ID: 1173644777

View in Genome Browser
Species Human (GRCh38)
Location 20:44626547-44626569
Sequence CTATGAGTTTGTAGAGATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 292}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173644777_1173644782 12 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644782 20:44626582-44626604 ATAGCCTCCCGGCAGCCCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 132
1173644777_1173644781 11 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644781 20:44626581-44626603 GATAGCCTCCCGGCAGCCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 169
1173644777_1173644785 17 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644785 20:44626587-44626609 CTCCCGGCAGCCCCTGGGAAGGG 0: 1
1: 1
2: 4
3: 60
4: 350
1173644777_1173644791 27 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644791 20:44626597-44626619 CCCCTGGGAAGGGAAGAAAGGGG 0: 1
1: 0
2: 8
3: 55
4: 524
1173644777_1173644789 26 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644789 20:44626596-44626618 GCCCCTGGGAAGGGAAGAAAGGG 0: 1
1: 0
2: 3
3: 60
4: 528
1173644777_1173644779 1 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644779 20:44626571-44626593 CGATCCTTTTGATAGCCTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 35
1173644777_1173644784 16 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644784 20:44626586-44626608 CCTCCCGGCAGCCCCTGGGAAGG 0: 1
1: 1
2: 8
3: 59
4: 516
1173644777_1173644788 25 Left 1173644777 20:44626547-44626569 CCTTCATCTCTACAAACTCATAG 0: 1
1: 0
2: 0
3: 27
4: 292
Right 1173644788 20:44626595-44626617 AGCCCCTGGGAAGGGAAGAAAGG 0: 1
1: 0
2: 7
3: 78
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173644777 Original CRISPR CTATGAGTTTGTAGAGATGA AGG (reversed) Exonic
901206407 1:7499176-7499198 CCATGAGTGTGCAGAGAGGATGG + Intronic
901206425 1:7499551-7499573 CCATGAGTGTGTAGAGAGGATGG + Intronic
904694159 1:32318386-32318408 TTATTTTTTTGTAGAGATGAGGG - Intronic
906300129 1:44675482-44675504 TTTTAATTTTGTAGAGATGAAGG - Intronic
906968132 1:50480405-50480427 CTATGAGTATGTATAAATAACGG + Intronic
907585243 1:55611058-55611080 CTATCAGTTTGCACAGATGTGGG + Intergenic
907727602 1:57034304-57034326 CACTGAGCTTGCAGAGATGAGGG - Intronic
908443902 1:64183323-64183345 CTTTGAGTTTGTCCATATGAAGG - Intergenic
908998490 1:70188560-70188582 TTTTGTGTGTGTAGAGATGAGGG - Intronic
909632055 1:77778079-77778101 TTATTATTTTGTAGAAATGAGGG + Intergenic
914502957 1:148263684-148263706 CTATGGGTTTGTAGCTTTGACGG + Intergenic
914970569 1:152305298-152305320 CTGTGAGTGTCTAGAGATGTCGG + Exonic
914970721 1:152306270-152306292 CTGTGAGTGTCTAGAGATGTCGG + Exonic
914971665 1:152312105-152312127 CTGTGAGTGTCTAGAGATGTCGG + Exonic
