ID: 1173647699

View in Genome Browser
Species Human (GRCh38)
Location 20:44643852-44643874
Sequence CCACGGTGCCTGGCACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1471
Summary {0: 1, 1: 1, 2: 41, 3: 280, 4: 1148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173647699 Original CRISPR CCACGGTGCCTGGCACATAG TGG (reversed) Intronic
900216031 1:1482124-1482146 CCACGGTGGCTGCCCCAGAGAGG - Exonic
900223150 1:1520127-1520149 CCACGGTGGCTGCCCCAGAGAGG - Exonic
900678565 1:3903589-3903611 GCATGGTGCCTGGCACACTGTGG + Intergenic
901096900 1:6688901-6688923 GCACAGTGCCAGGCACATAATGG - Intronic
901350124 1:8588039-8588061 TTACAGTGCATGGCACATAGTGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901694791 1:10998912-10998934 CCACCGTGCCTGGCACACTGGGG - Intergenic
901755003 1:11436050-11436072 CCACTGTGCCCGGCCCATGGTGG + Intergenic
902065363 1:13681231-13681253 CCACAGTGCCTTACCCATAGCGG - Intergenic
902275335 1:15335624-15335646 GCACAGTGGCTGGCACACAGGGG - Intronic
902401825 1:16162155-16162177 CCATGGTGCCGGGCATACAGTGG + Intergenic
902490918 1:16779818-16779840 GCACAGTGGCTGGCACAGAGTGG + Intronic
902603176 1:17553848-17553870 GCACAGTGCCTGGCACCCAGTGG - Intronic
902815079 1:18911824-18911846 CCACTGCGCCTGGCCCAAAGGGG + Intronic
902985449 1:20151786-20151808 CCACCGCGCCTGGCCCAGAGCGG + Intergenic
903002953 1:20279414-20279436 TCCCAGTGCCTGGTACATAGTGG - Intergenic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903139161 1:21328366-21328388 ACCTTGTGCCTGGCACATAGTGG + Intronic
903352506 1:22726331-22726353 GGATGGTGCCTGGCACTTAGTGG - Intronic
903568388 1:24285870-24285892 ACACGGTGCCTGGAGCACAGTGG - Intergenic
903686237 1:25134390-25134412 GCATGGGGCCTGGCTCATAGTGG - Intergenic
903710168 1:25317447-25317469 CCCCAGTGCCTGGCTCATAGTGG - Intronic
903716948 1:25374959-25374981 CCCCAGTGCCTGGCTCATAGTGG + Intronic
903781267 1:25821336-25821358 GCACAGAGCCTGGCACACAGAGG + Intronic
903864986 1:26391550-26391572 GCATGGTGTCTGGCACATAGTGG + Intergenic
903925073 1:26826420-26826442 GCACCGTGCCTGGTACACAGTGG + Intergenic
903952372 1:27003813-27003835 GAACGGTGTCTGGCACATGGTGG + Intergenic
904081815 1:27877036-27877058 ACACGGAGCCTGGCACACATGGG - Intronic
904088272 1:27926478-27926500 TCACAGTTCTTGGCACATAGAGG + Intergenic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904272369 1:29358569-29358591 GCACAGAGCCTGGCACAGAGTGG - Intergenic
904300651 1:29551284-29551306 GCACAGGGCCTGGCACATGGAGG + Intergenic
904330468 1:29755082-29755104 GCACAGTGCCTGGTACACAGTGG + Intergenic
904339879 1:29827879-29827901 GCACAGTGCCTGGTACACAGTGG + Intergenic
904426527 1:30427347-30427369 ACACGATGCCTGGCAGATTGAGG - Intergenic
904447580 1:30587437-30587459 GCACAGTGGCTGGCACACAGTGG - Intergenic
904450896 1:30610783-30610805 CCCCAGTGCCAGGCCCATAGTGG + Intergenic
904457553 1:30656759-30656781 GCACAGGGCCTGGCACATGGAGG - Intergenic
904600439 1:31669864-31669886 CCAAGGTGCCGGGCACAGAGGGG + Intronic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904853339 1:33476088-33476110 GCACTGTGCCTGGCACCTTGTGG + Intronic
904870531 1:33615056-33615078 GCATGGTGCCGGGCACAGAGTGG - Intronic
904894075 1:33800918-33800940 GCACAGGGCCTGGCACAGAGAGG + Intronic
905092315 1:35439443-35439465 GCACAGGGCCTGGCACATAGTGG + Intronic
905172524 1:36117569-36117591 GAACGGTACCTGGCACACAGTGG - Intronic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905491861 1:38350629-38350651 CCACTGTGCCTTCAACATAGTGG - Intergenic
905500856 1:38435152-38435174 GCACAGGGCCTGGCACATCGCGG - Intergenic
905770185 1:40632750-40632772 CAACAGCGCCTGGCACCTAGAGG - Intronic
905838744 1:41154875-41154897 TCATATTGCCTGGCACATAGAGG - Intronic
905877751 1:41443799-41443821 CCACAGTGCTGAGCACATAGTGG - Intergenic
906233130 1:44182768-44182790 CCACCGCGCCTGGCCCAGAGAGG + Intergenic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906883246 1:49616110-49616132 ACACAATGCCTGGCACATGGTGG - Intronic
907174236 1:52502983-52503005 GCACGGTGCCAGGTCCATAGTGG - Intronic
907321827 1:53607501-53607523 GCACTGTACCTGGCACATAATGG - Intronic
907372363 1:54011677-54011699 CCCCAGTGCCTAGCACAGAGGGG - Intronic
907376638 1:54049407-54049429 ATACAGTGCCTGGCACATTGTGG - Intronic
907395210 1:54184982-54185004 ACATGGTGCCTGGCACAGAGTGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907486999 1:54785241-54785263 GCACAGTGCCTTGGACATAGGGG - Intronic
907491360 1:54810859-54810881 CAACGGTGTCTGGCACAGAGTGG - Intronic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
907898211 1:58713173-58713195 GAACAGTGTCTGGCACATAGTGG - Intergenic
907925950 1:58955347-58955369 GAACAGTGCCTGCCACATAGTGG + Intergenic
908329804 1:63060044-63060066 TTCTGGTGCCTGGCACATAGTGG - Intergenic
908389923 1:63675196-63675218 GCACTGTGCCTGGAGCATAGTGG + Intergenic
908406801 1:63822238-63822260 TAACAGTGTCTGGCACATAGTGG + Intronic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
908472520 1:64457963-64457985 CCGCAGTACCTGGCATATAGTGG + Intergenic
908530087 1:65026065-65026087 TAAAAGTGCCTGGCACATAGAGG + Intergenic
908634269 1:66145153-66145175 CCATGGTGTCTGTCATATAGGGG - Intronic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
909062306 1:70893176-70893198 ACAAGGTGCCTGGCACATAATGG - Intronic
909554884 1:76942513-76942535 ACACAGTGTCTGGCACATACAGG - Intronic
909682042 1:78302754-78302776 CCACTGTGCCTAACACATAGTGG - Intergenic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910259029 1:85278114-85278136 GAACAGTGTCTGGCACATAGTGG - Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911056674 1:93714410-93714432 GAACACTGCCTGGCACATAGTGG + Intronic
911211074 1:95138274-95138296 GCACAGTGCCTGGCTCATGGTGG + Intronic
911282824 1:95952505-95952527 CCACTGTGCCTGGCCCATTCTGG + Intergenic
911616691 1:100020619-100020641 CCACAGTGCCTAGCATATATAGG - Intronic
911692631 1:100851663-100851685 TCACAATGCCTGGCACATAGTGG - Intergenic
912558365 1:110532344-110532366 GCACAGTGCCAGGCACACAGGGG - Intergenic
912713471 1:111965896-111965918 GCAGAGTGCCTGGCACACAGAGG - Intronic
912739952 1:112185105-112185127 CAACAGTGCTTGGCATATAGTGG + Intergenic
912797962 1:112704376-112704398 ACAGAGTGCCTGGCACCTAGGGG - Intronic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
913001464 1:114584660-114584682 CCACAGTGCATGGCACATGGTGG + Exonic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
913329715 1:117657106-117657128 ACACGATGCCTGTCACATGGCGG - Intergenic
913696221 1:121328456-121328478 ACATGATACCTGGCACATAGAGG - Intronic
914025145 1:143905825-143905847 CCACGGTGCCGGGCCGGTAGCGG + Exonic
914141343 1:144951602-144951624 ACACGATACCTGGCACATAGAGG + Intronic
914663582 1:149813540-149813562 CCACGGTGCCGGGCCGGTAGCGG + Exonic
914672352 1:149880804-149880826 CCACTGTGCCTGACCAATAGTGG - Intronic
