ID: 1173643875

View in Genome Browser
Species Human (GRCh38)
Location 20:44621792-44621814
Sequence GGAGAAGCAGTGGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173643875_1173643883 29 Left 1173643875 20:44621792-44621814 CCTCCTGGGGCCACTGCTTCTCC 0: 1
1: 0
2: 2
3: 71
4: 597
Right 1173643883 20:44621844-44621866 CTGGATCTTTTTCCAGCCCATGG 0: 1
1: 0
2: 0
3: 14
4: 216
1173643875_1173643881 10 Left 1173643875 20:44621792-44621814 CCTCCTGGGGCCACTGCTTCTCC 0: 1
1: 0
2: 2
3: 71
4: 597
Right 1173643881 20:44621825-44621847 ATATCTGTGCAGATGACTCCTGG 0: 1
1: 0
2: 1
3: 17
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173643875 Original CRISPR GGAGAAGCAGTGGCCCCAGG AGG (reversed) Intronic
900187003 1:1337335-1337357 GGTGGAGCAGAGGCCCCAGTGGG - Intronic
900336361 1:2165943-2165965 GGAGGGACAGTGGCCGCAGGGGG - Intronic
900373608 1:2343498-2343520 TGAGCAGCAGTGGCCCCTCGAGG + Intronic
900489331 1:2939064-2939086 GGAGGAGCAGTGGCCCATGTGGG + Intergenic
900718149 1:4158219-4158241 AGAGAAGCAGAGGCCACAGCGGG - Intergenic
900736156 1:4300722-4300744 GGAGCTGAAGTGGCCCCAAGGGG + Intergenic
901419648 1:9142423-9142445 GGTGAAGCAGTGCCTCCTGGTGG - Intergenic
901460302 1:9387333-9387355 GTAGAAGCTGGGGCCACAGGAGG - Intergenic
901523172 1:9801153-9801175 GGAGAATCACTTGACCCAGGCGG + Intronic
901711345 1:11117987-11118009 GGAGAATCACTGAACCCAGGAGG + Intronic
902815380 1:18913519-18913541 GGAGGAGCCTTGGCCCCAGCGGG + Intronic
902918570 1:19653194-19653216 GGAGAAGGCGTGAACCCAGGAGG + Intronic
903297108 1:22350838-22350860 GGGGCAACAGTGGGCCCAGGCGG + Intergenic
903665819 1:25006836-25006858 GGAGAAGCTGGGGCTCCGGGAGG + Intergenic
904354398 1:29929489-29929511 GGAGAAGCAGTGACTCCCGTTGG - Intergenic
904559275 1:31385888-31385910 GGAGAAAGTGTGGCCCCAGGAGG - Intergenic
904858900 1:33520440-33520462 GTAGAAACTGTGGCCCCAGTAGG + Intronic
904882274 1:33709983-33710005 GGAGAAGCAGTTTCCAGAGGAGG - Intronic
905179828 1:36158574-36158596 GCAGAAACTGTGGCTCCAGGAGG - Intronic
905183172 1:36178814-36178836 GCAGAAGCAGGTGCCCCCGGCGG + Exonic
905979382 1:42210226-42210248 GTGCAAGCAGTGGCCCCAGTGGG - Intronic
906480553 1:46196794-46196816 GCAGAGGCAGTGGTCCCCGGCGG - Exonic
907182974 1:52586957-52586979 GGAGAATCACTGGAACCAGGGGG + Intergenic
907592357 1:55687148-55687170 GCTGGAGCAGTGGCCCCATGAGG - Intergenic
907931172 1:59002257-59002279 GGAGAATCATTGAACCCAGGAGG - Intergenic
909047886 1:70731835-70731857 GGAGAATCATTGAACCCAGGAGG - Intergenic
909340455 1:74525778-74525800 GGAGCAGCAGTTGGCCCAGCAGG + Intronic
910304136 1:85742220-85742242 GGAGAATCACTTGACCCAGGAGG - Intronic
910559673 1:88576977-88576999 GGAGAAGCTGGGTCCCCAGGAGG + Intergenic
912263373 1:108131038-108131060 GCAGATGCAGTGGCCACAGGAGG - Intergenic
912519123 1:110233469-110233491 AGTGAAGCAGTGACCCTAGGGGG - Exonic
912722599 1:112032712-112032734 TGGGAAGCAGTGGTTCCAGGAGG - Intergenic
912800802 1:112718850-112718872 CGAGACGCAGCGGCCCCTGGCGG - Intergenic
915255918 1:154628434-154628456 GGAGAGGCAGTGGCACAAGATGG - Intergenic
915303927 1:154967240-154967262 GGATAAGCAGTGGAGCCAGTAGG - Intronic
915315053 1:155023803-155023825 GGAGAGGCACACGCCCCAGGGGG + Intronic
915457648 1:156051295-156051317 GAAGAAGCAGTGGCAGCAGCTGG + Exonic
915558089 1:156670964-156670986 GAAGATGATGTGGCCCCAGGGGG - Exonic
916046658 1:161005068-161005090 GGAGAATCACTGAACCCAGGAGG + Intronic
916166802 1:161972392-161972414 TGAGGAGCGGAGGCCCCAGGCGG - Intergenic
916235394 1:162583065-162583087 GGAGAATCACTGAACCCAGGAGG - Intronic
916660178 1:166916173-166916195 TGAGCAGCAGGGGTCCCAGGGGG - Exonic
917502578 1:175599235-175599257 GGAGGAGCGGTGACCCGAGGTGG - Intronic
917872927 1:179257742-179257764 GGAGAATCATTTGACCCAGGAGG + Intergenic
918126748 1:181590614-181590636 TGAGAAGCAGTGACCCAAGGCGG + Intronic
918177149 1:182056721-182056743 GGTGAAGCACTTGCCGCAGGTGG + Exonic
919491664 1:198212556-198212578 GCACAAGCAGTGGCCCCAGTGGG - Intronic
920202797 1:204270187-204270209 TGAGAAGGAGTGGCCACAGATGG - Intronic
920415223 1:205795056-205795078 GGAGAAGACCTGGCCCCAGAAGG + Intronic
920442828 1:205992702-205992724 GGGAAAGCAGTTGCCCCATGGGG + Intronic
920803192 1:209208229-209208251 GGAGGAGCTGTGGCCCGGGGAGG + Intergenic
920830530 1:209460954-209460976 GGAGAATCATTGAGCCCAGGAGG - Intergenic
922222447 1:223618830-223618852 GGAGAAGCAGGGCCTCCAGAGGG + Intronic
922651744 1:227346139-227346161 GGAGAATCAGTTGAACCAGGAGG + Intergenic
922810894 1:228414965-228414987 GCAGAAGTTGTGGCCACAGGTGG + Exonic
923806233 1:237261257-237261279 GAAGAAGCAGTTACCCAAGGGGG - Intronic
924171461 1:241345923-241345945 GGAGAATCACTTGACCCAGGAGG + Intronic
924179099 1:241423886-241423908 GGAGCAGCAGTGGCGGCAGTGGG + Intergenic
1062877761 10:955893-955915 GGGGAAACAGTCGCCTCAGGTGG - Intergenic
1063943862 10:11158251-11158273 GTAGAAGCAGGGGCTCCTGGAGG + Intronic
1065407671 10:25388301-25388323 GGAGCAGCAGTGGCGGCAGTGGG + Intronic
1066091867 10:32030423-32030445 GGAGAATCATTGAACCCAGGAGG + Intronic
1066181752 10:32968817-32968839 GGAGAATCACTGACCCCAGGAGG + Intronic
1067166338 10:43869087-43869109 GAAGAGGCAGTGGGCCAAGGGGG + Intergenic
1067526861 10:47044406-47044428 GCAGCATCAGGGGCCCCAGGAGG - Intergenic
1068186326 10:53591133-53591155 GGAGAATCAGTGAACCCAGGAGG - Intergenic
1068683212 10:59842130-59842152 GGAGAATCAGTTGAACCAGGAGG - Intronic
1068783908 10:60949126-60949148 GGAGAAACAGAGGTCCCAGGAGG - Intronic
1069532632 10:69230403-69230425 GGAGATTCAGAGTCCCCAGGGGG - Intronic
1069719251 10:70539344-70539366 GGAGAATCTGAGGCCCCGGGAGG + Intronic
1069788551 10:71005024-71005046 GGGGAAACTGAGGCCCCAGGAGG + Intergenic
1069792266 10:71030341-71030363 TGAGAAGCGTTTGCCCCAGGTGG + Intergenic
1069833556 10:71295132-71295154 GGAGAAGGAGTGTCCCCTGCTGG + Intronic
1070171033 10:73932750-73932772 GGAGAATCACTTGACCCAGGAGG + Intergenic
1070753880 10:78979708-78979730 GGAGAAACTGAGGCCCCATGTGG - Intergenic