915139611 1:153759108-153759130 CTATTTTTTTGTAGAGATGAGGG - Intronic
916332988 1:163639063-163639085 CTATGGATGTGTGGAGATGAAGG - Intergenic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917322021 1:173792499-173792521 CTATGCATTTGTAGAGAAAAAGG + Intergenic
917635516 1:176931872-176931894 CTATGACTTTGTAGAGAGAAGGG + Intronic
917755036 1:178090529-178090551 CTATTTTTTTGTAGAGATGAGGG + Intergenic
918660441 1:187081599-187081621 AGATGAGTTTGGAGAGGTGATGG + Intergenic
919529483 1:198699249-198699271 CTGTCAGTTTGTAGAGTTGATGG + Intronic
919553057 1:199016109-199016131 TTATGATTATGTAGAGAAGATGG + Intergenic
919634173 1:199987926-199987948 CTTTATTTTTGTAGAGATGAGGG + Intergenic
920059099 1:203215338-203215360 CCATGAGTTTGTAGAGGAGCAGG + Intronic
921541441 1:216421301-216421323 CTATATGTTTTTAGAGATGGAGG + Intronic
923995151 1:239485454-239485476 TTAAATGTTTGTAGAGATGAGGG + Intronic
924442984 1:244102317-244102339 TGATGCGTTTGGAGAGATGATGG - Intergenic
1063536572 10:6890053-6890075 CTATGAGTTTATAGTGATATAGG - Intergenic
1065288593 10:24208704-24208726 CTCTGAGATTAAAGAGATGAGGG + Intronic
1066355768 10:34682449-34682471 CTATGAATTTATAGAGAGCATGG - Intronic
1067211799 10:44265760-44265782 CAAGGAGTGTGTAGATATGAGGG - Intergenic
1069171044 10:65229640-65229662 CTATGAGTTTGTGAAGAAAAGGG + Intergenic
1072103582 10:92252690-92252712 GTATGTTTTTGTAGAGATGAGGG + Intronic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1075428549 10:122362161-122362183 CTGTGAGCCTGTAGAGAAGATGG + Intergenic
1075875746 10:125804280-125804302 CTATGAGTTTATAGAGCTTCTGG + Intronic
1080920972 11:36709085-36709107 TTATGAGCTTCTGGAGATGAAGG - Intergenic
1081215531 11:40392122-40392144 CTAGGGGTTTGTGGGGATGAGGG + Intronic
1082055326 11:47810370-47810392 GTATTTTTTTGTAGAGATGAGGG + Intronic
1082912805 11:58395818-58395840 CTATGAGTTTGGACAAATGCAGG - Intergenic
1084351237 11:68601309-68601331 CTCTGAGTTTGTGGGAATGAGGG + Intronic
1084871403 11:72100887-72100909 CTGGGAGTTTATAGAGGTGATGG - Intronic
1085214080 11:74812476-74812498 TTTTTATTTTGTAGAGATGAGGG + Intronic
1087268241 11:96084129-96084151 ATATGAGTTTGGGGAGAGGATGG + Intronic
1087770047 11:102199022-102199044 CTATGTGTTTGTGGAGGAGAAGG + Intronic
1087843688 11:102946901-102946923 CTGTGTGTATGTAGAGATGGAGG + Intronic
1088786602 11:113187937-113187959 CTATGACTTTATAGAAATAAAGG + Intronic
1089159617 11:116427644-116427666 CTATGACATTGTAGAATTGAGGG - Intergenic
1092259235 12:6943789-6943811 GTATGTGTTTGGAGAGAAGATGG - Intronic
1095182426 12:39161193-39161215 CTATGAGTTTCTAGAAACCAAGG + Intergenic
1096131772 12:49164891-49164913 CTATAAGGTTGTAGAGAAAATGG + Intergenic
1096948634 12:55439844-55439866 CGAGGAGTTTGAAGAGATGTTGG + Intergenic
1097692424 12:62746017-62746039 CTATTTTTTTGTAGAGACGAGGG - Intronic