914898810 1:151700381-151700403 CTACAGTGTCTGGCACATAACGG - Intergenic
915274294 1:154777318-154777340 AGACGTTGCCTGGCACAGAGTGG + Intronic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
915625852 1:157113653-157113675 TCTCAGTGCCTGGCACATAATGG + Intergenic
916040556 1:160957609-160957631 GCACAATGCCTGGCACACAGTGG + Intergenic
916100797 1:161391531-161391553 CCACTGTGCCTGGCCCGAAGTGG + Intergenic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
916715994 1:167447025-167447047 ACAAAGTGCCTGGCACACAGTGG + Intronic
916859987 1:168793213-168793235 CCACTGTGCCTTGCACATGTAGG - Intergenic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917253445 1:173088351-173088373 GCACAGTACCTTGCACATAGTGG - Intergenic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917977084 1:180246885-180246907 GCACGGTGCCTGGCACACAAGGG - Intronic
918116930 1:181505903-181505925 CCACTGTACTTGGCACACAGTGG - Intronic
918118463 1:181517021-181517043 ACACAGTACCTGGCACACAGTGG - Intronic
918557202 1:185817007-185817029 GAACAGTGCCTGGCACATAGTGG + Intronic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
919102440 1:193111095-193111117 CTACAGTGCCTGGCATATGGTGG - Intergenic
919121307 1:193343798-193343820 CCATGCTGCATGACACATAGTGG + Intergenic
919353396 1:196489275-196489297 CCCCAGAGCCTGGCACAAAGTGG - Intronic
919462596 1:197895681-197895703 TCATGGTGTCTAGCACATAGTGG - Intergenic
919767827 1:201138662-201138684 GCAGAGCGCCTGGCACATAGTGG - Intronic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919827522 1:201514007-201514029 GCCCAGTGCTTGGCACATAGTGG - Intergenic
919905649 1:202076626-202076648 GAATGGTGCCTGGCACAAAGTGG - Intergenic
920067579 1:203279905-203279927 CCATGGTGCCTGGCACACATGGG + Intergenic
920179997 1:204126723-204126745 CAACAGTGCCTGGCACGTAGTGG - Exonic
920186843 1:204164898-204164920 CCACAAGGCCTGGCACCTAGGGG + Intronic
920271280 1:204766189-204766211 GCCCAGTGCCTGGCACTTAGAGG + Intergenic
920332858 1:205223680-205223702 CCACGGCGCCTGGCCCAAACTGG - Intergenic
920354694 1:205362297-205362319 GCATTGTGTCTGGCACATAGTGG - Intergenic
920432625 1:205928443-205928465 GCATGGTGCCTGGCACAGAGTGG + Intronic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
920483544 1:206346821-206346843 ACACAATACCTGGCACATAGAGG - Intronic
920849568 1:209619383-209619405 GCACAGTGCCTGGCACTTGGAGG + Intronic
921034927 1:211367843-211367865 GGACAGTGCCTGGCACAGAGAGG - Intronic
921070809 1:211656147-211656169 AAACAGTGCCTGGCTCATAGTGG + Intergenic
921075874 1:211699612-211699634 GCACAGTGCCTGGCACATCAAGG - Intergenic
921207394 1:212859947-212859969 GCACAGTTCCTGGCACATAAGGG + Intronic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
921348946 1:214215911-214215933 CCACATTTCTTGGCACATAGTGG + Intergenic
921455674 1:215368180-215368202 GCACAGTACCTGACACATAGTGG - Intergenic
921527639 1:216237703-216237725 TCACAGAGCCTGGCACACAGCGG + Intronic
921848543 1:219909257-219909279 GAACAGTACCTGGCACATAGTGG - Intronic
922375932 1:224965802-224965824 CCATGGTGCCTGGCAGGTAGTGG + Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922565006 1:226596120-226596142 CCACGTTGCTTGGCACCTTGTGG + Intronic
922569361 1:226624710-226624732 GCCCGGGGCCTGGTACATAGTGG - Intergenic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
923696071 1:236253807-236253829 ACCCAGTGCCTGACACATAGTGG - Intronic
924048824 1:240060117-240060139 ACGCAGTGCCTGGCGCATAGTGG - Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
924698880 1:246429711-246429733 ACACTGTGCCTGGCATATGGTGG - Intronic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924761049 1:246986353-246986375 CCACCGTGCCTGGCACCAAAAGG + Exonic
1062870185 10:894895-894917 CCACCGTGCCTGGCTTATTGTGG - Intronic
1063394968 10:5678107-5678129 CCACGGGGCCTGGCCCTTAGAGG - Intergenic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064978835 10:21146056-21146078 TCATGGTGCCTGGCTCATAGCGG - Intronic
1065537912 10:26732668-26732690 GAACAGTGCCTAGCACATAGTGG + Intronic
1065953645 10:30674508-30674530 CCACTGTGCCTGGCCCATTTTGG + Intergenic
1066245286 10:33577335-33577357 TCACCGTGCCTGGCCCAAAGTGG - Intergenic
1066379840 10:34891913-34891935 CTACAGTGCCTGGCACATTGTGG - Intergenic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1067148904 10:43713448-43713470 CTCCAGTGCCTGGCACACAGAGG + Intergenic
1067410585 10:46060784-46060806 CCACAGTGCCTGGGCCAAAGTGG + Intergenic
1067750332 10:48967500-48967522 CTTCGGTGCCCAGCACATAGTGG + Intronic
1069908300 10:71745117-71745139 CTCCAGTGCCTGGCACATAGTGG - Intronic
1070275672 10:75004272-75004294 GCACAGTGCCTAGCACATAGAGG + Intronic
1070565948 10:77603975-77603997 CAACGGTGCCTGACACATAAAGG + Intronic
1070573055 10:77656059-77656081 GCAGAGTACCTGGCACATAGTGG - Intergenic
1070742144 10:78910232-78910254 CATCCGTGCCTGGCACCTAGTGG + Intergenic
1071439424 10:85677301-85677323 CCAGCATGCCTGGCACACAGTGG + Intronic
1071719192 10:88125900-88125922 GCACAGTGCCTGGCATATGGAGG - Intergenic
1071792983 10:88975687-88975709 AAACAGTGCCTGGCACATATTGG + Intronic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072415180 10:95241343-95241365 CCACTGTGCCTGGCAACAAGGGG + Intronic
1072449063 10:95524814-95524836 GCATAGTGCCTGGCACATAATGG + Intronic
1072548876 10:96461794-96461816 GGATGGTGCCTGGCACAGAGAGG - Intronic
1072633326 10:97161983-97162005 CCCAGGTGCCTGGCATAGAGTGG + Intronic
1072650871 10:97294284-97294306 CCACAGTTTCTGGCACATAATGG + Intergenic
1072820552 10:98552381-98552403 GAACTGTGCCTGGCACATATAGG + Intronic
1072905498 10:99449511-99449533 GAACAGTGCCTGGCACATAGTGG + Intergenic
1073018436 10:100420778-100420800 GCAGGGTGTGTGGCACATAGTGG + Intergenic
1073103806 10:101021049-101021071 GCACAGTGGCCGGCACATAGTGG + Intronic
1073189035 10:101637094-101637116 CCACCGTGCCCGGCCCATGGTGG - Intronic
1073189085 10:101637418-101637440 CCACTATGCCTGGCTCATGGTGG - Intronic
1073237158 10:102026944-102026966 CCACAGTACCTGGCATATAGGGG + Intronic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074256775 10:111810934-111810956 CCACAATGCCTGGCACTTAGTGG + Intergenic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074480895 10:113819689-113819711 GAACAGTGCCTGGCACATAGTGG - Intergenic
1074912240 10:117921820-117921842 CCAGGGTGCCTGGAGCACAGTGG - Intergenic
1075015586 10:118908082-118908104 GCACAGTACCTGGCTCATAGTGG - Intergenic
1075633545 10:124015678-124015700 GCAGGGTGCCTGGCACATGGTGG - Intronic
1075874803 10:125797324-125797346 CCATGGTACCTGCCTCATAGAGG - Intronic
1075933125 10:126316258-126316280 GCACAGGGCCTGGCACATAAAGG + Intronic
1075960762 10:126566316-126566338 GCACAGTGCCTGACACATAGGGG - Intronic
1077533926 11:3110055-3110077 GCATGGGACCTGGCACATAGTGG + Intronic
1077664866 11:4098674-4098696 CAACGGTTCCTAGCACAAAGAGG - Intronic