1071121865 10:82287737-82287759 GGTGAAGGAGTGGCCACAGCTGG + Intronic
1071601891 10:86962489-86962511 GGAGGAGCAGAGGCCCCTCGTGG - Intronic
1071692573 10:87837774-87837796 GGAGAAGTTGGGGCCTCAGGAGG - Intronic
1072022787 10:91420496-91420518 GGAGAATCAGTAGAACCAGGAGG + Intronic
1072267871 10:93747836-93747858 GGAAAAGCAGTGGCTCTAAGAGG - Intergenic
1072519611 10:96219415-96219437 GGAGAGGCTGAGCCCCCAGGAGG + Intronic
1073144429 10:101271252-101271274 GGGGAATCAGGAGCCCCAGGAGG + Intergenic
1073352757 10:102831523-102831545 TGAGAAGGAGTGGCACCAGCCGG - Exonic
1073373198 10:103009183-103009205 GGAGAAGCACTTGAACCAGGAGG + Intronic
1073912669 10:108364802-108364824 GGAGAACCAGTAGTCCCATGTGG + Intergenic
1074128685 10:110553331-110553353 GGAGAATCACTGGACCCGGGAGG - Intergenic
1074763518 10:116684579-116684601 AGATAAGCAGTGGCTCCAGGAGG + Intronic
1076301104 10:129426967-129426989 GGAGAAGCAGGGACTCCTGGAGG + Intergenic
1076315003 10:129533773-129533795 TGAGAAGCAGTGGCCCGGGATGG + Intronic
1076316406 10:129544900-129544922 GGAGAAACAGAGACTCCAGGAGG - Intronic
1076429065 10:130388946-130388968 GGAGAAACAGGGGCCTCAGGTGG - Intergenic
1076606957 10:131695390-131695412 GGAGGGGGAGAGGCCCCAGGAGG + Intergenic
1076636748 10:131886021-131886043 GGAGATGCATTGGCCCCAGGCGG - Intergenic
1076851385 10:133095143-133095165 GGGGAAGCAGGAGCCCCAGCTGG + Intronic
1077012323 11:384827-384849 GGAGCAGCAGTGGCGGCAGCAGG + Intergenic
1077451597 11:2651628-2651650 GGAGAGACAGAGACCCCAGGTGG - Intronic
1077464335 11:2726464-2726486 GGGGAAACTGAGGCCCCAGGCGG + Intronic
1078646069 11:13142251-13142273 GGAAAAGCAGCCGCCCGAGGTGG - Intergenic
1078823858 11:14907691-14907713 GGTGAAGCAGTGCCCACAGGTGG + Intronic
1078840909 11:15074894-15074916 GGTGAATCAGTGCCCACAGGTGG + Intronic
1079650535 11:22922890-22922912 AGAGGAGCAGTGGTCCCAAGAGG - Intergenic
1079706017 11:23619569-23619591 GGAGAATCTGTGAACCCAGGAGG + Intergenic
1079747490 11:24151938-24151960 GGAGAATCACTTGACCCAGGAGG - Intergenic
1079763316 11:24357523-24357545 GCACAAGCAGTGGCTCCAGTGGG + Intergenic
1080224994 11:29950236-29950258 GGAGCTGCAGTGGGCCCATGCGG - Intergenic
1080239413 11:30109516-30109538 GAAGAGGCATTGGCCGCAGGTGG - Intergenic
1080852168 11:36079078-36079100 GGAGCAGCAGTGGCGGCAGTAGG - Intronic
1081674105 11:44958261-44958283 GGAGAAACAGAGGCCCAGGGAGG - Intergenic
1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG + Intronic
1082045986 11:47727967-47727989 GGAGAATCATTGAACCCAGGAGG - Intronic
1082140650 11:48604339-48604361 GGAGAAGAAGTGGCAGCAGGAGG - Intergenic
1083670431 11:64297063-64297085 GGAGACGGAGGGGTCCCAGGTGG + Intronic
1083751975 11:64765984-64766006 GGAGGGGGAGGGGCCCCAGGCGG + Intronic
1084298115 11:68226277-68226299 GGAGGAGCAGGGTCCCCAGGAGG + Intergenic
1084406454 11:68976767-68976789 GGGGAAGAAGAGGCCACAGGGGG + Intergenic
1084419390 11:69052783-69052805 GCAGCAGCAGAGGCCTCAGGAGG - Intronic
1084549305 11:69831372-69831394 TGGGCATCAGTGGCCCCAGGTGG - Intergenic
1084562162 11:69911206-69911228 AGGGAAGGAGTGGCCCCTGGTGG - Intergenic
1084752372 11:71212871-71212893 AGAGGAGCAGGGACCCCAGGCGG + Intronic
1084752383 11:71212904-71212926 AGAGGAGCAGGGACCCCAGGCGG + Intronic
1084752394 11:71212937-71212959 AGAGGAGCAGGGACCCCAGGCGG + Intronic
1084752407 11:71212970-71212992 AGAGGAGCAGGGACCCCAGGGGG + Intronic
1084752418 11:71213003-71213025 AGAGGAGCAGGGACCCCAGGTGG + Intronic
1084783432 11:71426582-71426604 GGAGATGCAGTAGCTCCTGGTGG + Intergenic
1084938137 11:72598191-72598213 GGAGAAGCTATGGCACCAAGAGG + Intronic
1085055870 11:73403436-73403458 GGAGAGGCAGTGGCATGAGGAGG + Intronic
1085203277 11:74714547-74714569 TGGGAAGCAGTGACCCCAGAAGG - Intronic
1085204543 11:74722898-74722920 GGAGAAGCAGAGGCTCACGGAGG + Intronic
1085275909 11:75300112-75300134 GGAGAAACACTGAACCCAGGAGG + Intronic
1086421337 11:86640498-86640520 TGAAAATCTGTGGCCCCAGGTGG - Intronic
1086921651 11:92594350-92594372 GGAGAATCACTGAACCCAGGAGG + Intronic
1087252797 11:95923186-95923208 GGAGAACCAGTAGCCCAAGAAGG + Intronic
1087304038 11:96468615-96468637 GGAGAATCACTTGACCCAGGAGG - Intronic
1087892730 11:103553190-103553212 AGACAAGCAGTGGTCCCTGGAGG + Intergenic
1088738910 11:112750996-112751018 AGAGGAGCAGAGGACCCAGGAGG + Intergenic
1088910006 11:114183591-114183613 GGGGAAGCAAAGGCCCGAGGAGG - Intronic
1089563595 11:119358404-119358426 GGAGAATCACTGAACCCAGGAGG - Intronic
1089672939 11:120068977-120068999 GGTCCAGCAGTGGCCCCAGAAGG - Intergenic
1089867447 11:121643951-121643973 GGAAGACCAGTGGCACCAGGGGG + Intergenic
1091177708 11:133576544-133576566 GGAGAAGGAGCGCCCCTAGGAGG + Intergenic
1091875351 12:3929114-3929136 AAAGAGGAAGTGGCCCCAGGTGG + Intergenic
1092205805 12:6613707-6613729 GGAGAAGCAGTCCCCGCAGTAGG + Intergenic
1092403552 12:8198455-8198477 GGACAAGCAGTGGATCCAGTGGG + Intergenic
1092732738 12:11549642-11549664 GGAGGTGCAGTGAGCCCAGGTGG - Intergenic
1093272705 12:17083916-17083938 GGAGAATCAATGAGCCCAGGAGG - Intergenic
1093272828 12:17085702-17085724 GGAGAATCAATGAGCCCAGGAGG - Intergenic
1093622922 12:21313619-21313641 GGAGAATCACTTGACCCAGGAGG + Intronic
1095524032 12:43104044-43104066 GTGGAAGCAGTTGCGCCAGGTGG + Intergenic
1095601598 12:44019397-44019419 GGAGAAACAGAGGCTTCAGGAGG + Intronic
1096051604 12:48614612-48614634 GGAGAACCAGTGAACTCAGGAGG - Intergenic
1096588581 12:52642435-52642457 GGAGCAGCAGAGGGCCCTGGTGG + Intergenic
1096605675 12:52764049-52764071 GGAAAAGCAGAGGTCCCTGGAGG - Intergenic
1096678734 12:53241085-53241107 GCAATAGCAGTGGCCACAGGAGG - Intergenic
1096850793 12:54434809-54434831 GGAGAATCATTGAACCCAGGTGG - Intergenic
1097710509 12:62912474-62912496 GGAAGAGCAGTGTGCCCAGGAGG + Intronic
1097986163 12:65785424-65785446 GAAGAAGCAAAGTCCCCAGGAGG - Intergenic
1098550608 12:71757196-71757218 GGAGAATCACTTGACCCAGGAGG - Intronic
1098740021 12:74161639-74161661 GGAGAATCACTGGAACCAGGAGG + Intergenic
