ID: 1173643374

View in Genome Browser
Species Human (GRCh38)
Location 20:44618630-44618652
Sequence CTGGCGCCGGGACTTGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173643366_1173643374 -1 Left 1173643366 20:44618608-44618630 CCACAAGATGTTATTTATTGAGC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 232
1173643365_1173643374 25 Left 1173643365 20:44618582-44618604 CCAGGTACACTTTCAAGACACTG 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 232
1173643364_1173643374 26 Left 1173643364 20:44618581-44618603 CCCAGGTACACTTTCAAGACACT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173643374 Original CRISPR CTGGCGCCGGGACTTGGGCG GGG Exonic
900108377 1:995793-995815 CTGGAGCCGGGGCTTGTGAGAGG - Intergenic
900394571 1:2447904-2447926 CTGGCTGCGGGACTTTGGCAGGG + Intronic
900513374 1:3070445-3070467 CTGCAGCCGGGGCTTCGGCGGGG - Intronic
901068309 1:6505103-6505125 CTGGGGCCGGGGCCTGGGCCTGG - Intronic
902082234 1:13829039-13829061 CTGGAGCCTGGACTTGAGGGAGG - Intergenic
903191582 1:21659462-21659484 CTGGCGCCGGGGAGAGGGCGAGG - Intronic
907294080 1:53438680-53438702 CTGGCTCTGGGGCTTGGGCACGG + Intergenic
911164168 1:94710277-94710299 CTGGCGCCGAGAAGAGGGCGTGG + Intergenic
915596130 1:156897509-156897531 CTGGTGCCAGGACTTTGGCTGGG + Intronic
916792628 1:168137033-168137055 GGGGCGCCGGGAGCTGGGCGGGG - Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918001648 1:180502610-180502632 CTGGCGCTGGGCCGTGGGGGCGG + Exonic
922116345 1:222617991-222618013 CTGGGGCGGGGGCTGGGGCGGGG - Intergenic
922726510 1:227925380-227925402 GTGCCGCCGGGACCCGGGCGTGG - Exonic
923517441 1:234709545-234709567 CAGGCTCAGGGACTTGGGCTTGG + Intergenic
1063393675 10:5666581-5666603 TGGGCGCCGGGACCTGGGCCGGG + Intronic
1067407444 10:46036108-46036130 CTGGCTCCCTGACTTGGGTGAGG - Intronic
1068938353 10:62657592-62657614 CCGGCGCCGGGAGTGGGGAGAGG - Intronic
1072525047 10:96263973-96263995 CTGGAGCAGGGACTTGGGTAGGG + Intronic
1072677295 10:97477405-97477427 CTGTGGCAGGGACTTGGGGGTGG + Exonic
1075690224 10:124389307-124389329 CTGGGGCGGGGCCGTGGGCGGGG - Intergenic
1076000059 10:126906432-126906454 CTGGTGTCGGGACTGGGCCGTGG + Intronic
1076333748 10:129691356-129691378 CTGGCAACAGGACTTGGGAGAGG + Intronic
1076891986 10:133289395-133289417 GTGGCGCGGGGACTTGGACTCGG - Intronic
1077352062 11:2097619-2097641 CAGGCGCCCGGACCTGGGTGGGG - Intergenic
1078449875 11:11432848-11432870 CTGGAGCCAGGACATGGGCTGGG - Intronic
1080497043 11:32830183-32830205 CTGGCGGCAGGACCTCGGCGGGG + Intronic
1082238965 11:49852295-49852317 CTGGCGCTGGAAGGTGGGCGCGG - Intergenic
1082243176 11:49892034-49892056 CTGGCGCTGCAAGTTGGGCGCGG + Intergenic
1083655158 11:64225993-64226015 CTGCAGCAGGGACTTGGGGGTGG - Intronic
1083747714 11:64744869-64744891 CTGGCGCGGGGGCGGGGGCGGGG - Intronic
1084110343 11:67010354-67010376 CTGGAGCCTGGACCTGGGCAAGG - Intronic
1084174782 11:67417526-67417548 CTGGCGCCAGGACGTGGGCCTGG + Exonic