1077716002 11:4581365-4581387 TTAGGATGCCTGGCACATAGTGG + Intergenic
1078018680 11:7637392-7637414 CCACAGGGCCTAGCACACAGCGG - Intronic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078529040 11:12122250-12122272 TCATGGTGCCTGGCACATAGTGG + Intronic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1078773650 11:14374369-14374391 GCTCAGTGCCTGGCACATAGAGG + Intergenic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079005019 11:16785448-16785470 GCACAGGGCCTGGCACACAGTGG - Intronic
1079019735 11:16899682-16899704 GCACAGTGCCTGAGACATAGCGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1079639629 11:22788995-22789017 CCACAATTCCTGGCACATAGAGG - Intronic
1079853477 11:25568907-25568929 CTACAAAGCCTGGCACATAGTGG + Intergenic
1080043335 11:27782708-27782730 AAACAGTGCCTGGCTCATAGTGG - Intergenic
1080127606 11:28755480-28755502 GCACAGTGCCTGGTACACAGAGG + Intergenic
1080445031 11:32330916-32330938 GCACAATGCCTGGCACACAGTGG - Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1080648715 11:34206070-34206092 CCACTGTGCCTGGCCCTTATAGG - Intronic
1080947970 11:36996278-36996300 GCATGATGCCTAGCACATAGTGG + Intergenic
1081432095 11:42987485-42987507 CCCAGGTGCCTGGCACAAGGTGG + Intergenic
1081569739 11:44282304-44282326 CCACTGTGATAGGCACATAGTGG - Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081662753 11:44898070-44898092 GAGCAGTGCCTGGCACATAGTGG - Intronic
1081738352 11:45420928-45420950 CAACAGTGGCTGGCACAAAGAGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081846671 11:46245621-46245643 GCCCAGTGCCTGGCACATGGTGG + Intergenic
1081866727 11:46364346-46364368 GCACAGTGCCTGACACATAGGGG + Intronic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1082847700 11:57739900-57739922 GCACGGTGATTGGCACATAATGG + Intronic
1083174230 11:60939277-60939299 CCCCAGTGCCTGTCACATAGGGG + Intronic
1083266071 11:61547397-61547419 CCCCGGGGCCGGGCACACAGTGG + Intronic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083444344 11:62697498-62697520 CCACTGTGCCGGGCCCAAAGCGG - Intronic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083673396 11:64312582-64312604 CAACGAGGCCTGGCACATGGTGG - Intronic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1083937211 11:65876093-65876115 CCACCGTGCCTGGCCTATTGTGG - Intergenic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084053295 11:66615212-66615234 CCACCGGGCCTGGCCCATACTGG + Intergenic
1084097282 11:66920001-66920023 CCATGGTGCCTAGCACAAAACGG + Intronic
1084296198 11:68214360-68214382 GCACGGCGCGGGGCACATAGTGG - Intergenic
1084299224 11:68235449-68235471 CCACCGTGCCTGGCCCACAGCGG - Intergenic
1084433083 11:69122347-69122369 ACCCAGTGCCTGGCACACAGCGG + Intergenic
1084619028 11:70255935-70255957 GCCCGGTGCCTGGCATAAAGTGG + Intergenic
1085026260 11:73238341-73238363 GCAGGGTCCCTGGCACACAGGGG + Intergenic
1085045457 11:73350276-73350298 GAACAGTGCCTGGCACATAGTGG - Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085273835 11:75285706-75285728 ACAAGGGGCCTGGCACAAAGGGG + Intronic
1085415697 11:76317945-76317967 GCACGGTGCCTGGCCCATTGCGG + Intergenic
1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG + Intergenic
1085524970 11:77158856-77158878 CCTCCCAGCCTGGCACATAGTGG - Intronic
1085702955 11:78761524-78761546 CCACTGTGCCTGGCCCAGGGTGG + Intronic
1085775167 11:79358842-79358864 GCTCCGTGCCTGGCCCATAGTGG - Intronic
1085835630 11:79953330-79953352 CCATAGTGCCTGACACATAGAGG + Intergenic
1085957204 11:81413927-81413949 TTACAGTGCCTGGCACAGAGAGG - Intergenic
1086239175 11:84668905-84668927 GAACAGTGCCTGGCACATTGTGG - Intronic
1086492425 11:87368976-87368998 GCAAGGTGCCTGGCACATAGTGG + Intergenic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1087084407 11:94202035-94202057 GCACAGTCCCTGGCACACAGTGG - Intergenic
1087148704 11:94838264-94838286 GCATAGTGCCTGGCACTTAGAGG + Intronic
1087467775 11:98530882-98530904 CCACTGTACCTGGCCCATATTGG + Intergenic
1087703920 11:101467410-101467432 CAACAGGGCCTGGCACATAGTGG - Intronic
1087923798 11:103896513-103896535 TAATTGTGCCTGGCACATAGAGG + Intergenic
1088079899 11:105899319-105899341 CAACAGTGCTTGACACATAGTGG - Intronic
1088214122 11:107489290-107489312 GCACAATGCCTGGCACACAGTGG + Intergenic
1088288313 11:108209600-108209622 CCACCGTGCCTGGCCCAATGTGG - Intronic
1088684376 11:112272619-112272641 CCACAATGCCTGCCACATATTGG - Intergenic
1088851182 11:113704814-113704836 GCACAGAGCCTGGCACAAAGTGG + Intronic
1089252671 11:117176339-117176361 CAACAGTACCTGGCACATCGTGG + Intronic
1089321719 11:117630993-117631015 GAATGTTGCCTGGCACATAGTGG + Intronic
1089365091 11:117916566-117916588 CCACTGTGCTGGGCTCATAGTGG + Intronic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089598434 11:119597853-119597875 CCACGGTGCCAGCCTCACAGGGG - Intergenic
1089659943 11:119979207-119979229 ACCCAATGCCTGGCACATAGTGG - Intergenic
1089812523 11:121143625-121143647 GCACAGTGCCTGGCACTCAGTGG + Intronic
1089843668 11:121441234-121441256 CCACAGCGCCTGGCCAATAGAGG - Intergenic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090353359 11:126122143-126122165 CCACCGTGCCTGACCCACAGAGG + Intergenic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1090501430 11:127265183-127265205 CCAGGGTGCCAGGCACCTGGTGG - Intergenic
1090598371 11:128343503-128343525 ACACGATGCTTGGCACAGAGTGG - Intergenic
1090622696 11:128575505-128575527 GGACCGTGTCTGGCACATAGTGG - Intronic
1090911356 11:131122316-131122338 GCACAGTGCCTGGTCCATAGTGG - Intergenic
1091054758 11:132407449-132407471 CGACAGTGCCTGGCACAGGGTGG - Intergenic
1091386539 12:99542-99564 GTAGGGTGCCTGGCACACAGTGG + Intronic
1091655410 12:2342522-2342544 GCACAGTGCCTGGCACACTGAGG + Intronic
1091717964 12:2793604-2793626 GCACAGTGCCGGGCACATAACGG + Intergenic
1091878530 12:3957709-3957731 GCACAATCCCTGGCACATAGTGG + Intergenic
1092027698 12:5256825-5256847 CCCCTGTGTCTGGCACATGGTGG - Intergenic
1092265319 12:6976435-6976457 CCACCGTGCCCGGCCCAAAGGGG - Exonic
1092393279 12:8100696-8100718 CCATTGTGCCTGGCCCAAAGAGG + Intergenic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1093551421 12:20416502-20416524 CTACTATTCCTGGCACATAGCGG - Intronic
1094072291 12:26431104-26431126 TAACAGTGCCTAGCACATAGCGG + Intronic
1094365375 12:29674311-29674333 CCACAGTGCCCAGCACATAAAGG + Intronic
1094674085 12:32601202-32601224 GCACTGTGCTAGGCACATAGTGG - Intronic
1095127094 12:38492678-38492700 TAACAGTGCCTGGCACATGGTGG - Intergenic
1095503301 12:42864787-42864809 CCACTGCGCCTGGCCCAGAGGGG + Intergenic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1095941568 12:47730661-47730683 TCACAGTGTCTGGCACACAGTGG - Intergenic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1095990196 12:48029291-48029313 ACAGAGTGCCAGGCACATAGAGG + Intergenic
