ID: 1173646302

View in Genome Browser
Species Human (GRCh38)
Location 20:44635197-44635219
Sequence CCTTCCTCGCTGGGGAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173646294_1173646302 5 Left 1173646294 20:44635169-44635191 CCTTGAGGTCTGGGTAGGAAGGG 0: 1
1: 0
2: 1
3: 30
4: 257
Right 1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG 0: 1
1: 0
2: 4
3: 17
4: 203
1173646287_1173646302 29 Left 1173646287 20:44635145-44635167 CCTAAGAGAGGAGCTGCTGTGAG 0: 1
1: 0
2: 0
3: 24
4: 286
Right 1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG 0: 1
1: 0
2: 4
3: 17
4: 203
1173646292_1173646302 6 Left 1173646292 20:44635168-44635190 CCCTTGAGGTCTGGGTAGGAAGG 0: 1
1: 1
2: 2
3: 15
4: 176
Right 1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG 0: 1
1: 0
2: 4
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173646302 Original CRISPR CCTTCCTCGCTGGGGAACAG GGG Intronic
900080891 1:856556-856578 GCTTCCTCCCTGGGGCTCAGTGG + Intergenic
900640257 1:3685039-3685061 CCTCCCTCCCTGGGGTCCAGCGG - Intronic
901021446 1:6258001-6258023 ACTTCCTCTCTGGGGGACATGGG - Intronic
901396693 1:8987041-8987063 CCTCCCTCGCTGGGGTGCAGTGG + Intergenic
901856362 1:12046750-12046772 CCTTCCTCCCTGGCTGACAGGGG + Intergenic
902564349 1:17301154-17301176 CTTTCCTCCCTGGGGAAAGGAGG - Intergenic
904810000 1:33157268-33157290 TCTTCCTGCCTGGGAAACAGAGG + Intronic
904982514 1:34518565-34518587 ACTTCCTTGCTGGGTGACAGTGG - Intergenic
905762990 1:40576107-40576129 AGTTCCTCGCTAAGGAACAGTGG + Intergenic
907464658 1:54627142-54627164 CCTTCCTCGGCTGGGTACAGTGG - Intronic
907703263 1:56810397-56810419 GCTGCCTCGGTGGGAAACAGGGG - Intronic
912104673 1:106257350-106257372 CATTTCTCGCCGGGGCACAGTGG - Intergenic
915318406 1:155042721-155042743 CCTCCATCACTGGTGAACAGTGG - Exonic
916695780 1:167234692-167234714 TCATCCTGGCTGGAGAACAGTGG - Intronic
919781266 1:201222661-201222683 CCTACCTTGCTGGGGACCTGGGG + Intronic
920495928 1:206454864-206454886 CCGTCCTCGCTGGGGGAGAAGGG - Exonic
920845165 1:209587629-209587651 TCCTCCTCTCTGGTGAACAGAGG - Intronic
921300317 1:213745606-213745628 CCTCCTTCCCTGGGGGACAGAGG - Intergenic
1062979799 10:1712638-1712660 CCTCCTTCCCTGGGGGACAGAGG - Intronic
1064119554 10:12606795-12606817 ACTTCCTTGCTGGAGAACACAGG - Intronic
1065202359 10:23325302-23325324 CATTCCACCCTGGGCAACAGAGG + Intronic
1068721994 10:60255883-60255905 CCTTCCTCACTGGGGCCCAGAGG + Intronic
1069808430 10:71140768-71140790 CCTTCCTCAGTCGGAAACAGTGG + Intergenic
1069860452 10:71467979-71468001 CCTTCCTTCATGGGGAAAAGTGG + Intronic
1069886539 10:71627456-71627478 CCAGCCTCCCTGGGGACCAGAGG + Intronic
1070647010 10:78208799-78208821 CCTTCCACTCTGGGGAAGGGAGG - Intergenic
1071499275 10:86191911-86191933 CCTGCGTCGCTGGGACACAGAGG + Intronic