1084238797 11:67805304-67805326 CGGGCGCCATGACGTGGGCGGGG + Intergenic
1084360908 11:68667982-68668004 CTGGCGGGGGGACTTGCACGGGG - Intergenic
1085208144 11:74749306-74749328 CCCGCGCCGGGACGGGGGCGCGG + Exonic
1091267354 11:134281716-134281738 CTGGCGCCTGGGCTGGGGCAGGG + Intronic
1092242489 12:6843715-6843737 CTGGTGCTGGGGCTTGGGAGTGG + Intronic
1092409484 12:8242935-8242957 CGGGCGCCATGACGTGGGCGGGG + Intergenic
1093464842 12:19439370-19439392 CAGGCGCCGGGGCGGGGGCGGGG + Intronic
1095180775 12:39144883-39144905 AGGGCGCCGGGACTGGGGAGGGG + Intergenic
1095741473 12:45611259-45611281 CTGGCGCTGGGGCTGGGGCTGGG + Intergenic
1096971531 12:55670400-55670422 CTGGGGCAGGGACTGGGGCTGGG - Intergenic
1100611649 12:96195315-96195337 CTGGGGCGGTGACCTGGGCGGGG - Intronic
1102026806 12:109718352-109718374 CGGGGGCTGGGACTTGGCCGGGG + Intronic
1102030362 12:109736811-109736833 CTTGCGCCGGGAGCTGGCCGTGG + Intronic
1102238742 12:111310560-111310582 CTTGCGCCAGGGCTTGGGCCGGG - Exonic
1102519144 12:113468178-113468200 GTGGCGCGTGGGCTTGGGCGTGG + Exonic
1102977486 12:117217003-117217025 CTGTGGCAGGGACTGGGGCGGGG + Intronic
1104734878 12:131130660-131130682 CTGGCGCGGGCACCTAGGCGAGG + Intronic
1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG + Intronic
1108354801 13:49620490-49620512 TTGGCGCCGGGTCCTGGGTGTGG - Intergenic
1114624977 14:24123113-24123135 CTGGGGCTTGGACTTGGGTGGGG + Intronic
1118457613 14:65959026-65959048 CTTGCGCGGGGACTTGTGAGGGG - Intronic
1118752690 14:68818134-68818156 CTGGAGCTGAGACTGGGGCGGGG - Intergenic
1119778126 14:77260666-77260688 CTGGGGACGGGACTGGGGCAGGG + Intergenic
1122296831 14:100710542-100710564 CTGGCGCTGGGCTTTGGGAGTGG - Intergenic
1123739882 15:23226180-23226202 CTGGGGCAGGGACAGGGGCGGGG - Intergenic
1124291091 15:28455118-28455140 CTGGGTCGGGGACTGGGGCGGGG - Intergenic
1124291105 15:28455148-28455170 CTGGGGCAGGGACAGGGGCGGGG - Intergenic
1128506660 15:68277783-68277805 GCGGCGCCGGAACTTGGGCGGGG - Exonic
1129364740 15:75047390-75047412 CTGTCCCTGGGACTTGGGGGAGG + Intronic
1129677987 15:77642686-77642708 CTGGGACCGGCACTTGGGCTTGG + Intronic
1129985727 15:79918465-79918487 CTGGCCCCTGGCCTTGGGCTGGG + Intronic
1130411645 15:83653567-83653589 CTGGCGCCCGGGTCTGGGCGGGG + Intergenic
1130531116 15:84748504-84748526 CTGGCGGCGGGACCTGGCTGGGG - Intergenic
1131144314 15:90001634-90001656 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
1133350461 16:5097730-5097752 CGGGCGCCATGACGTGGGCGGGG + Exonic
1135335801 16:21599906-21599928 CTGGGGCCGGGGCCGGGGCGGGG + Intronic
1135644810 16:24152575-24152597 CTGGGGCCGGGACATGTGCAGGG - Intronic
1136453894 16:30369943-30369965 CTGGGGCCGGGGCTGGGGCCGGG + Exonic
1136707666 16:32202514-32202536 CTGGGGCGGGGACGGGGGCGGGG + Intergenic
1136760244 16:32726896-32726918 CTGGGGCGGGGACGGGGGCGGGG - Intergenic
1136807860 16:33143490-33143512 CTGGGGCGGGGACGGGGGCGGGG + Intergenic
1141546987 16:84776756-84776778 CTCGCCCCGGGACCTGGGCCTGG + Intronic
