-131684574 GGAGAGCCAGGCTCACACTCAGG - Intergenic
1109761672 13:66837853-66837875 CAACTGCCAAACACACACCCAGG + Intronic
1110341515 13:74397193-74397215 GCAGAGCCAGACTCAAACCCAGG + Intergenic
1113195794 13:107804133-107804155 CAAGTGCCTAACCCACACCCTGG + Intronic
1113719963 13:112547713-112547735 CAAGTCCCAAATTCACACCCTGG + Exonic
1114405346 14:22451177-22451199 TGAGTGCCAAAGTCCCAGCCAGG - Intergenic
1117427250 14:55613517-55613539 GGAGTCTCACACTCTCACCCAGG + Intronic
1119538473 14:75422480-75422502 GGAGTGCTCAACTGACACCATGG - Intergenic
1124008339 15:25812100-25812122 AGAGTGCCAAACCCAAACCCTGG - Intronic
1124011556 15:25843245-25843267 GGAGTGCCGAGATCACACCCCGG - Intronic
1124351728 15:28960783-28960805 GGAGTGTCACACTGTCACCCAGG + Intronic
1125477173 15:40055196-40055218 GGAATGCCCAGCCCACACCCAGG - Intergenic
1126356464 15:47801611-47801633 GGAGAGCAAAACTCAGACACAGG + Intergenic
1126739380 15:51762121-51762143 AGAGTCTCACACTCACACCCAGG - Intronic
1126940579 15:53761096-53761118 GGAGTCCCACTCTGACACCCAGG - Intronic
1129246529 15:74282337-74282359 GCAGTGCCGGACTCACATCCCGG + Intronic
1129522754 15:76196169-76196191 GAGGTGCCAGACACACACCCTGG + Intronic
1130551633 15:84893270-84893292 GAAGTGCCAAGCTCACCTCCTGG + Intronic
1131255561 15:90859753-90859775 TGAGGGCCAGACTCCCACCCTGG + Intergenic
1134689272 16:16180516-16180538 GGAGTTCCACTCTGACACCCAGG + Intronic
1135480279 16:22815617-22815639 GGAGTCTCAATCTCAAACCCAGG + Intronic
1136070229 16:27783020-27783042 GGGGTTGCAAACTCACACGCTGG - Intergenic
1141507185 16:84485536-84485558 GGAATGCCAAAGGCAAACCCTGG + Intronic
1142628656 17:1208860-1208882 GGAGTCTCACACTCTCACCCAGG - Intronic
1146717606 17:35099585-35099607 GGAGTGGCAAACTGGCACCAGGG - Intronic
1149420111 17:56502294-56502316 GAAGTGCCAAACTCTCACGTTGG + Intronic
1149577152 17:57722320-57722342 GGAGTGACCAACTCTCTCCCAGG - Intergenic
1152102164 17:78308382-78308404 TGGGTGCCAAACTCACTCCCAGG + Intergenic
1155663687 18:28281953-28281975 GGGTGGCCAGACTCACACCCAGG + Intergenic
1157816893 18:50736132-50736154 GGAGTGGAAAACTCACAGCATGG - Intergenic
1158363403 18:56702747-56702769 CTAGTGCCAAATTCAGACCCTGG + Intronic
1158758116 18:60350718-60350740 GGACTCCAAAACTCAAACCCAGG - Intergenic
1159404164 18:67977816-67977838 GGAGTGGCCAACTCTCACCACGG - Intergenic
1160304783 18:77722327-77722349 GGAGTGCCAGGCTGTCACCCAGG + Intergenic
1161076680 19:2289323-2289345 TGAGAGCAAAGCTCACACCCGGG - Intronic
1161392878 19:4030591-4030613 GGAGTCTCACACTCTCACCCAGG - Intronic
1164008110 19:21170697-21170719 GGAGTGTCAATCTGTCACCCAGG + Intronic
1165396064 19:35564179-35564201 GGAGTGTCACTCTGACACCCAGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1166443494 19:42837635-42837657 GGAGTGTCACTCTCTCACCCAGG + Intronic
1167217313 19:48173238-48173260 GGAGAGCCAGAATCACACCCAGG + Intronic
1168401816 19:56089547-56089569 AGGGTGCCAAACCCACTCCCTGG - Intronic
925754872 2:7123599-7123621 GGAGGACCAAACCCACACTCAGG + Intergenic
927161690 2:20269224-20269246 GGAGTGCCACTCTGTCACCCAGG + Intronic
930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG + Intergenic
931623274 2:64232268-64232290 GGAGTCCCACACTGTCACCCAGG - Intergenic
931788763 2:65644904-65644926 GTAATGCCCAACTCCCACCCGGG - Intergenic