1096267020 12:50131807-50131829 CCACTGTGCCTGGCTCATGGTGG - Intronic
1096365240 12:51023765-51023787 GCACGGTGGCTGGCACCCAGGGG + Intronic
1096523995 12:52199935-52199957 GCACGGTGCCTGGCATATAGTGG + Intergenic
1096545785 12:52339309-52339331 TAAAGGTGCCTGGCATATAGTGG + Intergenic
1096619787 12:52857076-52857098 CCATGGTGCCTGGCACTTGGTGG - Intergenic
1097400479 12:59122479-59122501 GCACAGTGCCTTGCACATAATGG + Intergenic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1097659303 12:62411393-62411415 GAATAGTGCCTGGCACATAGTGG - Intronic
1097809774 12:64005907-64005929 CCACTGTGCCTATCACATAAAGG - Intronic
1097865262 12:64554842-64554864 TCTCAGTCCCTGGCACATAGTGG + Intergenic
1097934882 12:65236252-65236274 CCACTGTGCCTGGCTCGTAGAGG - Intronic
1098092883 12:66922867-66922889 CCTCTGAGCCTGGCACACAGTGG + Intergenic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098286708 12:68914371-68914393 GCACAGTGCATGGCACATAAAGG + Intronic
1098550047 12:71753292-71753314 TCACAGTGCCTGGCATATGGTGG + Intergenic
1098646276 12:72905375-72905397 GAAGAGTGCCTGGCACATAGGGG + Intergenic
1098872599 12:75833825-75833847 GCATGGTGCCTGGCACAGAGTGG - Intergenic
1099176748 12:79430882-79430904 ACACAGAGCCTGGCACATGGTGG - Intronic
1099334068 12:81330883-81330905 ACACAGTGCCTGGCTCATAAAGG + Intronic
1099346175 12:81502638-81502660 GCACAGTTCCTAGCACATAGTGG - Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1100004605 12:89879562-89879584 ACACAGTACCTGGCAGATAGGGG + Intergenic
1100100998 12:91105703-91105725 CCACAGTGCCCAGTACATAGTGG - Intronic
1100289195 12:93197997-93198019 GCAAGGTGCCTGGCACAAACTGG - Intergenic
1100406764 12:94278708-94278730 CCACTGTGCCCGGCCCAAAGAGG - Intronic
1100573317 12:95863560-95863582 TCACAGTGCCAGGCACATAATGG - Intronic
1100762528 12:97824923-97824945 CCCCAGTGCATGGCCCATAGTGG - Intergenic
1100872287 12:98922784-98922806 CCACTGTGCCTGGCTCTTAAGGG + Intronic
1101010089 12:100440503-100440525 AAAAGGTGCCTGACACATAGTGG + Intergenic
1101098947 12:101372431-101372453 ACGCAGTGCTTGGCACATAGAGG + Intronic
1101106500 12:101445577-101445599 CTAGAGTGCCTGACACATAGTGG - Intergenic
1101160395 12:101968108-101968130 GCATGGTGCCTGGAAAATAGTGG + Intronic
1101440814 12:104703161-104703183 GCACAGTGCCTGGGCCATAGTGG + Intronic
1101583054 12:106060992-106061014 ACGTGGTGCCTGGCACATAGTGG - Intergenic
1101627685 12:106461633-106461655 GCATAGTACCTGGCACATAGTGG + Intronic
1101711766 12:107274159-107274181 CCACAGTGCCAAGCACAAAGAGG + Intergenic
1101740604 12:107497081-107497103 GAACAGTGCCTGGCACATAGTGG + Intronic
1101757494 12:107632491-107632513 CCAGAGTGCCAGACACATAGTGG - Intronic
1101797930 12:107993098-107993120 GCCTGGTGCCTGGCACTTAGAGG + Intergenic
1101857789 12:108458281-108458303 CAACAGTGCCTGGCCCAGAGTGG + Intergenic
1101888785 12:108692568-108692590 GCACGGCGCCTGGCACTTAAAGG + Intronic
1101981092 12:109407372-109407394 GCACAGTGCCTGGCACACATGGG + Intronic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1102105320 12:110316577-110316599 CCACTATACCTGGCACACAGTGG - Intronic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1102285884 12:111656166-111656188 CTCCAGTGCCTGGCACATGGTGG + Intronic
1102289042 12:111684211-111684233 CCACAGTGCCGAGCACACAGAGG + Intronic
1102351084 12:112192741-112192763 CCACGGTGCCTTGTACAGAGAGG + Exonic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1103206663 12:119134943-119134965 TGACAGTGCCTGACACATAGTGG - Intronic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103469476 12:121168554-121168576 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103707004 12:122880828-122880850 CCCCCGAGCCTGGCACACAGAGG - Intronic
1104444968 12:128825163-128825185 GGACAGCGCCTGGCACATAGTGG + Intergenic
1104553640 12:129780218-129780240 CCACAGTGCCCAGCACACAGCGG - Intronic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1105069802 12:133227556-133227578 TCCTGGTGCCTGGCACACAGTGG + Intronic
1105283409 13:18983521-18983543 GCACAGTGCCTGACACAGAGTGG - Intergenic
1105553211 13:21418085-21418107 CCACACTATCTGGCACATAGTGG - Intronic
1106229026 13:27807591-27807613 CCCCAGGGCCTGGCACACAGTGG + Intergenic
1106302476 13:28481599-28481621 GTACAGTGCCTGGCACATAATGG - Intronic
1106548916 13:30754744-30754766 GCATAGTGCCTGGCACATAGGGG - Intronic
1106647114 13:31648023-31648045 TCACAGTGCCTGGAACATAGTGG + Intergenic
1106798752 13:33234018-33234040 CCACAGTGCCTGGGACAGTGAGG - Intronic
1107114138 13:36728205-36728227 ACACAGTGCCTGGTACAGAGTGG + Intergenic
1107169444 13:37322584-37322606 CCACAGAGACTGGCACAGAGGGG - Intergenic
1107179660 13:37444104-37444126 CCACTGTGCCTGGTCCATAGTGG + Intergenic
1107279203 13:38714155-38714177 GCACCGTGCCATGCACATAGTGG + Intronic
1107445743 13:40469148-40469170 GCACAGTGCCTGCCACATATAGG - Intergenic
1107831989 13:44382778-44382800 GCACAGTGCCAGGCACAGAGGGG - Intronic
1107855232 13:44608553-44608575 CCATATTGTCTGGCACATAGAGG + Intergenic
1107928986 13:45290857-45290879 CCCCTGTGCCTGGCACACAGTGG - Intergenic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108681866 13:52787471-52787493 GCACAGAGCCTGGCACACAGTGG + Intergenic
1109299509 13:60576478-60576500 CCACGGTGACTGGGCCACAGTGG + Intergenic
1110155519 13:72312166-72312188 GCATAGTGCCTGGCATATAGTGG - Intergenic
1110559359 13:76893990-76894012 CCACAATGTCTGGCACATAACGG + Intergenic
1110702292 13:78562801-78562823 ACACAGTGCCTGGCACATGGTGG + Intergenic
1111491487 13:88981854-88981876 CCACGGAGCCTGGGAGATAGAGG + Intergenic
1111836745 13:93397632-93397654 GCACAGTACCTGGCACATAAAGG - Intronic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112136529 13:96584534-96584556 GGACCATGCCTGGCACATAGAGG + Intronic
1112383461 13:98915834-98915856 CTACAGTGACTTGCACATAGTGG + Intronic
1112962016 13:105138606-105138628 CCACTGCGCCTGGCCCATAAAGG - Intergenic
1113369751 13:109712996-109713018 CCACCGTGCCTGGCCCATCTGGG - Intergenic
1113436374 13:110294856-110294878 GAATAGTGCCTGGCACATAGTGG + Intronic
1113802925 13:113095845-113095867 GAACTGTGCCTGGCACACAGCGG - Intronic
1113818358 13:113191967-113191989 CCACTGTGCTTGGCTCATCGAGG - Intronic
1115509013 14:34121433-34121455 GCACTGTGCCTTACACATAGAGG - Intronic
1115750180 14:36481619-36481641 GCACAATGCCTGGCACACAGTGG + Intronic
1116683031 14:48000202-48000224 ACATGGTGCATGGCACATAGGGG - Intergenic
1117018075 14:51539442-51539464 ACATAGTGCCTGACACATAGTGG + Intronic
1117272463 14:54158882-54158904 CCACAGTGACTGGCATAGAGAGG - Intergenic
1117553673 14:56862397-56862419 GCCCTGTGCCTGGCACACAGTGG - Intergenic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1117966564 14:61212693-61212715 GCACAGTGCCTGCCAAATAGTGG - Intronic
1117968092 14:61226202-61226224 ACACAGTGCCTGGCTCAGAGTGG - Intronic
1118166834 14:63344952-63344974 CGCCAGTGCCTGGCACATAGCGG + Intergenic