1141972316 16:87492390-87492412 CGGGCGCCGGGGCGGGGGCGGGG + Intergenic
1142044229 16:87914760-87914782 CTGGCGGCTGGGCTTGGGAGGGG + Intronic
1142177295 16:88651083-88651105 CTGGGGGCGGGGCCTGGGCGGGG - Exonic
1142223254 16:88865479-88865501 CTGGCGCCCGGCCATGGGCCAGG - Intronic
1142271042 16:89089401-89089423 CTGGGGAGGGGCCTTGGGCGGGG - Intronic
1203062398 16_KI270728v1_random:987218-987240 CTGGGGCGGGGACGGGGGCGGGG - Intergenic
1142812561 17:2402019-2402041 CTGGGGCCGGGGCCAGGGCGGGG + Intergenic
1142855102 17:2724697-2724719 GTGGCGCCGGGGCCCGGGCGCGG + Intergenic
1143186304 17:5012513-5012535 CTGGAGCCGGGACATGGAGGAGG + Intronic
1145886442 17:28385296-28385318 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
1146062210 17:29613359-29613381 CTGGCGCTGCGGCGTGGGCGGGG - Exonic
1146062273 17:29613619-29613641 CTGGCTCCTGGCCCTGGGCGTGG - Exonic
1146445279 17:32928063-32928085 CTGGCGGCGGGGATTTGGCGCGG + Exonic
1150230958 17:63550264-63550286 CTGCCTCCGAGAGTTGGGCGGGG + Intergenic
1150474089 17:65461157-65461179 CTGGGGCCAGGACTAGGGTGAGG - Intergenic
1150479065 17:65495867-65495889 CTGGAGCGGGGACCTGGGCTGGG - Intergenic
1150692307 17:67377282-67377304 CTGGGGCCGGGAGGTGGGTGCGG - Intronic
1151662519 17:75526157-75526179 CTGGCGCCTGCACGTGGGCCCGG - Intronic
1152357483 17:79813925-79813947 CTGGTGCTGGGGCTTGGGCGCGG - Intergenic
1152362682 17:79839776-79839798 CGGGCACCGGGATGTGGGCGAGG - Intergenic
1154353670 18:13608393-13608415 CTGGGGCTGGGACCTGGGCTGGG + Intronic
1158648538 18:59267805-59267827 TTGGCGCCGGCTCTAGGGCGAGG - Exonic
1160556505 18:79729081-79729103 CTGGCGCGGGCACCGGGGCGTGG - Intronic
1160763738 19:798047-798069 CTGGCGCCGGGGCCTCGCCGCGG + Intronic
1161043712 19:2123490-2123512 CTGACGCCGGGCCTTAGGCCAGG - Intronic
1162348338 19:10134346-10134368 CTGCCCCCGGGCCTTGGGCCTGG - Intronic
1163513322 19:17748493-17748515 CTGGAGCCTGGACTTGGGGGGGG + Intronic
1163651789 19:18522074-18522096 CTGGAGCCGGGAAGGGGGCGCGG - Exonic
1163655744 19:18543732-18543754 CTGGGGCGGGGGCTGGGGCGGGG + Intronic
1163655751 19:18543744-18543766 CTGGGGCGGGGGCTGGGGCGGGG + Intronic
1163655758 19:18543756-18543778 CTGGGGCGGGGGCTGGGGCGGGG + Intronic
1166233295 19:41438403-41438425 CAGGCGCAGGGACTGGGGAGGGG + Exonic
1167258023 19:48442752-48442774 CTGGCGCCGGACCAAGGGCGCGG + Exonic
1167505663 19:49869843-49869865 CAGGCCCCGGGAGTGGGGCGGGG + Exonic
1167569138 19:50276114-50276136 GCAGCGCCGGGACCTGGGCGAGG + Exonic
1167691098 19:50983950-50983972 CTGGGGCCGGGCATGGGGCGGGG - Intronic
1168239362 19:55081534-55081556 CTGGAGGCGGGGCTAGGGCGTGG + Intronic
1168305615 19:55433504-55433526 CTGGCGCAGGGCCTCGGGCGAGG + Exonic
1168320129 19:55504051-55504073 GAGGCGCCGTGACTTGGGGGTGG + Intronic
925367303 2:3319597-3319619 CTGTAGCCGGTACTTGGGCATGG - Intronic
925414227 2:3658041-3658063 CTGGCTTCGGGCCTTGTGCGAGG + Intergenic
925984681 2:9206546-9206568 CTGGGGGCGGGGCATGGGCGCGG + Intergenic