1074859127 10:117496965-117496987 CCTCCCACGGTGGGGAAAAGGGG + Intergenic
1074996552 10:118762071-118762093 CCATCCTAGCAGGGAAACAGAGG + Intergenic
1076171954 10:128326948-128326970 CCTTCCAAGCTGGGGAACTTGGG + Intergenic
1076776742 10:132701900-132701922 GTTTCCTCGCTGGGGAAATGAGG + Intronic
1076993181 11:286042-286064 CTTTCCTCACTGGGGAACCGGGG - Intergenic
1077025782 11:439281-439303 GCTTCCTCACTGGGAACCAGGGG - Intronic
1077506874 11:2933666-2933688 CCTTCCTGACTGAGGAGCAGTGG - Intergenic
1079160921 11:17993755-17993777 ACTTCCTCTCTGGTGAACATGGG - Intronic
1081080928 11:38738447-38738469 CCATACTCTCTGGGAAACAGAGG + Intergenic
1081787480 11:45757550-45757572 CCCTCCTCCCTGGGGAATATTGG + Intergenic
1082996850 11:59261976-59261998 CCTTCCAGGCTGGGGACCACAGG - Intergenic
1084911686 11:72394837-72394859 CCTTCCTTGCTGGGGAATACTGG + Intronic
1085518754 11:77126170-77126192 CCTTCCCCCCAGGGGGACAGAGG - Intergenic
1088065501 11:105713340-105713362 TCTTCCTGGCTGGGGTGCAGTGG - Intronic
1088476881 11:110249832-110249854 CCTGCCAGGCTGGGGCACAGTGG - Intronic
1089347762 11:117801996-117802018 CATTTCTCTCTGGGGAGCAGTGG + Intronic
1090071263 11:123546579-123546601 CAGACCTCACTGGGGAACAGGGG - Intronic
1090155922 11:124438842-124438864 TCCTCCTAGCTGGGCAACAGTGG - Intergenic
1090462177 11:126901378-126901400 CCTTCTTCCTTGGGGAGCAGGGG + Intronic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1103191138 12:119003143-119003165 CCTTCCTTGCTGGGACCCAGAGG - Intronic
1103881917 12:124172726-124172748 ACTTACTCGCTGTGGAAGAGAGG - Intronic
1105747126 13:23387900-23387922 CCTTTCTGGCTGGGGTACAGTGG - Intronic
1107066238 13:36216579-36216601 CTCTCCAGGCTGGGGAACAGAGG + Intronic
1107961275 13:45561640-45561662 CCTTCCTCACTGGGGAAAAATGG - Intronic
1110045219 13:70819423-70819445 CCTCCCAGGCTGGAGAACAGTGG - Intergenic
1112212285 13:97389670-97389692 CATTCCTAACTGGGCAACAGAGG + Intronic
1112248715 13:97758099-97758121 CCAGCCACTCTGGGGAACAGTGG + Intergenic
1112616902 13:101015597-101015619 CCTTCATCCCTTGGGACCAGGGG - Intergenic
1112910186 13:104472901-104472923 CCTTCATTGCTGGAGAACAATGG - Intergenic
1113593652 13:111517393-111517415 CCTTCCTCACTGGGAAAAAGAGG - Intergenic
1120769085 14:88358954-88358976 CCCTCCTCACTGGGTGACAGGGG - Intergenic
1121013501 14:90535078-90535100 CCTCCCTCGGTGGGGAAAGGAGG - Exonic
1121467504 14:94125479-94125501 AGTTCCTCCTTGGGGAACAGGGG + Intergenic
1122246080 14:100404504-100404526 TGTTCCTGGCTGGGAAACAGGGG + Intronic
1122870212 14:104634997-104635019 GCTTCTCCGCTGGGGAGCAGAGG - Intergenic
1127505760 15:59596381-59596403 CCTTTCTAGGTGGGGAGCAGAGG - Intronic
1129167404 15:73786635-73786657 CCTCCCTCGCTGGCCCACAGTGG + Intergenic
1129276532 15:74449289-74449311 CCAGCCTCCCTGGGGTACAGTGG - Exonic