1099438016 12:82666687-82666709 CGAGAAGAAGAGGGCCCAGGAGG + Intergenic
1100776361 12:97979295-97979317 GGAGCAGCAGTGGCTGCAGGTGG - Intergenic
1101881991 12:108631989-108632011 GGAGAAGCAGCTGCCTCTGGCGG - Exonic
1102534381 12:113569862-113569884 TGGGAAGGAGTGGCCCCCGGCGG + Intergenic
1102561245 12:113763887-113763909 GGGTAAGCTGAGGCCCCAGGAGG + Intergenic
1102587993 12:113936575-113936597 GGGGAAGCCGTGGCCCCTGGGGG - Intronic
1103701745 12:122851718-122851740 GGAGGTGCAGGGACCCCAGGAGG - Intronic
1103701907 12:122852481-122852503 GGGCAGGCAGTGGCCCCACGAGG + Intronic
1103926576 12:124426773-124426795 GGAGAAGCAGATGCGCCAGCTGG - Exonic
1103968392 12:124654583-124654605 CCAGAGGCAGTGGCCCCTGGTGG - Intergenic
1104367078 12:128187627-128187649 GGAGAAGCCGTGTCCCTTGGTGG - Intergenic
1104930969 12:132339311-132339333 GGGGAAGCAGTGGGCGCCGGAGG - Intergenic
1104978352 12:132561995-132562017 GGAGCCGCAGTGCCCCCTGGAGG + Intronic
1106242928 13:27924747-27924769 GGAGGAGCAGAGGGCCTAGGAGG + Exonic
1106761555 13:32873400-32873422 GGAGAGGCTGGGTCCCCAGGAGG + Intergenic
1107413525 13:40179239-40179261 AGAGTGGCAGTGGACCCAGGAGG - Intergenic
1109611056 13:64765003-64765025 GGAGAAGCAAGGTGCCCAGGAGG - Intergenic
1110209384 13:72954010-72954032 GCACAAGCAGTGTCCCCAGTGGG + Intronic
1111272371 13:85903236-85903258 GGAGAATCACTGAGCCCAGGAGG + Intergenic
1112268988 13:97951112-97951134 GGAGAATCACTGAACCCAGGAGG - Intergenic
1112549323 13:100404719-100404741 GGTGAAGCAGGGGGCCTAGGGGG + Intronic
1112762817 13:102710149-102710171 GGCGAAGCTGTGGCTCCATGGGG + Intergenic
1113579809 13:111420943-111420965 GGGGCAGCAGTGGCCACATGGGG + Intergenic
1113878100 13:113607237-113607259 GGAGAAGCTCTGGGCTCAGGAGG - Intronic
1113879291 13:113614660-113614682 AGAGACACAGTGGCCCCGGGAGG - Intronic
1113923374 13:113927162-113927184 GGGGAAGCATTGGCCCCAACAGG + Intergenic
1114031851 14:18585696-18585718 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1114085542 14:19234843-19234865 GGAGAACCCCAGGCCCCAGGAGG + Intergenic
1114213723 14:20639219-20639241 GGAGAATCACTGAACCCAGGGGG - Intergenic
1117844165 14:59893825-59893847 GGAGGAGCAGTGGCCCTTGGAGG - Intergenic
1118702467 14:68447126-68447148 GGAGAATCACTTGACCCAGGAGG + Intronic
1119079226 14:71676200-71676222 GGAGAATCACTTGACCCAGGAGG + Intronic
1119364412 14:74079521-74079543 GGAGAAGGTGTGAACCCAGGAGG - Intronic
1119390246 14:74286856-74286878 GGAGAAGCAGCGGCGGCAGAGGG - Intronic
1119715277 14:76854514-76854536 GGAGAATCACTGAACCCAGGAGG + Intronic
1119726225 14:76923221-76923243 TGAGAAGCAGGTGACCCAGGTGG - Intergenic
1120246530 14:82012355-82012377 GGAGAAGTAGAGGTCTCAGGAGG - Intergenic
1121505636 14:94474616-94474638 AGAGAAGGGGTGGCCACAGGAGG - Intronic
1121680071 14:95786400-95786422 GAAGAAACAGTGGCCCCAGAGGG + Intergenic
1121791750 14:96704367-96704389 GGTGAAGAGGGGGCCCCAGGAGG - Intergenic
1122722508 14:103730221-103730243 GGAGAGTCAGGGGTCCCAGGAGG - Intronic
1202897088 14_GL000194v1_random:16557-16579 GGAGAACCCCAGGCCCCAGGAGG + Intergenic
1123761891 15:23439905-23439927 GGAGAAGATGTGGGGCCAGGAGG - Exonic
1123897523 15:24843161-24843183 GGAGAATCATTGAGCCCAGGAGG - Intronic
1123924588 15:25095102-25095124 GAAAAAGCAGTGGAACCAGGAGG + Intergenic
1124470423 15:29979554-29979576 GGAGAATCACTTGACCCAGGAGG - Intergenic
1124695062 15:31857532-31857554 GGAGAAGCCTGGGACCCAGGAGG + Intronic
1125320404 15:38481410-38481432 GGACAAGTAGTGGCACCAGCCGG + Exonic
1125725424 15:41866022-41866044 GGAGAAGGTGTAGCCCCAGCTGG - Exonic
1125769628 15:42156480-42156502 GAAGCAGCACTGCCCCCAGGAGG + Exonic
1126076753 15:44918876-44918898 GGAGAAGGCGTGACCCCAGGAGG - Intergenic
1129111544 15:73340066-73340088 GGGGAGGCAGAGGCCCCAGGAGG - Intronic
1129475668 15:75783211-75783233 GGAGAGGCTGTGGGACCAGGAGG + Intergenic
1129607928 15:77033849-77033871 GTGCAAGCAGTGACCCCAGGAGG + Intronic
1129638042 15:77343574-77343596 GGAGAATCATTGAACCCAGGGGG - Intronic
1129692512 15:77721807-77721829 GGAGAAGCTGAGGCCCGGGGTGG - Intronic
1129787931 15:78321600-78321622 GGAGAAACTGAGGCCCCAAGAGG - Intergenic
1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG + Intergenic
1131131923 15:89905777-89905799 AGAAAAGAAGTGGGCCCAGGAGG - Intronic
1131279067 15:91006322-91006344 GTATAAGCAGTGGCCCTAGGTGG + Intronic
1131927833 15:97405311-97405333 GGAGAGGCAGAGACCTCAGGAGG + Intergenic
1132374730 15:101321436-101321458 GGAGATGAAGTTTCCCCAGGAGG - Intronic
1132611740 16:820283-820305 GGAGAATCACTTGACCCAGGAGG - Intergenic
1132656727 16:1044576-1044598 GGAGAGGGAGAGGCCTCAGGAGG + Intergenic
1132795770 16:1721520-1721542 GGTGCTGCAGTGACCCCAGGAGG - Intronic
1132852226 16:2029935-2029957 GTAGAAACAGTGGCCCCCAGTGG - Intronic
1133050325 16:3113799-3113821 TGAGAAGCTGTGGTTCCAGGTGG - Intronic
1133565412 16:6988859-6988881 GGAGAATCACTGAACCCAGGAGG - Intronic
1133634906 16:7656153-7656175 AGAGAAGCAGGAGCCCCAGCAGG + Intronic
1134261321 16:12653470-12653492 GGAGAATCACTGATCCCAGGAGG - Intergenic
1134620048 16:15681353-15681375 GGAGAATCACTTGCCCCAGGAGG - Intronic
1135206780 16:20491695-20491717 GGAGCAGCCGTGGCAGCAGGGGG + Intergenic
1135212105 16:20531937-20531959 GGAGCAGCCGTGGCAGCAGGGGG - Intergenic
1136269252 16:29138877-29138899 GGAGGAGGCGTGGGCCCAGGAGG - Intergenic
1136682806 16:31977830-31977852 GGAGCAACAGGAGCCCCAGGAGG - Intergenic
1136684881 16:31988260-31988282 GGAGAGGGTGAGGCCCCAGGGGG + Intergenic
1136783444 16:32921396-32921418 GGAGCAACAGGAGCCCCAGGAGG - Intergenic
1136785494 16:32931795-32931817 GGAGAGGGTGAGGCCCCAGGGGG + Intergenic
1136886343 16:33932453-33932475 GGAGCAACAGGAGCCCCAGGAGG + Intergenic
1138350276 16:56342655-56342677 GGCCCAGCAGTGGCCACAGGAGG + Intronic
1138430766 16:56967254-56967276 GGAGAATCACTGAACCCAGGAGG + Intronic
1139169771 16:64616013-64616035 GAAAAAGCAGTGTCCCCAGCTGG + Intergenic