1099978774 12:89574238-89574260 CAATGAGTTTGTAGAGGGTAAGG + Intergenic
1100452443 12:94720398-94720420 GTATTATTTTGTAGAGATGGAGG - Intergenic
1101591242 12:106127337-106127359 CAATTTTTTTGTAGAGATGAGGG + Intronic
1102291918 12:111707840-111707862 CTGGGAGTTTGTAAAGATGCTGG + Intronic
1103318410 12:120075556-120075578 CTAATTTTTTGTAGAGATGAGGG + Intronic
1104118183 12:125770950-125770972 CTATGAATTTCTGAAGATGAAGG - Intergenic
1106062229 13:26304839-26304861 TTATTATTTTATAGAGATGAGGG + Intronic
1106966672 13:35079147-35079169 CTATCAGAATTTAGAGATGATGG + Intronic
1108114919 13:47116634-47116656 ATATTACTTTGTAGAGATGAAGG + Intergenic
1108115081 13:47118715-47118737 CTATGAATTTGGAGAGAACATGG - Intergenic
1108463953 13:50695653-50695675 ATAAGAGTTTGTGGAGATGAAGG + Intronic
1109562275 13:64067149-64067171 TGAAGAGTTTGTAGACATGAGGG - Intergenic
1110696774 13:78500235-78500257 TTATGAGTTTGATGAAATGAAGG + Intergenic
1111605716 13:90536332-90536354 TTATGAGTTTATAGAAATAAAGG + Intergenic
1112531681 13:100210148-100210170 TTTTTATTTTGTAGAGATGAGGG + Intronic
1116348924 14:43833625-43833647 CTATAAGTTTGTAGCACTGATGG + Intergenic
1116590537 14:46765843-46765865 CTATGTGTTTGTGGTGATGCTGG - Intergenic
1117114611 14:52496781-52496803 TTATGTTTTTGTAGAGATGGGGG + Intronic
1117235209 14:53767266-53767288 CTATGTGTTTGTGGTGATGCTGG - Intergenic
1122480954 14:102046965-102046987 CTAATTTTTTGTAGAGATGAGGG + Intronic
1125350372 15:38760441-38760463 CTATGAAAGTGTAGAGAAGATGG + Intergenic
1125917845 15:43505328-43505350 CTTTGTGGTGGTAGAGATGATGG - Intronic
1126115204 15:45201722-45201744 CTAGGAGACTGTGGAGATGAAGG - Intergenic
1129798098 15:78393274-78393296 CTATTGTTTTATAGAGATGAGGG + Intergenic
1129906915 15:79194949-79194971 ATGTGAGTTTGGAGAGATGATGG - Intergenic
1130303745 15:82699434-82699456 GTATGAGTGAGGAGAGATGAGGG - Intronic
1131501523 15:92972188-92972210 ATATGGATTTGTAGAGATTAGGG + Intronic
1132212677 15:100036079-100036101 CTATGAGGCTGCAAAGATGATGG + Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1134239451 16:12494600-12494622 CTGTGAGCTGGTAGAGAAGATGG - Intronic
1138517806 16:57546882-57546904 CTAATATTTTGTAGAGATGGGGG + Intronic
1140843928 16:78868678-78868700 CTCTGAGATTGAAGAGAGGAAGG + Intronic
1144409019 17:14981869-14981891 ATAGGAGTTTGTAGAGAAGCAGG + Intergenic
1148487730 17:48001978-48002000 TTATTATTTTTTAGAGATGAGGG - Intergenic
1148812049 17:50299554-50299576 TTTTTATTTTGTAGAGATGAGGG + Intergenic
1150547285 17:66172889-66172911 CTATGTCTTTGTAGAAGTGAAGG - Intronic
1151820781 17:76495702-76495724 CTCTGAGTGTGTCGAGGTGAGGG - Intronic
1153175658 18:2369885-2369907 CAATGATTTGGTAGAGATAAGGG + Intergenic
1153748214 18:8202140-8202162 CTGTGAGTCTGAAGACATGAAGG - Intronic