1118208328 14:63744022-63744044 CTACGGTGCCTGGCCCAGAGGGG + Intergenic
1118633782 14:67729177-67729199 CCCCGGTGCCTGGGACAAAGAGG - Exonic
1118818322 14:69328207-69328229 AGACAGTGACTGGCACATAGAGG + Intronic
1118818403 14:69328616-69328638 CCTCGGTGCCAGGAACGTAGTGG - Intronic
1118901845 14:69992837-69992859 ACACAGTGCCAGGCACAGAGTGG - Intronic
1119032577 14:71204148-71204170 ACACAGTGCGTGGCACATGGTGG - Intergenic
1119616039 14:76099695-76099717 GCACAGCGCCTGGCACATGGTGG - Intergenic
1119634116 14:76260299-76260321 ACACAGTGCATGGCACAGAGTGG - Intergenic
1119652611 14:76394362-76394384 GCACAGCGCCTGGCTCATAGTGG - Intronic
1120758538 14:88266133-88266155 GCACAGTACCTGGCACATGGTGG + Intronic
1120927264 14:89810168-89810190 GCACAGTGTCTGGCACACAGTGG + Intronic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121382556 14:93486367-93486389 CCACTGTGCCTGGCCCCAAGAGG - Intronic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1121618924 14:95332658-95332680 GCACAGTGGCTGGTACATAGTGG - Intergenic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1122793520 14:104194391-104194413 CCCCGGTGCCCAGCACATGGTGG + Intergenic
1122977193 14:105175685-105175707 CCACCGTGCCTGGCCCAGCGTGG + Intronic
1123415732 15:20093759-20093781 CCACAGGGACTGGCACATAATGG + Intergenic
1123525071 15:21100873-21100895 CCACAGGGACTGGCACATAATGG + Intergenic
1124015987 15:25876347-25876369 CTACAGAGCATGGCACATAGTGG - Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1124794141 15:32760447-32760469 CCACCGTGCCTGGCCCATCCTGG + Intergenic
1124851647 15:33345252-33345274 GCTCCATGCCTGGCACATAGTGG - Intronic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125350454 15:38761717-38761739 GCACAGTGCCTGACACATAGTGG - Intergenic
1125869189 15:43083207-43083229 CAATGATGCCTGGCATATAGTGG + Intronic
1125870666 15:43099047-43099069 CCACCGTGCCTGGGCTATAGGGG - Intronic
1125900076 15:43337797-43337819 GCACAGTGCCTGGAACATTGTGG - Intronic
1126229762 15:46311053-46311075 CCACGATGCCTTGCACACAGTGG - Intergenic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1126347727 15:47714879-47714901 CCACAGTGCCTGGCATTTAATGG - Intronic
1126833830 15:52638417-52638439 CCACTGTGCCCGGCCCACAGTGG - Intronic
1126892570 15:53222271-53222293 CAAAAGTGCCTGTCACATAGAGG - Intergenic
1127141689 15:55984446-55984468 ACCTGGTGCCTGGCACAGAGTGG + Intronic
1127261943 15:57332770-57332792 CCACGGGGCCTGGCATATATGGG + Intergenic
1127382278 15:58440490-58440512 CCATGGGGCCTGGTACACAGCGG - Intronic
1127641826 15:60923379-60923401 GCACAGCACCTGGCACATAGTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1127918323 15:63473525-63473547 TCAGAGTGCCTGGCACAAAGTGG - Intergenic
1128268615 15:66289757-66289779 CCACCGCGCCTGGCCCACAGTGG - Intergenic
1128310678 15:66630266-66630288 GCATGGTGCCTGGCACCTAGAGG - Intronic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128426960 15:67551618-67551640 CCACTGTGCCTGGCCCACTGTGG + Intronic
1128989246 15:72245073-72245095 CCACTGTGCCTGGCCCATGGGGG - Intronic
1129098750 15:73238017-73238039 CCTCGGTGACTGTCACACAGTGG + Intronic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129127849 15:73460354-73460376 GCATAGTGTCTGGCACATAGTGG - Intronic
1129238379 15:74237252-74237274 GAACAGTGCCTGGCACATAGTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1129909221 15:79212365-79212387 GCATGATGCCTGGCACATGGTGG + Intergenic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1129995988 15:80006624-80006646 CCACGGCGCCTGGCCCATCCTGG + Intergenic
1130025214 15:80265155-80265177 TGACAGTGCCTGACACATAGAGG + Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130673543 15:85933178-85933200 GCACAGCGCCTGGCACAAAGTGG + Intergenic
1130986027 15:88845364-88845386 GCAAGGTGCCTGGCACACAGTGG + Intronic
1131123232 15:89836256-89836278 TCACAGTACCTGGCACATGGTGG + Intronic
1131373856 15:91907491-91907513 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1131445976 15:92498363-92498385 TCACAGGGCCTGGTACATAGTGG - Intronic
1131951914 15:97690364-97690386 CCACAGTACCTAGCACACAGTGG + Intergenic
1131967646 15:97861071-97861093 GCACAGTGCAGGGCACATAGAGG + Intergenic
1132177400 15:99726429-99726451 CCACTGTGCCTGGCCCCAAGTGG + Intronic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1132573279 16:653327-653349 CCACAGGGCCTGGCACAAGGGGG - Exonic
1133064392 16:3195781-3195803 CCCCAGTGCCTGGCACACAGAGG + Intergenic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133509534 16:6444265-6444287 GCACAATGCCTGGCACATGGTGG + Intronic
1133546147 16:6809348-6809370 GCACAGTGGCTGGCACTTAGAGG - Intronic
1133602304 16:7351373-7351395 CCATCGTGCCTTGCACGTAGTGG - Intronic
1133608336 16:7410204-7410226 GCACTGTGCCTGGACCATAGCGG - Intronic
1133686117 16:8166945-8166967 GCACAATGCCTGGCACATGGAGG + Intergenic
1133689858 16:8202951-8202973 CTACTGTGCCTTTCACATAGTGG + Intergenic
1133741638 16:8656232-8656254 CCACTGTTCCTGGCGCAGAGAGG + Intergenic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1134017373 16:10898567-10898589 CCTCTGGGCCTGGCACACAGTGG - Intronic
1134018995 16:10908379-10908401 CCCCAGTGACTGGCACATGGCGG - Intronic
1134110035 16:11509541-11509563 CCTCTGTGCCAGGCACAGAGTGG - Intronic
1134189902 16:12112962-12112984 CCACGCTGCCTGGGACAGCGTGG + Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134396654 16:13871332-13871354 CCACTGTGCCCGGCCCAGAGTGG - Intergenic
1134441036 16:14299852-14299874 GCTCTGTGCCTGGCACACAGAGG + Intergenic
1134444619 16:14321457-14321479 CCACTGCGCCTGGCCCAGAGTGG + Intergenic
1134586486 16:15416046-15416068 GGACAGTGCCTGGCACATAGTGG + Intronic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134617827 16:15665217-15665239 TCACACTGCCTGGCACATATAGG - Intronic
1134690681 16:16189254-16189276 CCCCGATGCCTGGAACCTAGAGG - Intronic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1134846498 16:17445315-17445337 GCCCAGTGCCTGGCACGTAGAGG + Intronic
1135141320 16:19924506-19924528 CCACTATGCCTGGCTCATAATGG + Intergenic
1135234810 16:20745296-20745318 CCACCGTGCCTGGCCCCAAGTGG - Intronic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135656247 16:24252903-24252925 CCAAGGTGCTGAGCACATAGGGG + Intergenic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1135956573 16:26961040-26961062 CTACCATGCCTGGCACAGAGCGG - Intergenic
1136028330 16:27484504-27484526 CCTCAGTGTCTGGCACATGGTGG - Intronic
1136048071 16:27631249-27631271 CCACTGTGCCTGGCCCATGGGGG - Intronic
1136048156 16:27631764-27631786 GAACTGTGCCTGGCACATAGTGG - Intronic
1136272950 16:29159221-29159243 CCACTGTGCACGGTACATAGCGG - Intergenic
1136272986 16:29159335-29159357 CCACCATGCATGGTACATAGCGG - Intergenic
1136291406 16:29274503-29274525 CCACTGTGCCTGGCAGCTGGGGG - Intergenic