1139386858 16:66578545-66578567 GGAAGGGCAGTGGCCCTAGGTGG - Intronic
1139492070 16:67291549-67291571 GCAGAGACAGTGGCCCCTGGGGG - Intronic
1139525805 16:67515608-67515630 GGAGAATCACTGAACCCAGGAGG - Intergenic
1140086458 16:71801214-71801236 GGAGAATCACTGAACCCAGGAGG + Intronic
1140375303 16:74440755-74440777 GGAGAATCACTTGACCCAGGAGG - Intergenic
1141050182 16:80754579-80754601 TGAGAAGCTGTGGAGCCAGGAGG - Intronic
1141909405 16:87048180-87048202 GGAGAAACAGTGCCTCCCGGGGG - Intergenic
1141935500 16:87235632-87235654 GGATGAGCAGTGGCTCTAGGAGG - Intronic
1142072735 16:88100149-88100171 GGAGGAGGCGTGGGCCCAGGAGG - Intronic
1142195398 16:88737196-88737218 GGTGGCCCAGTGGCCCCAGGAGG - Intronic
1142266782 16:89067621-89067643 GGAGAAAGAGTGGCCCGGGGAGG + Intergenic
1203086095 16_KI270728v1_random:1185380-1185402 GGAGCAACAGGAGCCCCAGGAGG - Intergenic
1142518920 17:491612-491634 GGAGAAGCCGTGGCCCCCACCGG - Intergenic
1142614161 17:1125302-1125324 GGAGCAGAAGGGGCCCCCGGAGG - Exonic
1142750648 17:1985460-1985482 AGTGAAGCAGTGGACCCAGGAGG - Intronic
1142762475 17:2050396-2050418 GGAGCAGCAGAGCCCCCAGCCGG - Intergenic
1142838159 17:2604718-2604740 GGAGAATCACTTGACCCAGGAGG + Intronic
1142923037 17:3207763-3207785 GGAGAAGCAGTGGCAGGATGGGG - Intergenic
1143021935 17:3921440-3921462 GGAGGGGCAGGGTCCCCAGGAGG + Intergenic
1143344725 17:6241364-6241386 GGGGCAGCAGTGGGCCAAGGAGG - Intergenic
1144500581 17:15783134-15783156 GGAGACGCAGAGGATCCAGGCGG + Intergenic
1144760129 17:17702441-17702463 GGATAAGCAGTGACCCCATCAGG + Intronic
1145876940 17:28326156-28326178 GCAGATTCAGTGACCCCAGGGGG - Intronic
1145941188 17:28744207-28744229 GCAGAAACGGTGGCCGCAGGTGG - Exonic
1146222196 17:31033979-31034001 GGAGAATCACTTGACCCAGGAGG - Intergenic
1146564563 17:33901261-33901283 GTAGCAGCAGTGGCCACAGCAGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147169028 17:38607376-38607398 GGAGAGGCAGTTGGCCCAGGAGG - Intergenic
1147210760 17:38871171-38871193 GGAGATTCAGTGTCCCCTGGGGG + Intronic
1147219815 17:38921935-38921957 GGGGCAGCAGAGGTCCCAGGAGG - Intergenic
1147470925 17:40660368-40660390 GGAGAATCATTGAGCCCAGGAGG - Intronic
1147614936 17:41822151-41822173 GGAGGGGCAGGGGCCCCGGGTGG - Intronic
1147739055 17:42659968-42659990 GGGGCGGCAGTGGCCCAAGGGGG + Intronic
1149275308 17:55027187-55027209 GGACAAGCAGTGGCCCCTGTGGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149985776 17:61345762-61345784 AGTGAAGGAGTGGCACCAGGAGG + Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150176326 17:63060528-63060550 GGAGAATCACTTGCACCAGGAGG + Intronic
1150301767 17:64053210-64053232 GGAGAATCAGTGGCCCAGGTGGG - Intronic
1150546551 17:66164465-66164487 GGAGAATCACTGAACCCAGGAGG + Intronic
1150652042 17:67016627-67016649 GGAAAGGAATTGGCCCCAGGTGG + Intronic
1151207851 17:72521389-72521411 GGGGTAGCAGAGGCCCAAGGGGG + Intergenic
1151475200 17:74341226-74341248 GGAGAATCACTGAACCCAGGAGG + Intronic
1151679208 17:75614887-75614909 GGGGCAGCAGAGGCCCCGGGGGG - Intergenic
1151703497 17:75755286-75755308 GGGGAAGCAGTGGGCACAGCTGG - Intronic
1151783822 17:76265586-76265608 GGCGAAGCAGTTGCTGCAGGCGG + Exonic
1152031361 17:77845520-77845542 GGCAAAGCAGCGGCCTCAGGAGG - Intergenic
1152403514 17:80083355-80083377 GGAGACCCAATGTCCCCAGGTGG - Intronic
1152725162 17:81941553-81941575 GGCGAAGCAGAAGCCCCAGGCGG + Exonic
1152743913 17:82030670-82030692 GGAGAAGCTGCGGCTCCGGGAGG + Exonic
1152751793 17:82065705-82065727 GGAGCTGCAGGGGCCCCGGGCGG - Intronic
1153268745 18:3297344-3297366 GGGTAAGCAGTGGCCCCTGTGGG - Intergenic
1153285772 18:3452652-3452674 GGAGAGGGAGGGGCCCAAGGAGG - Intronic
1153513233 18:5878386-5878408 GCAGATGCAGTGGCACCAGTGGG + Intergenic
1153918977 18:9771684-9771706 GGAACAGCAGTCGCCCCTGGAGG + Intronic
1154341886 18:13510348-13510370 AGAGAAACTGAGGCCCCAGGAGG - Intronic
1154491561 18:14925903-14925925 GGAGAAGCAGCTGCCACAGAGGG + Intergenic
1154492849 18:14934438-14934460 GGAGGAGCAGTGGACTGAGGTGG - Intergenic
1154935726 18:21054441-21054463 GGGGAAGCAGTGCCCTCAGAAGG - Intronic
1157221481 18:45831245-45831267 GGAGAAGGAGTGAACCCAGAAGG - Intronic
1158005132 18:52663417-52663439 GGACTAGTAGTGGCTCCAGGAGG + Intronic
1158500130 18:57993519-57993541 AGGGAAGCAGGGGCCCAAGGGGG + Intergenic
1158551280 18:58438239-58438261 GGAGAACCAGTGGAACCAAGGGG - Intergenic
1158599773 18:58847257-58847279 GGAGGAGCTGGGGCCGCAGGAGG + Intergenic
1159773427 18:72575618-72575640 GGAGAAGCCGGGCCCTCAGGAGG + Intronic
1159927365 18:74281395-74281417 GGAAAAGCCCAGGCCCCAGGGGG + Intronic
1160185840 18:76675472-76675494 GGGGAAGATATGGCCCCAGGTGG - Intergenic
1160287335 18:77556564-77556586 GGAGAGGAATTTGCCCCAGGAGG + Intergenic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1161003197 19:1921441-1921463 GGTGCAGCAGGGGCCCCCGGTGG + Intronic
1161447425 19:4326531-4326553 GGACAAGCAGTAGCCCCACAGGG - Intronic
1161464758 19:4422742-4422764 GGAGAAGCAGCGGCTCAAGGAGG + Exonic
1161464859 19:4423436-4423458 GGAGAAGCAGATGCCCAAAGTGG + Intronic
1161612857 19:5252781-5252803 GGAGAATCATTGAACCCAGGAGG + Intronic
1161704488 19:5812750-5812772 GGAGAAACTGAGGCCCCATGAGG - Intergenic
1161840582 19:6677971-6677993 GGTGGAGCACTGGCCCGAGGAGG - Exonic
1161842765 19:6692965-6692987 GGAGAAGCAGAAGCCCGACGGGG - Exonic
1162066996 19:8131832-8131854 GCAGAAGCAGTGGCGGCACGGGG + Intronic
1162164486 19:8743145-8743167 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162165558 19:8750613-8750635 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162166623 19:8758069-8758091 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162167689 19:8765525-8765547 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162168628 19:8771823-8771845 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162170374 19:8784587-8784609 GGGGAAGCTGTGGGCCCTGGGGG + Intergenic
1162921710 19:13906712-13906734 GGAGCAGCTGTGGCAACAGGTGG - Intronic