1153925260 18:9830183-9830205 TTATGTGTTTGTAGAGATGGGGG + Intronic
1154046770 18:10913313-10913335 CTATGAGGTGGGAGAGATGAGGG + Intronic
1154215989 18:12416486-12416508 TTCTGTTTTTGTAGAGATGAGGG + Intronic
1156240632 18:35250626-35250648 CAATGAGCTTGGAGAGATGAGGG - Intronic
1156250754 18:35350401-35350423 CTATATTTTTGTAGAGATGGGGG - Intergenic
1156835040 18:41542591-41542613 TTTTTACTTTGTAGAGATGAGGG - Intergenic
1157155085 18:45257666-45257688 CTATGAGGTTGGAGAAATGGAGG - Intronic
1157201159 18:45661064-45661086 CTATGTGTTCCTAGAGTTGATGG - Intronic
1158302693 18:56069513-56069535 CTTTTAGTTTGTATATATGAAGG - Intergenic
1160618679 18:80153949-80153971 CTATCAGTTTGTAGAAATGCAGG - Intronic
1161338007 19:3724709-3724731 GTATTTTTTTGTAGAGATGAGGG + Intronic
1161789263 19:6349300-6349322 CTTTTATTTTGTAGAGATGGGGG - Intergenic
1162307570 19:9884557-9884579 CTATGGGACTGTAGAGATGCTGG + Intronic
1162585931 19:11558568-11558590 TTGTAATTTTGTAGAGATGAAGG - Intronic
1163045372 19:14637699-14637721 CTAATTTTTTGTAGAGATGAGGG + Intronic
1163470140 19:17491697-17491719 CAATTTTTTTGTAGAGATGAGGG - Intronic
1163757308 19:19113782-19113804 CTATTTTTTTGTAGAGATGGGGG - Intergenic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163882249 19:19935347-19935369 CTCTGAATTTGTAGTGATGAGGG - Exonic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164638216 19:29806850-29806872 CTATTTTTTTGTAGAGATGGGGG + Intergenic
1164866046 19:31605330-31605352 TTATTAGTTTGGAGAGAAGATGG + Intergenic
1166088852 19:40495091-40495113 GTATGTGTGTGTAGAGGTGAAGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
926271094 2:11366628-11366650 TTAATTGTTTGTAGAGATGAGGG + Intergenic
926930759 2:18038332-18038354 CTATCAGTTTTTTAAGATGAAGG + Intronic
927386140 2:22535951-22535973 CTATTTTTTTGTAGAGATGGGGG + Intergenic
928677907 2:33667933-33667955 TTTTAATTTTGTAGAGATGAGGG + Intergenic
929079296 2:38106555-38106577 CTATGTCTCAGTAGAGATGAGGG - Intronic
929873974 2:45781160-45781182 TTATTATTTTGTAGAGATGGGGG - Intronic
930222709 2:48761375-48761397 TTATTTTTTTGTAGAGATGAGGG + Intronic
930619089 2:53625726-53625748 CTAGGAGTTTATAGAAATCATGG - Intronic
931640437 2:64376288-64376310 CTATGAGGTGGTAGTGGTGATGG - Intergenic
933427219 2:82128531-82128553 CTAAGAGTTTGTGGAGACCAAGG - Intergenic
935676071 2:105595901-105595923 CTATGATTTTATGGAGATGCAGG - Intergenic
935723179 2:105997606-105997628 CTAGGAGTTTCAAGAGGTGATGG + Intergenic
936604879 2:113940984-113941006 CTAAGTTTTTGTAGAGATGGAGG + Intronic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
940177011 2:150889628-150889650 CTATGAGGTTGGAGAACTGAAGG - Intergenic
944318996 2:198313846-198313868 ATACGAGTTTGTAGAAAGGAGGG - Intronic
945071473 2:205992968-205992990 CTATTTTTTTGTAGAGATGGGGG - Intergenic