927558018 2:24049699-24049721 CTGGAGTCGGGACCTGCGCGGGG - Exonic
927935082 2:27071781-27071803 CTGGGGCGGGGCCTCGGGCGCGG + Intergenic
930411055 2:51027457-51027479 CGGGGGCCGGGGCCTGGGCGGGG - Intronic
932144570 2:69306638-69306660 CTGGAGCCAGGACGTGGCCGTGG - Intergenic
934534560 2:95122033-95122055 CTGGCGGCCGGGCGTGGGCGGGG + Intronic
935653158 2:105399130-105399152 CTGGCACCGGGCGTGGGGCGCGG + Intronic
936234658 2:110732657-110732679 CCGGCGCCGGGTCTGGGGCTCGG + Exonic
939153924 2:138502135-138502157 CTGCCGCGGGGACTGGGGGGAGG - Intronic
941658783 2:168172944-168172966 CTGGGGCCGGGACTCAGGTGTGG - Intronic
942565860 2:177264481-177264503 GTGGTGCCGGGACGGGGGCGGGG - Intronic
944906059 2:204263335-204263357 CTGGGGCTGGGACTTGGGGTTGG + Intergenic
946173208 2:217907489-217907511 CTGGCGCCGGGCACTGAGCGTGG - Intronic
948697271 2:239738138-239738160 CTGGGGCCGGGGCTGGGGCTGGG - Intergenic
948697281 2:239738156-239738178 CTGGGGCCGGGGCTGGGGCTGGG - Intergenic
948839556 2:240642339-240642361 GTGGGGCCGGGACGTGGGTGGGG - Intergenic
1170144558 20:13158713-13158735 CTGGCTCCCTGGCTTGGGCGAGG - Intronic
1170211289 20:13848631-13848653 CTGGAGCCGGGATTTGAGCCTGG + Intergenic
1172274942 20:33674287-33674309 CTGGGGCTGGGGCTGGGGCGCGG + Exonic
1172487401 20:35306625-35306647 CTGTTGCCAGGACTTGGGAGGGG + Intronic
1173605162 20:44326682-44326704 CTGGCGCCAGGACACGGCCGCGG + Intergenic
1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG + Exonic
1174667298 20:52271961-52271983 CTAGGGCCAGGACTTGGGCAGGG + Intergenic
1175242927 20:57562992-57563014 CTGGCGCACTGACTTGGGAGGGG + Intronic
1175518993 20:59587746-59587768 CTGGAGCCGGGGCTGGGGCTGGG + Intronic
1176168276 20:63685738-63685760 CTGCCCCCAGGACATGGGCGGGG + Intronic
1179657432 21:42853886-42853908 CCGGCGCCGGCATTTGGGAGTGG - Intronic
1179934333 21:44592708-44592730 CTGGCGGCAGGAATTGGGCGGGG + Intronic
1180108708 21:45637555-45637577 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108725 21:45637611-45637633 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108742 21:45637667-45637689 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108759 21:45637723-45637745 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108776 21:45637779-45637801 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108793 21:45637835-45637857 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180108810 21:45637891-45637913 CCGGCCCCGGGACTCGGGAGTGG + Intergenic
1180256853 21:46635608-46635630 GGGGCGCCGGGCCCTGGGCGGGG + Intronic
1180834027 22:18920906-18920928 GTGGCGCTGGGACCTGGGGGAGG - Intronic
1180867105 22:19126020-19126042 CTGGGGCTGGGGCTTGGGCTGGG + Intergenic
1180956142 22:19742249-19742271 CTGGAGGCGGGACATGGCCGAGG - Intergenic
1181065791 22:20305333-20305355 GTGGCGCTGGGACCTGGGGGAGG + Intergenic
1181631935 22:24156095-24156117 CGGGGGCCGGGACTGGGGCCGGG + Intronic
1181631941 22:24156107-24156129 CTGGGGCCGGGACTGGGGCCGGG + Intronic