1162948489 19:14057410-14057432 GGAGAAGCGGCGGCTGCAGGAGG - Exonic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163560781 19:18018143-18018165 GGAGAATCACTTGGCCCAGGAGG + Intergenic
1163658680 19:18563434-18563456 GGAGAATCACTTGACCCAGGAGG - Intronic
1163699369 19:18779639-18779661 GGACAAGCAGTGGCGCCCGCCGG - Exonic
1163723431 19:18909225-18909247 GGAGAAACAGTGGCCCTGGGAGG + Intronic
1163936640 19:20451524-20451546 GGAGAATCACTGAACCCAGGAGG - Intergenic
1164469095 19:28513452-28513474 GGAGAAGCTGTGTGCCAAGGAGG + Intergenic
1164759413 19:30717570-30717592 GGGGAAGCCATGGCTCCAGGGGG + Intergenic
1165075658 19:33278749-33278771 GGAGGAGCAGGGGCTGCAGGGGG - Intergenic
1165317834 19:35067287-35067309 GGGGCAGCAGTGCCCCCTGGTGG - Intergenic
1165652584 19:37504435-37504457 GGAGAATCACTGAACCCAGGAGG - Intergenic
1165844507 19:38809569-38809591 GGAGAATCAGTTGACCCAGGAGG - Intronic
1165866069 19:38939818-38939840 GGTGAAGGAGTGGCCTGAGGCGG + Intronic
1165903985 19:39182168-39182190 GGAGAGGCAGGTGTCCCAGGAGG - Intronic
1166233268 19:41438335-41438357 GGTGCGGCAGTGGCCCCAGAGGG - Exonic
1166254451 19:41592360-41592382 GCAGAGGGAGTGGCCTCAGGTGG - Intronic
1167148973 19:47698277-47698299 GGAGCCACACTGGCCCCAGGTGG + Intronic
1167285949 19:48599110-48599132 GGAGAAGAGGGGGCACCAGGGGG - Intronic
1167598090 19:50437801-50437823 GGATAAGCAGTGGGTCCAGGAGG - Intronic
1167706486 19:51084167-51084189 GGGGGAGCAGAGGCCCCAGCAGG + Exonic
1167778278 19:51576950-51576972 GGAGAATCACTTGACCCAGGAGG + Intronic
1168249835 19:55135615-55135637 GGAGAATCACTGAACCCAGGAGG - Intronic
1168295013 19:55374091-55374113 GGGGCAGCAAAGGCCCCAGGAGG + Intergenic
1168316201 19:55485782-55485804 TGAGAGGCAGGGGCCCCAGGGGG + Intronic
1168345870 19:55649976-55649998 GGAGGAGCAGGGGCCCCCTGAGG - Intronic
925304750 2:2840193-2840215 GGTGAAGCAGAGGCTCCAGGAGG + Intergenic
927079114 2:19610340-19610362 GAGGAAGCAGTGGTCACAGGTGG - Intergenic
927513234 2:23657726-23657748 GGGGGAGCACTGGGCCCAGGGGG - Intronic
927611116 2:24541580-24541602 GGAGAGGTTGTGGCCCCAGTTGG + Intronic
928078029 2:28282906-28282928 GGAGAATCACTGAACCCAGGAGG + Intronic
928502650 2:31913172-31913194 GGAGAATCACTTGACCCAGGAGG + Intronic
928815752 2:35292814-35292836 GGACAAGCAGTGGCCCCAGTGGG + Intergenic
930064552 2:47317837-47317859 GGAGAATCACTGAGCCCAGGAGG - Intergenic
930103777 2:47623521-47623543 GGAGAATCATTGAACCCAGGAGG - Intergenic
931223473 2:60309172-60309194 GAAGAAACTGAGGCCCCAGGAGG + Intergenic
931294623 2:60909811-60909833 GGAGAATCAGTTGAACCAGGAGG + Intronic
931642825 2:64396545-64396567 GGAGAACCAATGTCCTCAGGTGG + Intergenic
931777532 2:65553404-65553426 GGAGAAGCCGTGGCCCAAACAGG + Intergenic
932246794 2:70203057-70203079 GGACAAAAAGTGGCCCCAGCAGG + Intronic
932303293 2:70683692-70683714 GGAGAAGCACCGGCCCCATGAGG - Exonic
932339942 2:70957174-70957196 GGAGAATCACTGAACCCAGGAGG - Intronic
932412799 2:71557286-71557308 GGAGAAGGGGATGCCCCAGGTGG + Intronic
932705479 2:74021146-74021168 GGAGACTCAGAGGCCCCAGGTGG - Intronic
933481322 2:82860638-82860660 TGAGAACTAGTGACCCCAGGAGG + Intergenic
934609290 2:95722730-95722752 AGAGAAGCACTCACCCCAGGGGG + Intergenic
934741741 2:96728780-96728802 GGAGAATCACTGAACCCAGGAGG + Intronic
934883921 2:98007971-98007993 GGAGAAGCAGTGAGCCTGGGAGG - Intergenic
935702182 2:105822255-105822277 GGAGCAGCAGAGGCCCTCGGGGG - Intronic
936542619 2:113364307-113364329 AGAGAAGCACTCACCCCAGGGGG + Intergenic
937138284 2:119574641-119574663 GCAGAAGCAGTGGCCAAAGGTGG - Intronic
937454317 2:122028061-122028083 GCAGAATCAGAGTCCCCAGGTGG - Intergenic
937855631 2:126670461-126670483 GGGGAAGCAGAGGCCAAAGGGGG - Intronic
938297278 2:130186021-130186043 TGAGAAGCAGAGGCCACAGATGG + Intronic
938491222 2:131762241-131762263 GGAGAACCCCAGGCCCCAGGAGG - Intronic
938496341 2:131800096-131800118 GGAGAACCCCAGGCCCCAGGAGG + Intronic
938973738 2:136456254-136456276 GGAGACTCAGTGGGGCCAGGAGG - Intergenic
939812271 2:146848822-146848844 GGACAAGCAGTGGGGCAAGGAGG + Intergenic
940144803 2:150534591-150534613 GGAGAAGGCGTGAACCCAGGAGG - Intronic
941580935 2:167294160-167294182 GGGGAGGCAGTGGCCCCACCTGG - Intergenic
942405004 2:175644923-175644945 GGAGAATCATTGAACCCAGGAGG - Intergenic
944135689 2:196397020-196397042 GGAGAAGGAGTGAACCCGGGAGG + Intronic
944522650 2:200587378-200587400 CCAGAAGCAGTGGTCACAGGTGG - Intronic
945539272 2:211064004-211064026 GAAGAAGCAGTGTAACCAGGGGG - Intergenic
945577841 2:211554488-211554510 GGAGAGGAAGTGGGCCTAGGAGG + Intronic
947461170 2:230306111-230306133 GGAGCAGCAGTGGCAGCAGTGGG + Intronic
947616794 2:231562844-231562866 GGAGAATCACTGAACCCAGGAGG + Intergenic
947807853 2:232980986-232981008 GGAGAAGGACTGGCACCAGTAGG + Intronic
948311701 2:236992061-236992083 GGAGAAGCTGAGGCCACTGGGGG - Intergenic
948676896 2:239602077-239602099 GGAGAGCCAGGGGGCCCAGGAGG - Intergenic
948903734 2:240968244-240968266 GGAGAAGCGGCGGCTGCAGGTGG + Intronic
948942085 2:241201690-241201712 GGAGGAAGGGTGGCCCCAGGCGG + Intronic
1169222923 20:3837000-3837022 TGAGAAGCTGAGGCCCCAGGAGG - Intergenic
1169863221 20:10173219-10173241 GGAAAAGCAGTGGATGCAGGAGG - Intergenic
1170683111 20:18544368-18544390 AGATAAGCAGAGGGCCCAGGTGG + Intronic
1170928294 20:20745489-20745511 GGAGAGGCAGAGGACCCATGAGG + Intergenic
1171222192 20:23408710-23408732 GGAGATGCAGAGGCCCCAGAAGG + Intronic
1172517769 20:35547378-35547400 GGAGAAGCAGAGGCATCAGCTGG - Intronic
1172600664 20:36180404-36180426 GGAGAAGCAGGGGCCCAGAGGGG - Intronic
1172772129 20:37388044-37388066 GGTGCAGCAGAGGCCACAGGAGG + Intronic
1172999718 20:39097012-39097034 AGAGATGCATTGGACCCAGGAGG - Intergenic
1173643875 20:44621792-44621814 GGAGAAGCAGTGGCCCCAGGAGG - Intronic
1173716270 20:45209445-45209467 GTAGAAACAGTGGCCCCAGCTGG + Intronic
1174383447 20:50172226-50172248 GGTGAAGCATTGGCCACAGCTGG + Intergenic
1175164128 20:57031110-57031132 GGGGAAGCTGAGGCCCAAGGAGG - Intergenic