947861630 2:233362914-233362936 CTATGTGTTTGTGGTGATGCTGG + Intronic
947882960 2:233536473-233536495 GTATTTTTTTGTAGAGATGAGGG - Intronic
1168995710 20:2131439-2131461 ATATAATTTTGTAGAGATGGGGG - Intronic
1169083736 20:2814691-2814713 CTGTGAGTTTGCAGAGCTGCAGG - Intergenic
1170460434 20:16572843-16572865 TTCTGAGTTGGTAGAAATGAGGG + Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173644777 20:44626547-44626569 CTATGAGTTTGTAGAGATGAAGG - Exonic
1174003185 20:47389720-47389742 ATATTTGTTTGTAGAGATGGGGG + Intergenic
1174273640 20:49387467-49387489 ATATGAGTCTGGAGAGATGCTGG + Intronic
1174423214 20:50414159-50414181 TTTTAATTTTGTAGAGATGAAGG + Intergenic
1174992560 20:55527334-55527356 CTATGTGTGTTTAGAGATGGTGG + Intergenic
1176943705 21:14954068-14954090 CTATGAGTGAGCAGAGGTGAAGG - Intergenic
1177449983 21:21253784-21253806 CTATGAACTTGTAGATATCAGGG + Intronic
1178276452 21:31242345-31242367 CTATTTTTTTGTAGAGATGGAGG - Intronic
1178390784 21:32196343-32196365 CTAAGAGGTGGTAGAGCTGATGG - Intergenic
1178592382 21:33922241-33922263 TTATCTTTTTGTAGAGATGAGGG + Intergenic
1180974641 22:19841453-19841475 TTATTTGTTTGTAGAGATGGGGG - Intronic
1183266442 22:36829189-36829211 CTATGAGCTTGTCGAGCTCAGGG + Intergenic
1183397762 22:37582512-37582534 CTATGAGCTTATAACGATGAGGG - Intronic
1184633458 22:45805214-45805236 TTATGAGATTGTGGAGATGCTGG + Intronic
949692021 3:6651566-6651588 CCATGAGTTTATAAAGAAGATGG - Intergenic
950248651 3:11445404-11445426 CGATGAGTTTGTAAGGATAAAGG - Intronic
950458467 3:13106485-13106507 CCATGAAATTGTACAGATGAGGG + Intergenic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
953022543 3:39124921-39124943 CTTTAAGTTTGTAGAAATGTTGG + Intronic
953926710 3:46986272-46986294 CTAGGAGTATGTAGAGATTGAGG + Intronic
953998594 3:47538866-47538888 GTATGTGTGTGTAGAGATGGGGG - Intergenic
954791109 3:53134146-53134168 ATTTGAGTTTGGAGAGATCAAGG + Intergenic
955681931 3:61511183-61511205 CTCTGATTTTATAGTGATGATGG - Intergenic
956875026 3:73454227-73454249 CTCTGGGTTTGTATAGATGGTGG - Intronic
957264781 3:77949054-77949076 CCATGAAGTTGTAGAGATGAGGG - Intergenic
957748830 3:84384407-84384429 CTCTGATTTAGTAGAGGTGATGG + Intergenic
958731308 3:97963298-97963320 CTCTTATTTTGTAGAGATGGTGG + Intronic
959302558 3:104621563-104621585 CTATGAGTTTTGAGAGATACGGG + Intergenic
960889999 3:122437754-122437776 CTATCAGTTTATAAAGGTGAAGG + Intronic
963157855 3:142118199-142118221 TTCTGAATTTGTAGTGATGATGG - Intronic
965172830 3:165290163-165290185 CTGTGAGATTGTAGAGAAAAAGG - Intergenic
966062880 3:175781404-175781426 TCATGTGTTTGTAGTGATGATGG + Intronic
966072630 3:175897256-175897278 CTCTTAGTTTGCAGTGATGAAGG + Intergenic
966137495 3:176715925-176715947 CTTTGAGTTTGAAGAGATTAAGG + Intergenic