1136294107 16:29291983-29292005 CCAGGAAGCCTGGCACTTAGGGG - Intergenic
1136352341 16:29719146-29719168 CCACGTTGCCAGGCACATGTGGG - Intergenic
1136380875 16:29894890-29894912 CCACTGTGCCCGGCCTATAGAGG - Intronic
1136385814 16:29925538-29925560 CCACAGCGCCTGGCAGTTAGGGG + Intronic
1136450537 16:30352124-30352146 GCCCTGTGCCAGGCACATAGTGG + Exonic
1136571261 16:31098349-31098371 CCACCATGCCTGGCCCACAGGGG + Intergenic
1137377026 16:47960697-47960719 CTTTGGTGCCTGGCACATACAGG - Intergenic
1137411253 16:48230210-48230232 GCACAGTGCCTGGCACATGTAGG + Intronic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1137693415 16:50445705-50445727 CCAAGGTGCCAGGCACAGAGGGG + Intergenic
1137730379 16:50685273-50685295 GCACAGTGCCTGCCACATAGTGG + Intergenic
1138046677 16:53732336-53732358 CCACCATGCCTGGCCCATTGTGG + Intronic
1138085153 16:54126811-54126833 CCAGGGTCCCTGTCACATATAGG - Intergenic
1138092106 16:54183160-54183182 CCACCGTGCCTGGCTCATGTTGG + Intergenic
1138131167 16:54481320-54481342 CTACAGTGCCTACCACATAGCGG - Intergenic
1138232184 16:55346417-55346439 CCATGGTGCCTGGCACAGTGTGG - Intergenic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1138431717 16:56973125-56973147 CCACGGTGGTTGAGACATAGTGG + Intronic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1138585808 16:57969931-57969953 CCAGGGTCCCTGGCAGAAAGGGG - Intronic
1138674317 16:58640032-58640054 CCACCGTGCCTGGCCCGTAGAGG + Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139527633 16:67526604-67526626 TCAAGGTGCCTGGCTCATAGTGG - Intronic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1139791113 16:69436171-69436193 GCATGGTGCCTGGAACATAATGG - Intronic
1139814238 16:69654703-69654725 GAACAGTGCCTGGCACATGGAGG - Intronic
1139829886 16:69788809-69788831 GAACAGTGCCTGACACATAGTGG + Intronic
1139842402 16:69892101-69892123 GCACCTAGCCTGGCACATAGTGG + Intronic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1139951907 16:70676616-70676638 GCACAGCACCTGGCACATAGTGG + Intronic
1140628726 16:76826434-76826456 ACACAGAGCCTGGTACATAGTGG - Intergenic
1140723246 16:77789290-77789312 CAACGGCGGCTGGCACACAGTGG - Intronic
1140724087 16:77796633-77796655 TGACGGTGCCTTGCACATGGTGG + Intronic
1140948893 16:79796985-79797007 GCACAATGCCTGGCACATGGTGG - Intergenic
1140949652 16:79804569-79804591 ACACAGTGCCTGGCCCATGGTGG - Intergenic
1141111799 16:81276159-81276181 ACACAGAGCCTGGCACCTAGCGG - Intronic
1141326115 16:83060990-83061012 GCAGAGGGCCTGGCACATAGTGG + Intronic
1141476338 16:84276028-84276050 CCCCGGTGCCTGGCACACCGTGG - Intergenic
1141547133 16:84777688-84777710 CCAAGGTCCCTGGCCCAGAGAGG + Intronic
1141792631 16:86246919-86246941 CAACGGTGCTTGGCACATGTAGG - Intergenic
1142076540 16:88121147-88121169 CCACAATGCATGGTACATAGCGG - Intergenic
1142097280 16:88248422-88248444 CCACTGTGCCTGGCAGTTGGGGG - Intergenic
1142100010 16:88266029-88266051 CCAGGAAGCCTGGCACTTAGGGG - Intergenic
1142164761 16:88580297-88580319 CCCTGGGGCCTGGCACATAGTGG + Intronic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1142637322 17:1266069-1266091 GCACGGTACCTGGCACATTGTGG - Intergenic
1142897713 17:2992681-2992703 GCCCAGTGCCTGGCACACAGCGG + Intronic
1142965817 17:3580360-3580382 ACGCCGGGCCTGGCACATAGTGG - Intronic
1143019463 17:3909353-3909375 GCACAGTGCCTGGCACTCAGTGG + Intronic
1143250488 17:5519733-5519755 CCACTGCGCCTGGCCCATAATGG + Intronic
1143393412 17:6573922-6573944 CCACTGTGCCTGGCGAAGAGCGG + Intergenic
1143551946 17:7635706-7635728 CAACAGTGCCTAGTACATAGCGG - Intergenic
1143742365 17:8964101-8964123 CCACTGTGCCTGGCCCAGTGTGG - Intronic
1143794221 17:9323592-9323614 CCACGGTGCCTTGTACAGAGAGG - Intronic
1143919252 17:10317952-10317974 CCACTGTGCCTGGCCGATTGGGG - Intronic
1143948393 17:10614260-10614282 GAACAGTGCTTGGCACATAGAGG + Intergenic
1144562221 17:16330219-16330241 CCACGGTGGCTGGCCCCAAGAGG - Intronic
1144628457 17:16857538-16857560 ACACTGTGCCTGGCACATGGTGG + Intergenic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1145160045 17:20568109-20568131 ACACTGTGCCTGGCACATGGTGG + Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145885534 17:28380162-28380184 GCACAATGCCTGGCACATGGAGG - Intronic
1145889975 17:28407473-28407495 GCACAGTGCCTGGCACGTAAGGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146061584 17:29610466-29610488 CCTCAATGCCTGGCACATAAAGG + Intronic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146455182 17:33004239-33004261 GCATAGTGCCTGGCACAGAGTGG + Intergenic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1146659389 17:34654270-34654292 ACACGATGCTGGGCACATAGTGG - Intergenic
1146787236 17:35731373-35731395 ACACTGTGCCGGGCACACAGTGG + Intronic
1147243282 17:39104851-39104873 CAACAGTGCCTGGAACATAGTGG + Intronic
1147538718 17:41338134-41338156 CCACAGTCCCAGGCACAAAGTGG - Intergenic
1147687931 17:42298446-42298468 CCACCGAGCCTGGCACATGATGG + Intronic
1147771450 17:42870932-42870954 GAACAGTGCCTGACACATAGTGG + Intergenic
1147877772 17:43633557-43633579 GCACGGTGCCTGCCTCAGAGTGG - Intergenic
1147911219 17:43857383-43857405 CCACCCTGCCTGGCACCTGGCGG - Intronic
1147988069 17:44317917-44317939 GCACGGTGCCTGGCACAGGCAGG + Intronic
1148141327 17:45331026-45331048 CCACCGTGCCTGGCCCACCGTGG + Intergenic
1148678661 17:49460079-49460101 GCACAGTGCCTGGCCCACAGAGG + Intronic
1148800608 17:50222751-50222773 CCACCGTGCCTGGCAAATCTTGG - Intergenic
1148853873 17:50568013-50568035 GCATGGTGCCTGACACATAATGG + Intronic
1148865330 17:50625394-50625416 CGCCAGTGCCTGGCACACAGAGG - Intronic
1148987681 17:51637852-51637874 ACACTGTGCCTAGCACAAAGAGG - Intronic
1149265993 17:54928264-54928286 CCACAGTGTCTGGCATACAGAGG - Intronic
1149399375 17:56279076-56279098 GCACTGTGCATGGCACAGAGAGG - Intronic
1149402510 17:56312709-56312731 GCATAGTGCCTAGCACATAGTGG - Intronic
1149424663 17:56543488-56543510 GAACAGTGCCCGGCACATAGTGG + Intergenic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150288478 17:63967438-63967460 CCACCGTGCCTGGCACTTTAGGG + Intronic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1150815905 17:68391715-68391737 CCAAGGTTCCTGCCACATACCGG - Intronic
1150851285 17:68705959-68705981 GAACAGTGCCTGACACATAGTGG + Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151411276 17:73931662-73931684 GCATGGTGCCAGGCACATATAGG + Intergenic
1151654014 17:75487104-75487126 TCCCAGTGCCTGGCACATGGTGG - Intronic
1151693045 17:75698903-75698925 CCACTGTGCCTGGCCCACAATGG - Intronic
1151713387 17:75819202-75819224 CCACAGGACCTGGCACAAAGCGG - Intronic
1151830511 17:76546541-76546563 CCATTGTGCCTGTCTCATAGTGG - Intronic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1151955747 17:77379326-77379348 CCACGGTGCCCGGTACACAGTGG + Intronic
1152260418 17:79263709-79263731 GAACGGTGCCTGACACACAGGGG + Intronic