1175443679 20:59006894-59006916 GGCGACGCAGGGCCCCCAGGAGG + Intronic
1175596565 20:60239331-60239353 GGAGAGACAGAGTCCCCAGGTGG - Intergenic
1175978929 20:62727426-62727448 GCAGAACCCGTGGCCCCAGGCGG - Intronic
1176297337 21:5081107-5081129 GGAGGAGCCGTGGCCCTGGGTGG - Intergenic
1176415266 21:6471108-6471130 GCAGGAGCAGAGCCCCCAGGAGG + Intergenic
1176616774 21:9032546-9032568 GGAGAACCCCAGGCCCCAGGAGG + Intergenic
1176708356 21:10131101-10131123 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1177690508 21:24500247-24500269 GGAGAATCACTTGACCCAGGAGG + Intergenic
1178286005 21:31326030-31326052 GGAAAAGCAGAGGCCTCAGCAGG - Intronic
1179641357 21:42749458-42749480 TGAGGAGCAGCTGCCCCAGGAGG - Intronic
1179662445 21:42885517-42885539 GGAGAACCACTGAACCCAGGAGG + Intronic
1179690766 21:43079441-43079463 GCAGGAGCAGAGCCCCCAGGAGG + Intergenic
1179859692 21:44180841-44180863 GGAGGAGCCGTGGCCCTGGGTGG + Intergenic
1180044968 21:45301108-45301130 GGAAGAGCAGAGGCCCCCGGAGG - Intergenic
1180292431 22:10858350-10858372 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1180455965 22:15512753-15512775 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1180495237 22:15887772-15887794 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1180590041 22:16929842-16929864 GGACAAGCAGAGATCCCAGGAGG - Intergenic
1180647841 22:17354424-17354446 GGAGAATCATTGAACCCAGGAGG - Intergenic
1180899515 22:19360302-19360324 TGAGAAGCAGGGCACCCAGGAGG + Intronic
1181144703 22:20836485-20836507 GCAGAGGAAGTGGCTCCAGGTGG + Intronic
1181235492 22:21445736-21445758 GGAGGAGCAGAGGCCGCAGGGGG - Exonic
1181329800 22:22081069-22081091 GGAGAATCACTGGAACCAGGAGG + Intergenic
1181377816 22:22474294-22474316 GGAGAATCACTGAACCCAGGAGG + Intergenic
1181411717 22:22727551-22727573 GGAGTATCAGTGGCTCCATGTGG + Intergenic
1181473095 22:23152754-23152776 GGAGAGCCCGTGGCCCCAGGGGG - Intronic
1181530564 22:23514727-23514749 GGAGAAGCTGAGGCCCAAGCAGG + Intergenic
1181540288 22:23569348-23569370 AGAGAAGCAGCTGCCCCAGAAGG + Intergenic
1181653069 22:24271422-24271444 GGAGGAGCAGGGGCCACAGGCGG + Intronic
1182047088 22:27283857-27283879 GGAGAAGCATGTGACCCAGGAGG + Intergenic
1182322948 22:29490115-29490137 GGAGGAGGAGAAGCCCCAGGAGG + Exonic
1182445881 22:30389214-30389236 GGAGAATCAGTTGACCCTGGAGG - Intronic
1182494048 22:30694296-30694318 CCAGAAGCGGTGGCCCCAAGTGG - Intronic
1182589961 22:31371591-31371613 GGAGAATCACTTGCACCAGGAGG + Intergenic
1182991519 22:34772225-34772247 GGAGCAGGGGTGGGCCCAGGGGG - Intergenic
1183230153 22:36577077-36577099 GGGGCAGCAGAGGCCCCCGGGGG - Intronic
1183469514 22:37998084-37998106 GGAGAAACTGAGGCCCCGGGAGG - Intronic
1183567588 22:38626781-38626803 GGAGAAGCACTTGAACCAGGAGG + Intronic
1183639870 22:39086391-39086413 GCTGAAGCAGGGGCTCCAGGAGG - Exonic
1183958774 22:41398303-41398325 CAAGAAGCAGAGGGCCCAGGAGG - Exonic
1184601858 22:45548634-45548656 GGAGCAGATGTGGCCCCCGGTGG - Exonic
1184687054 22:46100991-46101013 GCATCAGCAGCGGCCCCAGGTGG + Intronic
1184769457 22:46589066-46589088 GGAGAAGCAGGGACGGCAGGGGG + Intronic
1184783367 22:46659988-46660010 GGAGAAGCAGCGTCCCGTGGCGG - Intronic
1185146189 22:49138057-49138079 GGAGGAGCAGGGGCCCCTTGAGG + Intergenic
1185317055 22:50183800-50183822 GGAGAAGGAGGGGCTCCAGGAGG + Intergenic
950160932 3:10760691-10760713 GGAGAAGCAGTGTGCCATGGTGG + Intergenic
950432762 3:12960467-12960489 GGAGGAGCAGGGGGCCAAGGAGG - Intronic
950570127 3:13794672-13794694 GGAGGAGAAGTAACCCCAGGTGG + Intergenic
950699034 3:14727397-14727419 GGAGGAGCAGGGGCTCCAGATGG - Intronic
950762218 3:15241522-15241544 GGAGGTGCAGTGTCCACAGGGGG + Exonic
952387825 3:32855614-32855636 GGAGAAGCAGTGTTCCCTAGAGG + Intronic
952457040 3:33483050-33483072 GGAGAATCATTGAACCCAGGAGG - Intergenic
953412205 3:42696948-42696970 GGGGAAGGTGTGGTCCCAGGGGG + Intronic
953546915 3:43870354-43870376 GGAGGAGGAGTGGCACAAGGTGG + Intergenic
954072008 3:48149911-48149933 GGAGAATCACTTGACCCAGGAGG - Intergenic
954285701 3:49617500-49617522 GGAGGAGCAGTGGCCTCAAGGGG + Intronic
955235973 3:57139601-57139623 GGAGAATCACTGGAACCAGGAGG - Intronic
955690583 3:61586679-61586701 GGAAAGGCAGTGGGACCAGGAGG + Intronic
957707438 3:83807072-83807094 GGAGCAGCAGTGGTACCATGAGG + Intergenic
959379594 3:105626249-105626271 GGAGAATCATTGAACCCAGGAGG - Intergenic
959726278 3:109545593-109545615 GGAGAATCACTTGACCCAGGAGG - Intergenic
960806590 3:121589465-121589487 GGAGAATCATTTGACCCAGGAGG - Intergenic
961104158 3:124227132-124227154 GGAGGAACAGTAGCCTCAGGAGG - Intronic
961406176 3:126681401-126681423 GGAGGACCAGGGGCCCAAGGGGG - Intergenic
961665152 3:128489722-128489744 GGAGAGACAGTGGGCCCCGGCGG - Intronic
962276560 3:134019013-134019035 GGAGCAGCAGTGGCTTCAGGTGG - Intronic
962803824 3:138913146-138913168 GGAGAAACAGAGGCCCCCAGAGG + Intergenic
963732585 3:148987374-148987396 GAAGAAGCAGTGGCAGCAGCTGG + Intergenic
963879827 3:150516500-150516522 GGAGAATCACTGAACCCAGGAGG + Intergenic
963956985 3:151264880-151264902 GGCAAGGCAGTGGCCACAGGAGG - Intronic
964622690 3:158732548-158732570 GGAAAAGGAGTGGCCCCATGGGG - Exonic
965844565 3:172946571-172946593 TGGGTAGCAGTGGCCCCAGGGGG + Intronic
967053421 3:185805859-185805881 GGAGAATCAGTTGAACCAGGAGG - Intronic
968895718 4:3401952-3401974 GGAGAAGCAGTCTCCAGAGGTGG + Intronic
969365199 4:6690132-6690154 GGAGAAGCAGAGAGGCCAGGAGG - Intergenic
969635861 4:8369275-8369297 GGAGAGGCAGTCTCCCCAGGAGG - Intronic
969762512 4:9199337-9199359 GGACAAGCAGTGGCTCCAGTGGG - Intergenic
971264047 4:25082591-25082613 GGAGAAGCCTTGGCCGCAGGTGG + Intergenic
971957609 4:33441925-33441947 GGGGTACCAGTGGCCCCAGTTGG - Intergenic
973741078 4:53920071-53920093 GGAGGAGAACTGGCTCCAGGGGG + Intronic
975254552 4:72217109-72217131 GGAGCAGCAGTGGCGGCAGTGGG - Intergenic
975258859 4:72272426-72272448 GGAGAAGCAGTGTCCTCAGTGGG + Intergenic