969121476 4:4914547-4914569 CTTTGGGTCTGAAGAGATGAGGG + Intergenic
970115158 4:12686630-12686652 TTATTTGTTTGTAGAGATGAGGG - Intergenic
970936115 4:21571898-21571920 CTATGAGTTTGATTAGATAATGG - Intronic
971128543 4:23780494-23780516 CTTTGAGTTTGTAAGGATGCTGG - Intronic
972193170 4:36619350-36619372 TTATTTTTTTGTAGAGATGAGGG - Intergenic
973306500 4:48658562-48658584 GTATTTTTTTGTAGAGATGAGGG - Intronic
974025481 4:56729728-56729750 CTTAAATTTTGTAGAGATGAGGG - Intergenic
974163915 4:58175514-58175536 CTATGAAGATGTAGAAATGATGG - Intergenic
974277490 4:59743272-59743294 GTATTATTTTGTAGATATGAAGG - Intergenic
975092147 4:70416535-70416557 CTATGAGTTTGAACTGATGAAGG - Intergenic
976608405 4:87004240-87004262 CGATGAGTGTGGAGAGGTGAGGG + Intronic
977402554 4:96551215-96551237 CTATCAGCTTGCAGTGATGAAGG + Intergenic
979357628 4:119724148-119724170 ATATGAGATTGTAGGGAAGAAGG + Intergenic
980225109 4:129973336-129973358 CTATAAGTTTGCAGAAAAGATGG - Intergenic
982565493 4:156980667-156980689 TTATCAGTTTGTAGTGATGGTGG - Intergenic
983055913 4:163098734-163098756 CTATGTGTTTTGGGAGATGAGGG + Intergenic
984821415 4:183885944-183885966 TTATGAGTCTGCAGAGATGGAGG + Intronic
985169732 4:187136223-187136245 GTAGGATTTTGTAGAAATGATGG + Intergenic
986195079 5:5530964-5530986 TTTTAATTTTGTAGAGATGAGGG + Intergenic
989488595 5:42022816-42022838 GTATGAGAGTGTGGAGATGAGGG + Intergenic
989526443 5:42458991-42459013 CTGTGAGGTTGTAGAGAAAAGGG + Intronic
989721466 5:44533814-44533836 AAATGCTTTTGTAGAGATGAGGG + Intergenic
990228395 5:53683125-53683147 CTATGACATTGAAGAGAGGAAGG + Exonic
991133088 5:63149007-63149029 CTAGGAGCTTGAAGAGATCATGG - Intergenic
992777599 5:80102180-80102202 CTATGAGTATTTAGAGAAGAAGG - Intergenic
993688082 5:90965709-90965731 TTGTGAGTTTGAAGAAATGATGG + Intronic
994947855 5:106419044-106419066 CTATAAGTTAGTAGAAAAGAAGG + Intergenic
995991285 5:118242746-118242768 CTATGAGTTGGTAATGAAGAAGG - Intergenic
996189852 5:120526696-120526718 CTATGATTTTTCAGAGATCAGGG - Intronic
997505814 5:134415873-134415895 GTAATTGTTTGTAGAGATGAGGG - Intergenic
999341033 5:150772713-150772735 TTATGTGTTTGTAGTGATGCTGG - Intergenic
999791654 5:154945478-154945500 ATATGAGTTTATAGAGTTCAGGG + Intronic
1000299454 5:159942636-159942658 TTGTGTGTTTGTAGAGATGAGGG - Intronic
1000732953 5:164859168-164859190 CAATGAATTTGTAGAGTTGAGGG - Intergenic
1001218963 5:169882970-169882992 CTGTGAGTCCGTGGAGATGAAGG + Exonic
1001972151 5:175965399-175965421 CTATAAGATTTTATAGATGAAGG + Intronic
1002015600 5:176319516-176319538 TTATTATTTTTTAGAGATGAGGG - Intronic
1002245289 5:177878378-177878400 CTATAAGATTTTATAGATGAAGG - Intergenic
1003710168 6:8580611-8580633 CTATGAGTTTAGACAAATGAAGG - Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1008134476 6:47757930-47757952 GTGTGTGTTTGTTGAGATGAAGG + Intergenic