1152348278 17:79768257-79768279 GCACAGGGCCTGGCACACAGTGG + Intergenic
1152582791 17:81174660-81174682 CCACCGCGCCTGGCAAACAGAGG - Intergenic
1152987309 18:332540-332562 TCACGGTGCCTGGCATATAGAGG + Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1155820439 18:30368955-30368977 CCACTGTGACTGGAAGATAGAGG - Intergenic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156454959 18:37287646-37287668 CCATGGTGGCTGGAACAAAGTGG - Intronic
1156746459 18:40397645-40397667 CCATTGTGCCTGGCACATTCTGG - Intergenic
1157221968 18:45834710-45834732 CCCCAGTGCCTGGCATAAAGTGG + Intronic
1157243343 18:46032151-46032173 GTACGATGCCTGGCACATGGTGG - Intronic
1157296017 18:46444758-46444780 CCACTGTGCCTGGCTCATTTTGG + Intronic
1157415937 18:47502873-47502895 GTCCAGTGCCTGGCACATAGTGG - Intergenic
1157539682 18:48491548-48491570 GAACAGTGCCTAGCACATAGTGG - Intergenic
1157622299 18:49023648-49023670 CCACGGAGCCTGGCACCTCTGGG + Intergenic
1157713933 18:49869563-49869585 GCATGGGGCCTGGCACAGAGAGG - Intronic
1157802857 18:50635121-50635143 CTATGGTGCTTGGCACAGAGTGG + Intronic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1158028999 18:52939591-52939613 GCAAAGTGCCTGGCACATAATGG - Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158132170 18:54164171-54164193 CCACTGTGTCTGGCAGAAAGAGG + Intronic
1158254817 18:55533897-55533919 CCTCAGTGCCTGGCACAGGGTGG - Intronic
1158334989 18:56406488-56406510 CCACAGTGTCTTGCACATAGTGG - Intergenic
1158466152 18:57691609-57691631 AAAAGGTGCCTGGCACAGAGTGG + Intronic
1158867325 18:61650396-61650418 GCAGGGTGCCTGGCACATAGAGG + Intergenic
1158943017 18:62423652-62423674 GCATAGTGTCTGGCACATAGGGG + Intergenic
1159004295 18:62999015-62999037 CAACAGTGCCAGGCAGATAGCGG + Intergenic
1159141290 18:64398394-64398416 CCACCATGCCAGGCACATTGTGG - Intergenic
1160033247 18:75280397-75280419 ACACTGTGTCTGGCACATAATGG + Intronic
1160114608 18:76065531-76065553 GCACAGTGCCTGGCACAGGGTGG + Intergenic
1160848015 19:1175084-1175106 GCATGGTGACTGGCACATGGGGG + Intergenic
1160883618 19:1334328-1334350 CCACGGTGCCTGGCCCAGGAGGG - Intergenic
1161270828 19:3388328-3388350 CCTCGGAGCCTGGCACACAGAGG - Intronic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161447541 19:4326999-4327021 CCACGTAGCCTGGAACAGAGAGG + Exonic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162306895 19:9880304-9880326 GAACAGTGCCTGGCACATAGTGG - Intronic
1162437911 19:10673908-10673930 CCACTGTGTCCGGCCCATAGTGG + Intronic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162965395 19:14153201-14153223 AAATTGTGCCTGGCACATAGCGG - Intronic
1163058586 19:14741382-14741404 CCACGGTGCCTGGCCCTGAATGG + Intronic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1164412893 19:28020565-28020587 CCAGGCTGCCCGGCAAATAGAGG - Intergenic
1164616055 19:29667382-29667404 GCACAGTGTCTGGCACACAGTGG + Intronic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1165726051 19:38113707-38113729 GCACAGAGCTTGGCACATAGTGG + Intronic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166103718 19:40587188-40587210 CCCCTATGCCTGGCACATGGTGG - Intronic
1166149477 19:40861793-40861815 CCACTGTGCCTGGCCAATGGAGG - Intronic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166658329 19:44628330-44628352 CCTCAGTGCCTGGCACAGAGCGG - Intronic
1166752745 19:45172477-45172499 CCCCTGGGCCTGGCACAGAGTGG - Intronic
1166768031 19:45264117-45264139 CCCCAGGGTCTGGCACATAGCGG - Intronic
1166857331 19:45789218-45789240 GAACGGTGCCTGGCACAGAACGG + Intronic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1167124390 19:47539213-47539235 GCACAGGGCCTGGCACAGAGGGG + Intronic
1167629752 19:50618284-50618306 TCACTGTGCCTGGCCCATAATGG + Intergenic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
1168266792 19:55227793-55227815 CCAGGGTGGCTGGCGCAGAGTGG - Intronic
1168309705 19:55454342-55454364 CCACAGTGGCTGGCACAGAGTGG + Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168394545 19:56037268-56037290 CGACGGTGCCTGGTACACAAAGG - Intronic
1168427102 19:56247542-56247564 CAAGGGCGCCTGGCACACAGAGG + Intronic
924964452 2:62393-62415 CCACCATGCCTGGCCCAGAGTGG - Intergenic
925153414 2:1632882-1632904 GCACTGTGCCTGGCACATGGTGG + Exonic
925184360 2:1836883-1836905 CCAGGGTCCCTGGCACAGAGTGG - Intronic
925916913 2:8613557-8613579 CCACCGTGCCCGGCCCATAGGGG + Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
925990423 2:9250187-9250209 ACACGCTGCCTGACACAAAGTGG + Intronic
926049448 2:9735117-9735139 GCACAGTACCTGGTACATAGTGG - Intergenic
926052738 2:9755172-9755194 CCAGGGAGCCTGGCACATTCCGG - Intergenic
926112071 2:10189850-10189872 GCCCAGAGCCTGGCACATAGTGG + Intronic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
926372315 2:12191978-12192000 GCAAAATGCCTGGCACATAGTGG - Intergenic
926418303 2:12672838-12672860 TCACTTTGCCAGGCACATAGAGG + Intergenic
926426564 2:12743876-12743898 ACCCAGTGCCTGGCACATGGAGG + Intergenic
926438976 2:12867546-12867568 ACATTGTGCCTGACACATAGTGG + Intergenic
926566648 2:14482880-14482902 CCACAGTGCATGGCACACTGTGG - Intergenic
926644835 2:15278612-15278634 GCACAGTGCCTTGTACATAGAGG - Intronic
926684323 2:15687106-15687128 CCACTGTGCCTGGCCCCAAGTGG - Intergenic
926789786 2:16558722-16558744 ACACAGTACCTGGCACATAGTGG - Intronic
927038817 2:19207319-19207341 CCCCATTGCCTGGCACATGGTGG - Intergenic
927128524 2:20036234-20036256 CCATGGTGGCTGGCACACAGAGG - Intronic
927185504 2:20479276-20479298 TCTCTGTGCCTGGCACATGGAGG + Intergenic
927251530 2:20998931-20998953 GCACAGTGCCTTACACATAGAGG + Intergenic
927268975 2:21185172-21185194 CCACTGCGCCTGGCCCACAGGGG + Intergenic
928020416 2:27700199-27700221 GCATAGTGCCTGGCACATTGAGG - Intergenic
928023847 2:27723912-27723934 CAACAGTGTCTGGCACACAGTGG - Intergenic
928151634 2:28835563-28835585 GAACAGTGCCTGGCACATAGTGG + Intronic
928206181 2:29285544-29285566 CCATGGTGCCTGGCCCTCAGTGG + Intronic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
928217326 2:29372536-29372558 ACACAGTGCCTGGAACCTAGTGG - Intronic
928910479 2:36415860-36415882 GGACGGTGCCTGGCATCTAGGGG + Intronic
928945695 2:36770168-36770190 GAACAGTGCCTGACACATAGTGG - Intronic
929077878 2:38093349-38093371 AAACAGTGCCTGGCACTTAGGGG - Intronic
929533259 2:42765137-42765159 CCACTGTGCCTGGGACACAGAGG - Intergenic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
929601313 2:43206457-43206479 ACACCTTGCCTGGCACACAGTGG - Intergenic
929892163 2:45927334-45927356 GCACAGAGCCTGGCACATTGAGG - Intronic
930102686 2:47615495-47615517 CCACTGTGCAGGGCACATGGTGG - Intergenic
930366157 2:50442244-50442266 GCACCATGCCTAGCACATAGTGG + Intronic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
931483330 2:62665808-62665830 CCTCAGGGCCTGGCACAAAGTGG - Intergenic
931633855 2:64324808-64324830 GCACAGTGGCTGGCACACAGCGG - Intergenic