938552209 2:132392821-132392843 GGAGTGCTAAGCTGGCACCCTGG + Intergenic
938669291 2:133571784-133571806 GGAGTGGCAGACTCAGACGCTGG - Intergenic
941723318 2:168835453-168835475 GTAGTAACAAACTCACAACCAGG + Intronic
941960570 2:171249473-171249495 GGAGTGCCAGAAACACACCCAGG + Intergenic
942315898 2:174696347-174696369 AGACTGCCGAATTCACACCCTGG + Intergenic
943715139 2:191143426-191143448 GGGGAGGCAGACTCACACCCAGG - Intronic
943897817 2:193389813-193389835 AAAGTACCAAACTTACACCCGGG + Intergenic
944840102 2:203616451-203616473 CGAGCACCAAACTCCCACCCGGG - Intergenic
945347182 2:208732145-208732167 GGAGTGACCAACTCTCACCATGG - Intronic
945377609 2:209097301-209097323 GGAGCCCAAAACTCTCACCCTGG + Intergenic
948163846 2:235845838-235845860 GGAGGCCCAAACACACATCCAGG - Intronic
948472493 2:238192985-238193007 GGAGTCTCACACTCTCACCCAGG - Intronic
949058707 2:241944063-241944085 CCAGTGCCAAACACACACCCTGG - Intergenic
1168852070 20:983910-983932 TGAGTGGCAAACTCAAAGCCAGG + Intronic
1169171447 20:3468995-3469017 GGATTTCCACACTCATACCCAGG - Intergenic
1169468809 20:5865004-5865026 GGAATGACACACTCACACTCAGG + Intergenic
1171543092 20:25979446-25979468 GGACTGCTAGAGTCACACCCTGG - Intergenic
1173643158 20:44617429-44617451 GGAGTGCCAAACTCACACCCAGG - Intronic
1174043377 20:47715605-47715627 GGAGTCCCACACTGTCACCCAGG + Intronic
1174487608 20:50871129-50871151 GGAGCAGCAAACTCAAACCCTGG - Intronic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1177654429 21:23999275-23999297 GGAATGCCAAACTCTCTTCCAGG + Intergenic
1178162783 21:29939002-29939024 GGACTGCCAGACGCCCACCCAGG + Intronic
1178678046 21:34647516-34647538 GGAGTGCCCAACTGGGACCCAGG - Intergenic
1179510617 21:41870851-41870873 GCAGAGGCAGACTCACACCCTGG - Intronic
1179652360 21:42819823-42819845 GGAGTCCCACACTATCACCCAGG - Intergenic
1180150056 21:45942882-45942904 GGAGGGCCTGAGTCACACCCAGG - Intergenic
1181165014 22:20978588-20978610 GGACTGCCAGACTCCCAGCCTGG + Intronic
1182259734 22:29064877-29064899 GGAGTCCCAATCTGTCACCCAGG + Intergenic
1183620448 22:38968954-38968976 GGAGTGCAAAGCCCACAACCTGG - Intronic
957608626 3:82437511-82437533 GGATTGGCAAACTTAGACCCTGG - Intergenic
958593870 3:96196809-96196831 GGTGTGCTTAACTCACTCCCAGG + Intergenic
959322515 3:104895073-104895095 GGAGTCCCACTCTGACACCCAGG - Intergenic
963054497 3:141174752-141174774 GGAGGGCCCAATTCACACCGTGG - Intergenic
964408582 3:156375843-156375865 GGAGTGCCACTCTGTCACCCAGG + Intronic
965147841 3:164928667-164928689 GGAGTGGCCAACTCTCACCAGGG - Intergenic
969377866 4:6775124-6775146 GGTGTGCCAAAGTCACACAGCGG - Intergenic
970458686 4:16251300-16251322 GGAGTCTCACACTCTCACCCAGG + Intergenic
973788700 4:54358727-54358749 GGAGTGCCAGACTCTGACCATGG + Intergenic
976850854 4:89542613-89542635 TGAGGGCCAGCCTCACACCCAGG - Intergenic
984141064 4:176004325-176004347 GGAATGCAAAATTCATACCCAGG + Intergenic
985010957 4:185581472-185581494 GGAGTGACAAAGTCACCCACAGG + Intergenic
985883783 5:2660213-2660235 GCAGTGCCAAGATCACACCTAGG + Intergenic
990332992 5:54745750-54745772 GAAGTGCCAAAGACAGACCCTGG - Intergenic
992099169 5:73389724-73389746 GGAGTCTCACTCTCACACCCAGG - Intergenic
992780748 5:80124837-80124859 ACAGTGCCCAACTCCCACCCAGG + Intronic