1008207220 6:48676261-48676283 CTATGAGTTCCTAGAGAATATGG + Intergenic
1008256400 6:49306100-49306122 CTATGAGTTTCTGGAGCAGAAGG - Intergenic
1008534046 6:52493203-52493225 CTATGACTTAGGAGAGCTGATGG - Exonic
1008627432 6:53331480-53331502 TTATGTGTTTGTGGAGATGTTGG - Intronic
1009503460 6:64446091-64446113 ATATGAGTTTCTAGAAATAAAGG - Intronic
1013095377 6:106939982-106940004 TGAAGAGTTTGTGGAGATGAAGG + Intergenic
1013235224 6:108192514-108192536 CTATTTTTTTGTAGAGATGGGGG + Intergenic
1013545400 6:111151994-111152016 ATATGAGTTTCTTGAGATTAGGG + Intronic
1013703959 6:112810255-112810277 CTATTTTTTTGTAGAGATGGGGG + Intergenic
1013996276 6:116312052-116312074 CACTGAGTTTTTAAAGATGAGGG - Intronic
1015224688 6:130843970-130843992 CTTTGAGTTTCTAGAGACAAAGG + Intronic
1016344789 6:143101498-143101520 CTCTGAGCAGGTAGAGATGAAGG + Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1017693094 6:156987004-156987026 TTATATTTTTGTAGAGATGAGGG - Intronic
1018312051 6:162520075-162520097 ATATATTTTTGTAGAGATGAGGG - Intronic
1018503425 6:164438406-164438428 TTGGGAGTTTGTGGAGATGAGGG - Intergenic
1019974286 7:4568161-4568183 TTATTTATTTGTAGAGATGAGGG - Intergenic
1021875880 7:25048706-25048728 GCATGAGTTTGTAGTGTTGAGGG - Intergenic
1022594000 7:31694458-31694480 ATATTAGTTTCTAGAAATGAAGG + Intronic
1024160857 7:46674037-46674059 CTATGACTTTTTGGTGATGATGG + Intronic
1024469248 7:49750103-49750125 CTATGAGTTTTCAAAGATCAGGG + Intergenic
1025790677 7:64684394-64684416 CACTGAGGTTGTAGAGATCAGGG - Intronic
1025928763 7:65979286-65979308 CTGTGAGGGTGTAGAGATGCTGG + Intronic
1026042853 7:66883033-66883055 CTATGTGTTTATACAGTTGAAGG + Intergenic
1026065003 7:67063242-67063264 CTAAGAGTTTTTAATGATGAAGG - Intronic
1026215754 7:68347364-68347386 TTTTTGGTTTGTAGAGATGAGGG + Intergenic
1026711864 7:72748626-72748648 CTAAGAGTTTTTAATGATGAAGG + Intronic
1029294047 7:99525297-99525319 TTATATTTTTGTAGAGATGAGGG - Intronic
1031597643 7:123666493-123666515 CTATGAGTTTCCAGGGAGGATGG - Intergenic
1033690758 7:143734493-143734515 TGAAGAGTTTATAGAGATGATGG - Intergenic
1034230513 7:149523292-149523314 CTCTGAGTCTATAAAGATGAGGG - Intergenic
1036509406 8:9386825-9386847 CTCTGAGATTGCAGAGATCAGGG - Intergenic
1038105781 8:24432373-24432395 CTGTAAGTTTTTAAAGATGAAGG + Intergenic
1038739492 8:30204420-30204442 ATAAGGGGTTGTAGAGATGAAGG + Intergenic
1039200433 8:35085517-35085539 TTATTTTTTTGTAGAGATGAGGG + Intergenic
1041422153 8:57679600-57679622 GTATGTGTTTGTAGAGAAGATGG - Intergenic
1041426971 8:57732683-57732705 CTATGTGTTTGTGGTGATGCTGG - Intergenic
1043290466 8:78593848-78593870 CTAGAAGTTTTTATAGATGAAGG - Intronic
1044132240 8:88538576-88538598 CTTTGAGTGAGAAGAGATGATGG - Intergenic