1130223161 15:82038482-82038504 CCTCCCTGGCTAGGGAACAAGGG - Intergenic
1130322152 15:82850359-82850381 CCTTCCTCTCTGAGGGCCAGAGG - Intronic
1131906857 15:97152346-97152368 ATTTCCTCACTGGGGACCAGTGG + Intergenic
1133888609 16:9855989-9856011 CATTCCTAGCTGGGGCACAGTGG + Intronic
1135160317 16:20088719-20088741 CATTCCAAGCTGGGCAACAGAGG + Intergenic
1135205282 16:20478699-20478721 CCATCCTCACTGGGGAACAGAGG - Intronic
1135213622 16:20545113-20545135 CCATCCTCACTGGGGAACAGAGG + Intronic
1136412855 16:30086843-30086865 TCTCGCTCCCTGGGGAACAGTGG + Exonic
1137446237 16:48534279-48534301 CCTTCCACGCTGGGGAGAGGAGG + Intergenic
1139444799 16:66990663-66990685 CCTTCCAGCCTGGGCAACAGAGG + Intronic
1139960816 16:70716354-70716376 GCTCCCTGGCTGGGGAACAGGGG - Intronic
1140868695 16:79087239-79087261 CGCTCCTGGCTGGGGAAGAGAGG - Intronic
1141518331 16:84561165-84561187 CATTCCTGCCTGGGCAACAGAGG + Intergenic
1141659832 16:85435865-85435887 GCTTCCTGCCTGGGGAACATGGG - Intergenic
1142378763 16:89720612-89720634 CCGTCCTCGCCCGGGAACCGCGG + Intronic
1142593189 17:1016640-1016662 ACCTCCTGGGTGGGGAACAGAGG - Intronic
1143008154 17:3850603-3850625 CCCTCCTTGCTGGGTAAGAGAGG - Intergenic
1146649303 17:34596993-34597015 CCTTCCTAGCTTTGGAGCAGAGG - Intronic
1146662722 17:34675312-34675334 CCTGCCTCCCTGGGCATCAGGGG - Intergenic
1146885021 17:36464765-36464787 CCATCCTCGCTGCGGAAAAAAGG - Intergenic
1147959140 17:44155483-44155505 TCTTCCACCCTGGGGAGCAGAGG + Intronic
1148335886 17:46841286-46841308 CCTTCCTAGCTGGGTGACCGTGG - Intronic
1148491635 17:48027144-48027166 CCCTCCTCTCTTGGGGACAGTGG + Intronic
1149809411 17:59653583-59653605 CCTTCCAGCCTGGGCAACAGAGG - Intronic
1151332487 17:73418949-73418971 CATTCCTCGCTGGTGTCCAGGGG + Intronic
1152094427 17:78264733-78264755 CCATCCTAGCTGGGGAAGGGAGG + Intergenic
1152561101 17:81079185-81079207 TTTTCCTTGCTGGGGAGCAGGGG + Intronic
1152648025 17:81479140-81479162 CATTCCACCCTGGGGAATAGAGG - Intergenic
1153766519 18:8379601-8379623 ACCTGCTGGCTGGGGAACAGGGG + Intronic
1153880536 18:9418273-9418295 AGTTCCACGCTGGTGAACAGGGG - Intergenic
1155199569 18:23505089-23505111 CACTCCACCCTGGGGAACAGAGG - Intronic
1158749880 18:60246182-60246204 ACTTCCTTTCTGTGGAACAGTGG + Intergenic
1161318606 19:3630868-3630890 CCTCCCTCGCGGGGGATCTGAGG + Exonic
1161520145 19:4719400-4719422 CCTTCCTCTCTGGGTGACATTGG - Intronic
1161751079 19:6097158-6097180 CCTTCAACACTGGGCAACAGAGG + Intronic
1161770656 19:6229014-6229036 CCTTCATCGCTGTGGAGCAAAGG + Intronic
1162029516 19:7911346-7911368 CACTCCTGGCTGGAGAACAGGGG - Intronic
1162802423 19:13118681-13118703 CCTCCCTCGCTGGGAGACGGGGG - Intronic
1164872430 19:31657056-31657078 CCTCCCTCCCTGTGGAACTGTGG - Intergenic
1166730356 19:45055895-45055917 CCTGACTCGCTGTGGGACAGTGG - Intronic