1181797032 22:25318598-25318620 CTGGTCCCGGGACCTGGGCTGGG + Intergenic
1182358777 22:29734824-29734846 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
1183642516 22:39101146-39101168 CGGGGGCCGGGACGGGGGCGGGG - Intronic
1184894567 22:47399587-47399609 CTGGCCCAGGGCCTCGGGCGGGG + Intergenic
1185191172 22:49437527-49437549 CTGGCGTCGTGACTGGGACGGGG - Intronic
1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG + Exonic
1203284115 22_KI270734v1_random:146204-146226 GTGGCGCTGGGACCTGGGGGAGG - Intergenic
950046612 3:9952056-9952078 CTGCCGCAGGGACTGGGGAGAGG + Intronic
950365084 3:12477452-12477474 CTGGTGCCGGAAAGTGGGCGTGG + Intergenic
950770222 3:15305399-15305421 CTGGTGCTGGGCCTTGGGCGTGG + Intronic
954252557 3:49379361-49379383 CTAGGGCAGGGACTTGGGGGTGG + Intronic
954404518 3:50337934-50337956 CGGGCCCCGGGACCTGGGCTGGG - Exonic
954575009 3:51671167-51671189 CTCGCGGCGGGACATGGCCGTGG - Intronic
954610356 3:51941802-51941824 CTGGGGCCGGGGCTGGCGCGGGG - Exonic
957054749 3:75435101-75435123 CGGGCGCCATGACGTGGGCGGGG + Intergenic
961300102 3:125916611-125916633 CGGGCGCCATGACGTGGGCGGGG - Intergenic
961888404 3:130111463-130111485 CAGGCGCCATGACGTGGGCGGGG + Intronic
968008880 3:195260294-195260316 CGGGCGTCGGGCGTTGGGCGGGG - Intronic
968372665 4:10566-10588 GTTGCGCCGGGGCGTGGGCGCGG + Intergenic
968538816 4:1151773-1151795 CTGCAGCTGGGACTTGGGTGGGG + Intergenic
969422124 4:7103503-7103525 CTGGCTCCGCGACGAGGGCGGGG - Intergenic
976267082 4:83194789-83194811 CTGGCGCCGTGCCCTGGGCCTGG + Intergenic
980405064 4:132344900-132344922 CTGGGGCCGGGGCTGGGGCCGGG + Intergenic
980405071 4:132344912-132344934 CTGGGGCCGGGGCTGGGGCCGGG + Intergenic
981119711 4:141035862-141035884 CTGGGGCCAGGCCTGGGGCGGGG + Intronic
981315329 4:143335983-143336005 GAGGCACCGGGGCTTGGGCGCGG - Intergenic
982288741 4:153759771-153759793 CTGGCGCGGGGGCGCGGGCGTGG - Intronic
985084316 4:186297460-186297482 CTGGCCCCGGGGCTCGGGCTGGG - Intergenic
985610918 5:888114-888136 CTGGAACCGGGACTTGGGGAGGG - Intronic
985725858 5:1515474-1515496 CTGGGGGTGGGACTTGGGCCAGG - Intronic
986733277 5:10650132-10650154 CTGGGGCCGGGGCTGGGGCCGGG + Exonic
986833244 5:11605838-11605860 CAGGACCAGGGACTTGGGCGGGG - Intronic
990211106 5:53482013-53482035 CTGGTGCCCGGACGTGGGCGCGG + Intronic
990825452 5:59893413-59893435 CTGGGGCTGGGGCTGGGGCGAGG + Exonic
992939571 5:81750247-81750269 CTGGGGCTGGGGCTGGGGCGGGG - Intronic
993384918 5:87252083-87252105 TTGGCGCCGGGAGTGGGGAGAGG + Intergenic
993727128 5:91380989-91381011 CTCGCGCCGCGGCTGGGGCGAGG - Intronic
998388390 5:141771733-141771755 CTGGGCCCAGGACTTGGGCCAGG - Intergenic
1001134808 5:169093456-169093478 CTGGGGCAGGGGCTTGGGGGTGG + Intronic
1002784530 6:391690-391712 CTGGGGCGGGGCCTGGGGCGGGG - Intergenic
1003218384 6:4135667-4135689 GTGGAGCCGGGACTCGGGGGCGG + Intergenic
1003218410 6:4135722-4135744 GTGGGGCCGGGGCTTGGGTGCGG + Intergenic
1006379113 6:33687572-33687594 CTGGCCCCGAGACTGGGGTGGGG + Intronic