993766707 5:91868388-91868410 TGAGTGACAAAGTCACACACAGG - Intergenic
997469452 5:134108776-134108798 GGATGGCCAAACTCTCCCCCAGG + Intergenic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
999388376 5:151171944-151171966 GGAGACCCAGACTCAAACCCAGG - Intergenic
1000019733 5:157308868-157308890 GCAGAGCCAGACTTACACCCAGG - Intronic
1002038279 5:176490283-176490305 GGAGTCCCACTCTCTCACCCAGG - Intronic
1002350898 5:178582917-178582939 TGAGTGCCAAACCCACACACAGG + Intronic
1004870784 6:19901822-19901844 GGAGTGCAAGTCTCCCACCCTGG + Intergenic
1005782704 6:29209603-29209625 GGAGTGCAACACTCACTCTCTGG - Intergenic
1006140693 6:31927830-31927852 GGAGCACCAACCTCACACACAGG - Intronic
1006440908 6:34053230-34053252 GCAGAGCCAGACTCAGACCCAGG + Intronic
1006510899 6:34520481-34520503 GCAGAGCCAGACTCAGACCCAGG - Intronic
1006599866 6:35218192-35218214 ACATTCCCAAACTCACACCCAGG - Intronic
1008098738 6:47368514-47368536 GGAGTCTCACACTCTCACCCAGG - Intergenic
1017250860 6:152278184-152278206 GGAGGGCAAAGCTCACACCAAGG - Exonic
1017492211 6:154954754-154954776 TGTGTGCCAAACTCACACTGTGG + Intronic
1019338928 7:499124-499146 GGAGTGCCAGCCTCTCACCATGG + Intronic
1022742025 7:33131131-33131153 CGAATGCCAAACTCACCCTCTGG - Intronic
1024259548 7:47563545-47563567 GGAGATCCAATCTCACCCCCAGG + Intronic
1024322420 7:48084374-48084396 GGAGTCTCACACTCTCACCCAGG - Intergenic
1026050645 7:66943815-66943837 GGAGTGTCACTCTGACACCCAGG + Intronic
1026883279 7:73920757-73920779 GGAGGTCCAAACACACAACCAGG + Intergenic
1029677469 7:102080203-102080225 GGAGTCCCCAAGTCACATCCAGG - Intronic
1030494790 7:110285509-110285531 GGAGTCCCATACTGTCACCCGGG + Intergenic
1033507177 7:142016616-142016638 GGAGTGCCACTCTGTCACCCAGG + Intronic
1033851701 7:145504439-145504461 GTAGTGGTAAACTCACAGCCAGG - Intergenic
1034100504 7:148446106-148446128 GGAGTGCCAAGGTGACACCGGGG - Intergenic
1034300569 7:150011557-150011579 GGAGTCTCAAACTGTCACCCAGG - Intergenic
1037517532 8:19647919-19647941 GTTGTGCCAATCTCAGACCCTGG + Intronic
1037569205 8:20144450-20144472 GCAGTGCAAAAATCAGACCCTGG + Intergenic
1042093728 8:65189035-65189057 GAAATGCCAAACTCACAGCCTGG + Intergenic
1044091789 8:88011164-88011186 GGAGTGTCACACTGTCACCCAGG + Intergenic
1047976219 8:130133352-130133374 TGAGTGCAAAACTCCAACCCAGG + Intronic
1049293691 8:141818173-141818195 GGAGTGCCAAGCTCAACCCCAGG + Intergenic
1052294782 9:26885100-26885122 GGAGTGTCACACTGTCACCCCGG + Intronic
1056184306 9:84118712-84118734 GGAGTGTCACTCTCTCACCCAGG + Intergenic
1056396881 9:86189290-86189312 GGAGTGCCACTCTGTCACCCAGG - Intergenic
1058965253 9:110031428-110031450 GGAGATCAAAACTCACACTCTGG - Intronic
1060637474 9:125210861-125210883 GGAGTCTCAAACTGTCACCCAGG + Intronic
1062687241 9:137820120-137820142 GGACTGCCAACCTCAACCCCAGG + Intronic
1185958222 X:4515599-4515621 GGATAGCCAAACACACACCTAGG - Intergenic
1186754379 X:12654777-12654799 GGACTGCCAAAATGCCACCCTGG + Intronic
1191256659 X:58282453-58282475 GGAGTCCCTGACTCCCACCCTGG - Intergenic
1200759838 Y:7027654-7027676 GGAGTGTCACACTGTCACCCAGG - Intronic
1201285218 Y:12373676-12373698 GGAATGCACAATTCACACCCTGG - Intergenic
1201764233 Y:17564191-17564213 GGAGTCCCTAGCTCGCACCCAGG - Intergenic
1201837320 Y:18341799-18341821 GGAGTCCCTAGCTCGCACCCAGG + Intergenic