1166866705 19:45842904-45842926 CCTTTTTCACTGTGGAACAGGGG - Intronic
1168349983 19:55670154-55670176 CCTTCCACGATGGGGCTCAGGGG - Intronic
927528244 2:23768661-23768683 CCTTCATTGCTTGGGAATAGAGG - Intronic
929919368 2:46161567-46161589 CCTTCCTGCTTGGGGAAGAGTGG + Intronic
930012187 2:46945914-46945936 CCTTCCCCGCTGGGGCAAACGGG - Intronic
932578902 2:72980805-72980827 CCTGGCCTGCTGGGGAACAGAGG - Intronic
932682338 2:73836698-73836720 TCTTCCTCCCTGGGGCTCAGAGG + Intronic
935627432 2:105183073-105183095 CACTCCGCCCTGGGGAACAGAGG - Intergenic
936057069 2:109269327-109269349 CCTTCCCCCCGGGAGAACAGAGG + Intronic
936911858 2:117601826-117601848 CCTTCCTATCTGAAGAACAGAGG + Intergenic
937122722 2:119451973-119451995 TCTCCCTAGCTGGGGATCAGTGG - Intronic
937907958 2:127061535-127061557 CTTTCCTGGCTGTGGATCAGAGG - Intronic
939956880 2:148534594-148534616 CTTTCCTCTCTGGGGAAGTGTGG + Intergenic
940025238 2:149199845-149199867 CCTTCCTTGCAAGGGAACTGAGG - Intronic
942480955 2:176387599-176387621 TCTTCCAGGCTGGGGTACAGTGG + Intergenic
942543186 2:177035814-177035836 CCTTGCTGGCTGGGGAGCAGTGG - Intergenic
946793100 2:223321303-223321325 CTTTACTGGCTGGGGATCAGGGG + Intergenic
947200782 2:227612906-227612928 CCTCCCTCAGTGGGGAAAAGCGG + Intronic
948366009 2:237455232-237455254 CCTGCCTCGCTGTGCCACAGTGG - Intergenic
948431727 2:237923142-237923164 CCAGCCTTCCTGGGGAACAGCGG - Intergenic
948939426 2:241188665-241188687 CCGTCCTCACTGCGGGACAGAGG - Exonic
1172023711 20:31933960-31933982 CCTGCCTCACTGGTGAACACAGG - Intronic
1173260739 20:41432600-41432622 CTTTCTTGGCAGGGGAACAGAGG - Intronic
1173646302 20:44635197-44635219 CCTTCCTCGCTGGGGAACAGGGG + Intronic
1174198447 20:48790088-48790110 CTTTCCTCGCTGAGGAACCCTGG + Intronic
1177188301 21:17821597-17821619 CCTCCAACGCTGGGGATCAGTGG + Intergenic
1179877601 21:44278438-44278460 CCATCCTAGCTGGGGTAAAGTGG + Intergenic
1180698577 22:17769666-17769688 CCGTCCTGGCTGCGGAACTGAGG - Intronic
1181289286 22:21778555-21778577 CCTTCCAGCCTGGGCAACAGAGG + Intronic
1182537435 22:31015503-31015525 GCTTCCATGATGGGGAACAGTGG - Intergenic
1182581946 22:31319174-31319196 CATTCCACCCTGGGTAACAGAGG - Intergenic
1183030927 22:35103968-35103990 CCTTCCTCCCTGGGGAGTACAGG - Intergenic
1183601489 22:38843095-38843117 CCTTCCTCGCTGGCGAGGCGGGG - Intronic
1183733673 22:39631874-39631896 CCTTCCTTGCCAGGGAAGAGGGG - Intronic
1183735484 22:39642573-39642595 CCTTCCTGGCTGTGTGACAGTGG + Intronic
950943229 3:16916163-16916185 CCTGCCACACTGTGGAACAGAGG + Intronic
953876174 3:46668040-46668062 CCTTCTTCCTAGGGGAACAGGGG + Intergenic
953923538 3:46968369-46968391 CCTTCTCCGCTGGGTGACAGTGG - Intronic
954035767 3:47850243-47850265 CCTTCCTCTTTGGGGAACCGTGG - Intergenic