975373021 4:73610101-73610123 GGAGAAGCAGGAGCTACAGGAGG - Intronic
976788848 4:88854234-88854256 AGACAAGAAGTGGGCCCAGGAGG + Intronic
977654469 4:99505174-99505196 GCAAAAGCAGTGGCCCCACTGGG + Intergenic
980367205 4:131819423-131819445 GCAAAAGCAGTGTCCCCAGTGGG + Intergenic
980730153 4:136812930-136812952 GGAGCAGCAGTGGCGGCAGTGGG - Intergenic
980975627 4:139607467-139607489 GGAGAAGTCCTGGTCCCAGGAGG + Intergenic
981923903 4:150117114-150117136 GTGCAAGCAGTGGCCCCAGTGGG + Intronic
982631913 4:157840968-157840990 TGAGAAGAAATGGCCCTAGGGGG - Intergenic
983085842 4:163442948-163442970 GGAGAAGCAATAGCCTCAGTAGG - Intergenic
984767520 4:183410742-183410764 GGGGAGACGGTGGCCCCAGGAGG + Intergenic
985817540 5:2137759-2137781 GGAAGAGCAGTGGCCCCACCTGG - Intergenic
986082933 5:4412988-4413010 GGAGCTGCAGTGGCACCAGGAGG + Intergenic
988329319 5:29814904-29814926 GGAGGAGAATTGCCCCCAGGAGG + Intergenic
988511890 5:31871539-31871561 GGAGAATCACTTGACCCAGGAGG - Intronic
989091970 5:37743251-37743273 GGAAAAGCAGTTTCCCCAGCTGG - Intronic
991056373 5:62325212-62325234 GGAGAACCACTTGACCCAGGAGG - Intronic
991702489 5:69329591-69329613 GGAGAATCACTTGACCCAGGAGG - Intronic
995907689 5:117145541-117145563 TTAGAAGCAGTGGCCTCAGTGGG - Intergenic
996760632 5:126983033-126983055 GGAGAAGCAGTGGCGCATGGAGG + Intronic
996856677 5:128016065-128016087 GGAGCATCAGTGGCCTGAGGGGG - Intergenic
997350929 5:133230920-133230942 GGAGAAGCTGCGTCCTCAGGAGG - Intronic
998004478 5:138648007-138648029 GGAGAAGGAGAGGCCACAGTGGG + Intronic
998400244 5:141844931-141844953 GGAGAAGCAGTGGCAGGAGGAGG + Intergenic
998822424 5:146068705-146068727 GCAGAAACAGTGTTCCCAGGTGG + Intronic
999386394 5:151157109-151157131 AGACAAGCAGTGGCCCAAAGGGG + Intronic
999729790 5:154468101-154468123 GGAAAAGCACTAGCCCCAGAAGG - Intergenic
999751173 5:154629120-154629142 AGAAAAGCAGTGGCCCCTGGAGG + Intergenic
1001234069 5:170014715-170014737 GGAAAAGCAGTGTGCCCTGGAGG + Intronic
1001434951 5:171693019-171693041 GGAGAAGCTGAGGCCAGAGGGGG - Intergenic
1001436501 5:171703425-171703447 GCAGCAGCAGTGGCACTAGGCGG + Intergenic
1001492408 5:172165053-172165075 GGTGAAGCAGTGTCCCCGGCTGG - Intronic
1002399314 5:178982485-178982507 GGAGAATCACTTGACCCAGGAGG + Intronic
1003418024 6:5930366-5930388 GGAGGAGAAGTGGCCCCTGGGGG - Intergenic
1003481152 6:6534603-6534625 GCAGAAGGAGTGGCCCCCCGGGG - Intergenic
1003614457 6:7642501-7642523 GGAGAATCAGTGAACCCGGGAGG - Intergenic
1003929215 6:10907251-10907273 GGAGAATCACTTGACCCAGGAGG + Intronic
1004258704 6:14088903-14088925 GAAGAAGCAGTGGCCGCCTGGGG + Intergenic
1006112928 6:31759712-31759734 GGAGAGGCAGAGGCCCCTAGGGG - Intronic
1006460841 6:34156930-34156952 GGACATGCAGGGGCCCCTGGGGG + Intergenic
1006716197 6:36122276-36122298 GGAGAAGCTGTGCACCCTGGAGG - Intergenic
1007111649 6:39316329-39316351 GCAGAAGCAGGGGGCCCAGTGGG + Intronic
1007358561 6:41339473-41339495 GGAGAAGGTGTGAACCCAGGAGG - Intronic
1008612175 6:53194928-53194950 GGAGAATCACTGAGCCCAGGAGG + Intergenic
1008960006 6:57257065-57257087 TGAGAAGCACTGGCCCAGGGTGG - Intergenic
1011599354 6:89045452-89045474 GGAGAATCACTTGACCCAGGAGG + Intergenic
1013307096 6:108859310-108859332 GGAGAAGCCGTCTCCCCAGGAGG - Intronic
1013992045 6:116265174-116265196 GTGGAAGGAGTGGCCCCAGATGG + Intronic
1014619292 6:123645930-123645952 GGAAGAGCAGCGGCCCAAGGAGG + Intergenic
1014761276 6:125359513-125359535 GGAGAATCACTGAACCCAGGAGG + Intergenic
1016384017 6:143513614-143513636 GGTGGAGCTGTGGCCCCGGGGGG - Intergenic
1016844821 6:148559936-148559958 GGCGAAGCAGTGCCCTCTGGCGG - Intergenic
1017674407 6:156798220-156798242 GGACATGCAGGGGCCCCAGGAGG - Intronic
1017819073 6:158036817-158036839 AGAGAAGCTGTGGCCCCAGCTGG + Intronic
1018679766 6:166253974-166253996 GGAGACGCACTTGCCCCAGGCGG - Intergenic
1018744296 6:166750248-166750270 GGAGAAGCTGAGGACACAGGAGG - Intronic
1019346929 7:535633-535655 GGAGAAGAGGTGGGGCCAGGTGG - Intergenic
1019409413 7:900098-900120 GGAGAAGACGGGGCCCAAGGTGG - Exonic
1019605653 7:1908925-1908947 GCATGAGCAGCGGCCCCAGGGGG + Intronic
1019614494 7:1952997-1953019 GGGGCAGCTGTGGCTCCAGGAGG + Intronic
1019659984 7:2218807-2218829 GGAGAATCACTGAACCCAGGAGG + Intronic
1019783311 7:2957729-2957751 GGAGAATCCTTGGACCCAGGAGG - Intronic
1022586532 7:31618518-31618540 TGAGAAGAAGGGGCCCCTGGAGG - Intronic
1023032141 7:36099085-36099107 AGAGAAGCTGTGGTCCCAAGAGG + Intergenic
1023906061 7:44522147-44522169 GGAGAAGTTGTAGCCCAAGGTGG + Exonic
1025058648 7:55785515-55785537 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1025150395 7:56542460-56542482 GGAAAAGCTGTGGCCCTGGGAGG - Intergenic
1025220482 7:57103430-57103452 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1026274844 7:68867530-68867552 GGAGAATCACTTGACCCAGGAGG + Intergenic
1026622256 7:71960041-71960063 GGAGAATCATTGAACCCAGGAGG + Intronic
1027052228 7:75027701-75027723 CGAGGAGCAGGGTCCCCAGGGGG - Intronic
1027175719 7:75902007-75902029 GGAGAATCAGTGAGCCCAGCTGG - Intronic
1027838693 7:83279393-83279415 GGGCAAGCAGTGGCCCCTGTGGG + Intergenic
1028755065 7:94425147-94425169 GGAGGACCACGGGCCCCAGGAGG - Exonic
1029160229 7:98546388-98546410 GGAGAATCAGTTGAACCAGGAGG + Intergenic
1029249537 7:99225990-99226012 GGAGAAGCGTTGGCCCCCAGGGG - Intergenic
1029285869 7:99465838-99465860 AGAGGAACAGTGGCCCAAGGCGG + Intronic
1030113241 7:106044027-106044049 GGAGCAGCAGATGCCACAGGAGG + Intergenic
1030210138 7:106987848-106987870 TGGGCAGCAGTGGCCCCAGGAGG + Intergenic
1030626603 7:111852051-111852073 GGAGAATCACTGAACCCAGGAGG - Intronic
1030959402 7:115896901-115896923 GGAGAATCACTTGACCCAGGAGG + Intergenic
1031369505 7:120947476-120947498 AGAGAAGCAGGGGCACAAGGTGG + Intergenic
1032439725 7:131933221-131933243 GGACATGCAGTGGCCCACGGAGG - Intergenic
1032548441 7:132762590-132762612 GGAGACACAGGGGCGCCAGGAGG + Intergenic
1032766085 7:134995267-134995289 TGAGAAGCAGTGGCCCGACGGGG - Intronic