1045275336 8:100699119-100699141 ATTTTAGTTTGTAGAGATGGAGG - Intronic
1047637596 8:126781690-126781712 TCATGAGTTTGAAGAGAAGAAGG + Intergenic
1047859589 8:128950463-128950485 CTGTGCTTTTGTAGAGATCAAGG + Intergenic
1047982455 8:130197253-130197275 GTATTTTTTTGTAGAGATGAGGG - Intronic
1048248380 8:132834505-132834527 TTTTGCTTTTGTAGAGATGAGGG + Intronic
1049054530 8:140225172-140225194 CAAGGAGTTTGTAGTCATGAAGG - Intronic
1051037648 9:12768082-12768104 ATTTTATTTTGTAGAGATGAGGG + Intergenic
1051756483 9:20406281-20406303 GCATGAATTAGTAGAGATGAGGG - Intronic
1052200952 9:25779222-25779244 CTAGGAGGTTTTAGAAATGATGG - Intergenic
1053348068 9:37392681-37392703 CTATGAGTTAGGAAAGATGGTGG - Intergenic
1055019845 9:71658057-71658079 ATGTATGTTTGTAGAGATGAGGG + Intergenic
1055143525 9:72904468-72904490 ATATCAGTTAGTAGAGAAGAGGG - Intronic
1055774958 9:79757567-79757589 CCATGAGTATGTAGATATTATGG + Intergenic
1055927503 9:81525779-81525801 TGATGAGTTTCTAGAGAGGATGG - Intergenic
1056766622 9:89448146-89448168 CTATATTTTTATAGAGATGAGGG + Intronic
1056850285 9:90078040-90078062 CTGTCAGTTTATAAAGATGAAGG + Intergenic
1057771100 9:97968770-97968792 TTATTATTTTGTAGAGATGGGGG - Intergenic
1058502500 9:105635081-105635103 GACTGAGTTTGTAGACATGAAGG + Exonic
1059174148 9:112153981-112154003 TTATGTGTTTGTAGTGATGCTGG - Intronic
1059288130 9:113195437-113195459 CTTTGAGTTTGAAGAAATCATGG - Intronic
1059872482 9:118593442-118593464 CTGTGCGTTTGTAGAAATGTTGG - Intergenic
1060883478 9:127134777-127134799 CTATGAGTTTTTAAAAATAAAGG - Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061776756 9:132970779-132970801 CTCTGAGGCTGCAGAGATGAAGG - Intronic
1186123986 X:6392924-6392946 TTATGAATTTATATAGATGAGGG - Intergenic
1186672280 X:11780040-11780062 GTGTGTGTGTGTAGAGATGAGGG - Intergenic
1186732229 X:12421953-12421975 CTAAGTGTTTGTGGAAATGAAGG - Intronic
1187458559 X:19465064-19465086 CTATTATTTTGTAGAGATTGGGG + Intronic
1187535420 X:20137484-20137506 ATATGTGTGTGTACAGATGAAGG + Intronic
1187687966 X:21835013-21835035 AAATGTTTTTGTAGAGATGAGGG - Intergenic
1187949107 X:24454541-24454563 CAATAATTTTTTAGAGATGAGGG - Intergenic
1188702871 X:33286946-33286968 CTCTGAGGTTGAAGAGATGCGGG + Intronic
1190046725 X:47117421-47117443 TTATGCTTTTGTAGAGATGGGGG - Intergenic
1191868830 X:65728236-65728258 CATTGAGTTTGGAGAGATGAAGG - Intronic
1194542625 X:95193004-95193026 CTATGAGATTTTAAAGATAAAGG + Intergenic
1195450502 X:105006804-105006826 CTATGTGGTGGTAGAGATGATGG - Intronic
1197390429 X:125856610-125856632 CTATTAATAGGTAGAGATGAAGG - Intergenic
1199731977 X:150643023-150643045 CTATAAATATGTAGAGGTGATGG - Intronic
1200882275 Y:8228726-8228748 CTAAGAGTTTTTACAGATTAAGG - Intergenic
1201290144 Y:12414800-12414822 ATAAGAGTTTGTAGAGACCAAGG - Intergenic