954774816 3:53007253-53007275 CCTACCTAGCGGGGGAAAAGAGG - Intronic
955753093 3:62202681-62202703 ACTTCCTCACTGGGAGACAGTGG + Intronic
958992893 3:100867953-100867975 CCATAATCGCTGGGGAACACTGG - Intronic
962121475 3:132565211-132565233 CCTTCCTGGCAGGGGAGCTGGGG - Intronic
962616179 3:137129094-137129116 ACTCCCTCGCTTGGGAGCAGAGG - Intergenic
963759469 3:149272503-149272525 CCTTCCTTGGTTGGGTACAGTGG - Intergenic
967631010 3:191742906-191742928 CCTTCTTTGAGGGGGAACAGGGG + Intergenic
969532267 4:7736594-7736616 CTTTCCTCGCTGGGAAATCGAGG + Intronic
970239078 4:13989283-13989305 ACTTCCTAGCTGGGTAGCAGTGG + Intergenic
970297125 4:14642097-14642119 CCTTCCGGCCTGGGTAACAGAGG + Intergenic
971423921 4:26498106-26498128 CCTTCCAGCTTGGGGAACAGAGG - Intergenic
976185012 4:82434678-82434700 CCTTCCAGCCTGGGCAACAGAGG + Intronic
976409487 4:84696764-84696786 CCTTCCACCCTGGGCAAAAGGGG - Exonic
977891521 4:102317701-102317723 TCTTCCTTGCAGGGAAACAGTGG - Intronic
978426526 4:108588452-108588474 CATTCCAGCCTGGGGAACAGAGG + Intergenic
978503386 4:109433273-109433295 CCTTCCTCGAAGAGGAACAATGG - Intergenic
978791351 4:112666292-112666314 TCTTCCTGGCTGGAGTACAGTGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
984401180 4:179267148-179267170 CCTTCCAGGCTGGAGCACAGTGG + Intergenic
985332383 4:188852347-188852369 CTTTGTTCACTGGGGAACAGTGG - Intergenic
985555334 5:555330-555352 CCTCCCCAGCTGTGGAACAGGGG - Intergenic
985777297 5:1851475-1851497 CCTGGCCCCCTGGGGAACAGCGG + Intergenic
987253793 5:16127629-16127651 CCCTCCCTGCTGGGGAACAATGG - Intronic
987274224 5:16345030-16345052 ACATTCTAGCTGGGGAACAGGGG + Intergenic
997753786 5:136375277-136375299 CCTTCCTCGCGGGGGAAGCTGGG - Intronic
998077356 5:139247390-139247412 TCTTCCTGTCTTGGGAACAGAGG + Intronic
1001196835 5:169680679-169680701 TCTTCCAGGCTGGGGTACAGTGG - Intronic
1001680444 5:173553141-173553163 CGTACCTGGCTGGGGAACACTGG + Intergenic
1002356357 5:178632505-178632527 CCTTCCTCACAAGGCAACAGGGG + Intergenic
1002472011 5:179440898-179440920 CCTTCCTCTCTAGGACACAGGGG + Intergenic
1005032777 6:21526907-21526929 CCTTCCTCGGTGCTGAAGAGGGG - Intergenic
1005988051 6:30886300-30886322 CCCACCTCTCTCGGGAACAGCGG - Intronic
1006938615 6:37736380-37736402 CCTTCCTCCCTGGGGACCAGTGG - Intergenic
1007234952 6:40383921-40383943 CCATCCTAGAAGGGGAACAGTGG + Intergenic
1007696960 6:43740223-43740245 AATTCCTCTCTGGGGAACTGAGG - Intergenic
1010888528 6:81273928-81273950 CACTCCTGCCTGGGGAACAGAGG + Intergenic
1011835988 6:91432329-91432351 CCATCCAGGCTGGGGTACAGTGG + Intergenic
1015496716 6:133890154-133890176 CCATCCTCCCTGGGGTGCAGTGG + Intronic
1017014222 6:150087159-150087181 CATTCCAGGCTGGGGAAGAGGGG + Intergenic
1018129545 6:160715965-160715987 CCTTCCTCAGTGGGGCCCAGTGG - Intronic