1033355485 7:140595676-140595698 GGAGAATCACTTGGCCCAGGAGG + Intronic
1033418672 7:141186424-141186446 GGAGGAGCAGAGGCCCCGAGAGG - Intronic
1034066227 7:148139628-148139650 GGAGAATCACTTGACCCAGGAGG - Intronic
1034257196 7:149731154-149731176 GGAGAAGCAGTGGTAGAAGGAGG + Intronic
1034299552 7:150003083-150003105 GGAGATGTAGTGGCTCCAAGTGG + Intergenic
1034806451 7:154093690-154093712 GGAGATGTAGTGGCTCCAAGTGG - Intronic
1034830599 7:154304846-154304868 GGGGCAGAGGTGGCCCCAGGAGG - Intronic
1035084012 7:156240719-156240741 TGAGAACCACTTGCCCCAGGTGG - Intergenic
1035253273 7:157611138-157611160 GGAGCAACAGTGGCCCCAAATGG + Intronic
1035484690 7:159213627-159213649 GGAGAAGCAATGGCTTCAGATGG + Intergenic
1035624176 8:1059286-1059308 GGGGATGCAGGGGTCCCAGGAGG - Intergenic
1036272596 8:7321072-7321094 GGACAAGCAGTGGCTCCAGTGGG - Intergenic
1036348752 8:7989272-7989294 AGACAAGCAGTGGCTCCAGTGGG + Intergenic
1036844020 8:12149744-12149766 GGACAAGCAGTGGCTCCAGTGGG + Intergenic
1036865391 8:12392065-12392087 GGACAAGCAGTGGCTCCAGTGGG + Intergenic
1037363013 8:18093993-18094015 GGAGAAGCAGGGGACCCCAGAGG - Intergenic
1037899442 8:22678851-22678873 GGAGCAGCAGGGGCCCCAGAAGG - Intergenic
1039686005 8:39802163-39802185 GGAAAAGCAGTTTCCCCAGCTGG + Intronic
1039872902 8:41561798-41561820 GGAGAATCACTTGACCCAGGAGG + Intergenic
1040602543 8:48898406-48898428 GGAGAATCGCTGGACCCAGGAGG + Intergenic
1042221238 8:66476856-66476878 GAAGAAGCAGCAACCCCAGGTGG + Intronic
1042243584 8:66689087-66689109 GGGGAAACAGTGCCCCCTGGAGG - Intronic
1042499005 8:69488842-69488864 GGACAAGCAGAGGCTGCAGGAGG + Intronic
1044625632 8:94233273-94233295 GGAGGACCAGTGCCGCCAGGTGG - Intergenic
1044880418 8:96717785-96717807 GCACAAGCAGTGGCTCCAGAGGG + Intronic
1045754613 8:105528124-105528146 GGAGAAGCCCTGAGCCCAGGTGG + Intronic
1047970930 8:130083881-130083903 GGAGAATCAGTGAACCTAGGAGG - Intronic
1048344491 8:133566509-133566531 GGGGATGCAGGGCCCCCAGGAGG - Intronic
1049181567 8:141225764-141225786 GGAGAAGCAGCCTCCACAGGAGG - Intronic
1049353894 8:142178351-142178373 GGAGATGCACTGGCCACAGTGGG - Intergenic
1049478969 8:142811009-142811031 GGAGGAGGAGTGGCCCGAGTGGG - Intergenic
1049682289 8:143924825-143924847 GGAGAAGCAGCGGCAGCTGGCGG - Exonic
1052743265 9:32414742-32414764 GGAGAGGCAGGGGCCACATGTGG + Intronic
1052834500 9:33240490-33240512 GGAGAAACTGAGGCCCCAAGAGG - Intronic
1053165605 9:35841702-35841724 GTAGACCCAGTGCCCCCAGGGGG - Exonic
1053645316 9:40116614-40116636 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1053760398 9:41346913-41346935 GGAGAACCCCAGGCCCCAGGAGG + Intergenic
1054326338 9:63714515-63714537 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1054539256 9:66259357-66259379 GGAGAACCCCAGGCCCCAGGAGG + Intergenic
1055604380 9:77953120-77953142 GGAGAAACAGAGGTCCCAAGAGG + Intronic
1056180190 9:84075551-84075573 AGAGAAGCTGTGGTCCCATGAGG - Intergenic
1057220741 9:93256467-93256489 GGAGGGACAGTGGCCACAGGAGG - Intronic
1057614679 9:96578906-96578928 GGAGAATCACTGGAACCAGGAGG - Intronic
1057704540 9:97387768-97387790 GGAGCTGCAGCTGCCCCAGGTGG - Intergenic
1059454738 9:114392752-114392774 GGAGAAGCAGTTTTCCCAAGTGG + Intronic
1060279476 9:122206293-122206315 GGAGACTCAGTGTCCCCATGGGG - Intronic
1060884521 9:127141030-127141052 GGAGTAGGAGAGGACCCAGGTGG + Intronic
1060998242 9:127886896-127886918 GGGGAAACCGAGGCCCCAGGAGG - Intronic
1061132070 9:128713863-128713885 GGAGAAACAGAGGCCCAGGGAGG - Intronic
1061179243 9:129014166-129014188 GGACCAGCAGTGCCCCCAGCTGG - Intronic
1061249790 9:129420099-129420121 GGAGAAGCTGAGGCCCAAGCAGG - Intergenic
1061263294 9:129491579-129491601 TGAGAAACAGAGGCCCAAGGAGG + Intergenic
1061804135 9:133128716-133128738 GGAGAAATTGAGGCCCCAGGAGG - Intronic
1061893648 9:133635743-133635765 GGAGCAGCAGTGGTACCAGCTGG + Intergenic
1062257013 9:135630627-135630649 GGAGAATCACTTGACCCAGGAGG + Intronic
1062265463 9:135684804-135684826 GGGGATGCAGAGGCCCCAGTCGG - Intergenic
1062367562 9:136218487-136218509 GGAACAGCAGTGGACGCAGGAGG + Intronic
1062577502 9:137215471-137215493 GGAGGAGCAGAGGCCCCGGCGGG - Exonic
1062638735 9:137505933-137505955 GGAGAGGGTGGGGCCCCAGGCGG + Intronic
1062641576 9:137521284-137521306 GGAGCTGCAGAGGCACCAGGCGG + Intronic
1202793117 9_KI270719v1_random:100070-100092 GGAGAACCCCAGGCCCCAGGAGG - Intergenic
1185433842 X:25773-25795 AGAGCTGAAGTGGCCCCAGGTGG - Intergenic
1185443050 X:237840-237862 AGAGCTGAAGTGGCCCCAGGTGG - Intergenic
1185996932 X:4962103-4962125 GGAGAATCATTGAACCCAGGAGG + Intergenic
1187034420 X:15522728-15522750 GGGGAAGCAGTGGCCCCACTGGG + Intronic
1189190532 X:39098761-39098783 GGAGCAGCGGTGGCACCTGGTGG - Intergenic
1190057878 X:47192405-47192427 GGGGAAGCAGTGGCCCAAGTTGG + Intronic
1190234641 X:48606186-48606208 GTAGAAGCAGGGGACCCAGCAGG + Exonic
1190436921 X:50434556-50434578 GGTGAAATAGTGGCCCCTGGGGG - Intronic
1191008744 X:55738919-55738941 GCACAAGCAGTGGTCCCAGTGGG + Intronic
1193106980 X:77687061-77687083 GGAGAATCACTTGACCCAGGAGG + Intronic
1193565101 X:83066103-83066125 AGAGAAGAAGTGGGACCAGGGGG + Intergenic
1193663091 X:84281083-84281105 GGAGAATCCTTGGACCCAGGAGG - Intergenic
1195799953 X:108697328-108697350 GTACAAGCAGAGGCCACAGGAGG - Exonic
1196204043 X:112918881-112918903 GGAGAATCACTGAACCCAGGAGG - Intergenic
1196734548 X:118973132-118973154 AGAGAAGCAGAGACCCGAGGGGG + Intergenic
1198275505 X:135094937-135094959 GGTGATGCAATGGCCCCAGGTGG - Intergenic
1198311018 X:135425783-135425805 GGTGATGCAGTGGCCCCGGGTGG + Intergenic
1198929328 X:141836929-141836951 GTGCAAGCAGTGGCCCCAGTGGG + Intergenic
1199903968 X:152206273-152206295 GGAAAAGAGGGGGCCCCAGGAGG - Intronic
1199950241 X:152700645-152700667 GGAGGACCAGAGGCCCCCGGAGG + Exonic
1199959436 X:152767816-152767838 GGAGGAACAGAGGCCCCCGGAGG - Exonic
1201150176 Y:11091397-11091419 GGAGAACCCCAGGCCCCAGGAGG + Intergenic