1007967225 6:46014545-46014567 CAGTCGCCAGGACTTGGGGGAGG - Intronic
1008879966 6:56371898-56371920 GTGGAGCAGGGACTTGGGTGTGG - Intronic
1011044669 6:83068001-83068023 CTGGGGCCGGGGCCTGGGCCGGG + Intronic
1015315124 6:131808282-131808304 CGGGCGCCGGGGCCTGGCCGCGG - Intronic
1018462605 6:164013141-164013163 CTGGCGCCGCGTCCTGGGCCTGG - Intergenic
1019669894 7:2271814-2271836 CCGGGGCCGGGACATGGGCAGGG + Intronic
1021969625 7:25952695-25952717 CTGCCGCCGGGCCTTGACCGAGG - Intergenic
1024323267 7:48089695-48089717 CCGTCGCCGGGACGTGGGAGAGG - Intronic
1024580089 7:50793738-50793760 CTGTCCTCGGGACTCGGGCGCGG + Intergenic
1024952648 7:54880578-54880600 CTGGCGCCGTGCCCTGGGCCTGG - Intergenic
1025284260 7:57649666-57649688 CTGGGGCTGGGGCTTGGGCTTGG - Intergenic
1034201417 7:149285240-149285262 CTGGCTTCGGGATGTGGGCGGGG + Intronic
1034257023 7:149730248-149730270 CTGGAGCCGGGGCTGGGGCTGGG - Exonic
1035166078 7:156990679-156990701 CAGGCGCTGTGACTTGGTCGCGG - Intergenic
1039060127 8:33566458-33566480 CTGGCGGCGGGCCGGGGGCGTGG - Intronic
1039608481 8:38901414-38901436 CAGGGGCCGGGGCTCGGGCGGGG - Exonic
1045145621 8:99340744-99340766 CTGCTGCTGGCACTTGGGCGAGG + Intronic
1045387996 8:101689672-101689694 CTGGGCCCGGGACTGGGGAGAGG + Intronic
1049643864 8:143727531-143727553 CTGGCACCGGGACCTTGGTGGGG + Exonic
1053166331 9:35846408-35846430 CTGGGACCGGGACTTGGCGGGGG + Intronic
1058967281 9:110049382-110049404 CTGGGGCCGGGACCGGGGCCGGG - Intronic
1060176310 9:121499708-121499730 CCGGGGCCGGGAGCTGGGCGCGG - Intergenic
1060192198 9:121600095-121600117 CGGGCGGCGGGAGTTGGGGGTGG + Intronic
1060550500 9:124482698-124482720 CTGGGGGCGGGGCCTGGGCGGGG - Exonic
1060855989 9:126915169-126915191 CCGGCGCCGGGGCCTGGCCGGGG + Intronic
1060951809 9:127608666-127608688 CTGGCGCTGGGACCGGGTCGGGG + Intergenic
1060986992 9:127825581-127825603 CTGGGGCTGGGACTGGGGTGGGG + Intronic
1060996130 9:127875710-127875732 CTGGAGCTGGGACTTGGGGAGGG - Intronic
1061238725 9:129357115-129357137 CTGGGGCGGGCACTGGGGCGTGG - Intergenic
1061290810 9:129649405-129649427 CTGGGGCCTGGACTTTGGCCTGG + Intergenic
1061799416 9:133105827-133105849 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799423 9:133105839-133105861 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799440 9:133105869-133105891 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799447 9:133105881-133105903 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061799454 9:133105893-133105915 CTGGGGCGGGGGCTGGGGCGGGG - Intronic
1061970293 9:134041325-134041347 CTGGCAGCGGGACTGGGGCTGGG + Intronic
1185621417 X:1453206-1453228 ATGGCGGCGTGACATGGGCGTGG - Intronic
1186490528 X:9968914-9968936 CTGTCGCCTGGACTTGAGTGCGG + Intergenic
1186509048 X:10116998-10117020 CTGGGACTGGGACTTGGGCACGG + Intronic
1187507455 X:19888363-19888385 CTGGCCCAGGCACTGGGGCGGGG - Intergenic
1192435515 X:71141348-71141370 CTGGGGCTGGGACTGGGGCTGGG - Exonic