1018678325 6:166242111-166242133 CCTGCCTCTCTGGGGAGCATCGG + Intergenic
1019738536 7:2661885-2661907 CCCTCCCCGCAGGGGCACAGTGG + Exonic
1019803811 7:3107842-3107864 CCTTCCTGCCTGGGGATGAGAGG + Intergenic
1022028532 7:26470445-26470467 CCCTTCTCCCTGGGGGACAGAGG + Intergenic
1023108315 7:36785144-36785166 CCTCCCTCCCTGGGGAACACAGG - Intergenic
1033121977 7:138674524-138674546 CCTTCCTAGCTGGTGAGCTGGGG + Intronic
1033570788 7:142626654-142626676 CCCTCCTCGCTGGTGAATGGAGG + Intergenic
1034031595 7:147772686-147772708 CCTTCCTCCCCAGTGAACAGAGG + Intronic
1035284238 7:157796012-157796034 CCTTCCTGGCTGGAGAAAAATGG + Intronic
1035524377 8:300906-300928 GCTTCCTCCCTGGGGCTCAGTGG - Intergenic
1035751595 8:2000969-2000991 CCCTCCTCGCTGGAGAGGAGAGG + Exonic
1037917584 8:22781830-22781852 CCTTCCTCCCTGGGGAAGAGGGG + Intronic
1038726145 8:30084073-30084095 TCTTCCCATCTGGGGAACAGTGG + Intergenic
1039427869 8:37501676-37501698 CCTCACTCGCTGGGGGACTGTGG - Intergenic
1045282046 8:100757807-100757829 CCTTCCTCGCTGGGGACCGCAGG + Intergenic
1048162961 8:132037796-132037818 CCTGCCTCCCTTTGGAACAGAGG - Intronic
1049243024 8:141548376-141548398 CCTCCCTCTCTGGGGCACGGAGG - Intergenic
1049529232 8:143146159-143146181 TCTGCCTCGCTGGGCAACTGTGG + Intergenic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1052279108 9:26712768-26712790 CCTTCCCCTCTGTGGGACAGTGG - Intergenic
1054767763 9:69056585-69056607 TCATCCTGGCTGGAGAACAGTGG - Intronic
1055299663 9:74870010-74870032 CCTTTCTCTCTGGGTAAGAGGGG - Intronic
1057000960 9:91508932-91508954 CCTCACTGGCTGGGGAATAGTGG + Intergenic
1057025486 9:91731653-91731675 CCCTCCTGGCTGGGGCACCGTGG + Intronic
1057483807 9:95466332-95466354 CCTTTCTTGGTGGGGCACAGTGG - Intronic
1059522748 9:114958881-114958903 TCTTCCTTCCTGGGTAACAGTGG + Intergenic
1059584940 9:115595955-115595977 GCTCACTTGCTGGGGAACAGTGG - Intergenic
1061152215 9:128835394-128835416 TCTTCCTCTCTGGGAGACAGAGG + Exonic
1061907769 9:133707666-133707688 CTTTGCTTTCTGGGGAACAGGGG - Intronic
1062241298 9:135540528-135540550 CCTGCCTTGCGGGGGAAGAGAGG - Intergenic
1186323120 X:8452042-8452064 CCTTCCACACTGTGGAACTGTGG - Intergenic
1188142662 X:26571207-26571229 CCTTCCTACCTGGACAACAGAGG + Intergenic
1192150052 X:68706529-68706551 CCTCTCTCCCTGGGGGACAGTGG - Intronic
1195923527 X:110003866-110003888 CCTTCCTCTCTTGGCAGCAGCGG + Exonic
1196961711 X:121010498-121010520 GTTTCCTCTCTGGGGAACAGAGG - Intergenic
1197196590 X:123708784-123708806 CCCTCCAGGCTGGGGTACAGTGG + Intronic
1198532598 X:137560795-137560817 CCTTCCTCGCTGAGGGGCAGAGG - Intergenic
1198861650 X:141077131-141077153 CCTTCCAGCCTGGGCAACAGAGG + Intergenic
1198901041 X:141510251-141510273 CCTTCCAGCCTGGGCAACAGAGG - Intergenic
1200837709 Y:7749174-7749196 CCTACATGCCTGGGGAACAGGGG + Intergenic