932071646 2:68626519-68626541 ACACAGGACCTGGCACATAGAGG + Intronic
932254855 2:70275809-70275831 CCACCGTGCCTGGCCCATTGGGG - Intronic
932263995 2:70351113-70351135 CCACCGTGCCTGGCTCCTACTGG + Intergenic
932461285 2:71883495-71883517 TCACAATGCCTGGCACATGGTGG - Intergenic
932609710 2:73189830-73189852 CCACGGTGCTTAGCACATATTGG - Intergenic
932611303 2:73202448-73202470 CCACCTTGCCTCGCACAGAGCGG + Exonic
932621551 2:73267520-73267542 GAACAGTGCCTGGCACCTAGAGG - Intronic
932769834 2:74494508-74494530 CCCAAGTGCCTGGTACATAGTGG + Exonic
932966849 2:76486093-76486115 GCACGGTGCTTTGCACATTGTGG - Intergenic
933182408 2:79242191-79242213 CCACCGCGCCTGGCACATTTGGG + Intronic
933699375 2:85243758-85243780 CTAAGGTGCCTGGCACGTAGTGG - Intronic
934087875 2:88525438-88525460 CCAGGGTCCCTGGGACAAAGGGG - Intronic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
934976264 2:98804970-98804992 CCCCAGGGCCTGGCACCTAGTGG - Intronic
936226073 2:110653715-110653737 CCACTGTGCCTGGCCAGTAGTGG - Intronic
936630644 2:114199311-114199333 AAACTGTGTCTGGCACATAGTGG + Intergenic
937012890 2:118577453-118577475 CCACGATGACTGGAACATACGGG + Intergenic
937082155 2:119147835-119147857 CCACGGTGCTGGGCACACAGTGG + Intergenic
937156408 2:119722784-119722806 GCATGGTGCTTGGCACATGGTGG + Intergenic
937299470 2:120830335-120830357 GCATAGTGCCTGGCACATAGGGG + Intronic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
938182183 2:129193126-129193148 CCAAGGTGCCAGGCACACAAAGG + Intergenic
939003321 2:136759716-136759738 CAACAGTGCCTGGCAAATGGCGG - Intergenic
939335801 2:140826623-140826645 GCATGGTGCCTGGCAGATTGGGG - Intronic
939561359 2:143736089-143736111 CCACTGCGCCTGACACATATAGG - Intronic
939585462 2:143999046-143999068 CCAGAGTGCCTGGCAATTAGGGG - Intronic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940135131 2:150426885-150426907 CTGTGGTGCCTGGCACACAGTGG + Intergenic
940290300 2:152071994-152072016 GAACTGTGTCTGGCACATAGTGG - Intronic
941212570 2:162659628-162659650 CCACTGCGCCTGGCCAATAGTGG + Intronic
941362657 2:164571631-164571653 GCTCAGTGCCTGGCACATAATGG - Intronic
941598744 2:167511911-167511933 TCCCCGTGCCTGGCACATGGTGG - Intergenic
941782376 2:169459128-169459150 GCACAGTGCCTATCACATAGTGG - Intergenic
942213528 2:173695350-173695372 TCTCAGTGCCTGGCACATTGTGG + Intergenic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
942398723 2:175578902-175578924 GCACAGTGCCTGGCACTTAGTGG - Intergenic
942403578 2:175629376-175629398 GCACAGTGCCAGGCACATGGAGG - Intergenic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943102440 2:183504887-183504909 CCACCATGCCCGGCACATTGAGG + Intergenic
943289454 2:186050075-186050097 GCACAATGCCTTGCACATAGTGG - Intergenic
943613082 2:190057900-190057922 CCAGATTGCCTGGCACATAATGG + Intronic
944150029 2:196548040-196548062 CCACTGCGCCTGGCCCATAGTGG - Intronic
944318317 2:198307115-198307137 GCCCAGTGCCTGGCACACAGTGG - Intronic
944483147 2:200177794-200177816 GCACAGTGCCTGGCATATATTGG + Intergenic
944553858 2:200869076-200869098 CCACTGTGCCTGGCCCATCAAGG + Intergenic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945158956 2:206868988-206869010 ACAAGGTCCCTGGCATATAGGGG - Intergenic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
946131553 2:217610693-217610715 ACCCAGTGCCTGGCACAGAGCGG + Intronic
946387808 2:219395896-219395918 CCTCAGTGCCTGGCAGGTAGTGG + Intronic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
946735519 2:222750780-222750802 CCACAGTGCCTTGCATACAGCGG - Intergenic
946905433 2:224411604-224411626 GCACAATGCCTGGCACCTAGTGG + Intergenic
947136654 2:226982790-226982812 CCCTGGTGCCTGGTACATAGTGG - Intronic
947226617 2:227846569-227846591 CCACTGTGCCTGGCCCAGTGTGG + Intergenic
947507947 2:230724392-230724414 CCACCGTGCCCGGCCCATAGAGG - Intronic
947587630 2:231366408-231366430 CCACCGTGCCTGGCCCGTAATGG - Intronic
947718057 2:232351664-232351686 GCACGGGGCCTGGCACGTAGTGG + Intergenic
947724325 2:232387816-232387838 GCACGGGGCCTGGCACGTAGTGG + Intergenic
947729506 2:232420176-232420198 GCACGGGGCCTGGCACGTAGGGG + Intergenic
947741515 2:232487010-232487032 GCAAGGGGCCTGGCACGTAGTGG + Intronic
947946755 2:234110394-234110416 GGACAGTGCCTGGCACCTAGTGG - Intergenic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
948423861 2:237876095-237876117 CCAGGGTGCCCGGCGCATCGGGG + Intronic
1168794572 20:602921-602943 GCACAGTGCCTGCCACACAGAGG + Intergenic
1168832004 20:851119-851141 GCACAGCTCCTGGCACATAGTGG - Intronic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1168991081 20:2096131-2096153 CCAAACTGCCTTGCACATAGAGG + Intergenic
1169126433 20:3130942-3130964 CCACTGCGCCTGGCCCAAAGAGG - Intronic
1169472568 20:5900912-5900934 CTACTGTGCCTGGCACACGGTGG - Intergenic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1169918361 20:10706397-10706419 TCACAGTGCCTAGCACAGAGTGG - Intergenic
1169918679 20:10709630-10709652 CCACTGTGCCTAGCCCAAAGAGG + Intergenic
1170269510 20:14508605-14508627 GAACGGTGCCTGGAACATGGAGG - Intronic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1170333030 20:15236510-15236532 ACACAGTGCCTGGCACCAAGTGG - Intronic
1171017003 20:21551154-21551176 GCACAGTGCATGGCACACAGAGG - Intergenic
1171142341 20:22754123-22754145 CCATGGTGCCTGGCACATGGTGG - Intergenic
1171414344 20:24967486-24967508 CAACAGTGCCTGGCACATGTAGG - Intronic
1171426750 20:25053350-25053372 CCACGGCGCCTGGCCCACAATGG + Intronic
1171528803 20:25837650-25837672 CCACTGTGCCCGGCCAATAGAGG - Intronic
1171548023 20:26018236-26018258 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172109588 20:32537140-32537162 GCACGGCGCCTGGCACATAGCGG - Intronic
1172164515 20:32890884-32890906 GCATAGTGCCTGGCACATAGTGG + Intronic
1172494863 20:35373389-35373411 CCACTGTGCCTGGCCCATTCTGG - Intronic
1172637272 20:36418398-36418420 CCACCGTGCCTGGCCCATTTGGG + Intronic
1172754175 20:37271884-37271906 ACTCGGTGAATGGCACATAGCGG - Intergenic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173161637 20:40657211-40657233 GCACAGTGCCTGGCACAAGGTGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173345975 20:42200366-42200388 GCACAGTGCCTCGCACATAGTGG + Intronic
1173402299 20:42736469-42736491 CCCTGGTGCTTGGCACATTGTGG - Intronic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173812127 20:45962373-45962395 GCACAGAGCCTGGCACAGAGTGG - Intronic
1173897256 20:46560421-46560443 ACACAGTGCCTGGAACCTAGAGG - Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174039729 20:47690353-47690375 GCAGGGTGCCTGGCACGTAGTGG - Intronic
1174200611 20:48804192-48804214 GAACAGTGCCTGGCACATAGTGG - Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174219225 20:48939258-48939280 CCACCGCGCCTGGCCTATAGTGG + Intronic
1174251765 20:49225326-49225348 CCACTGTGCCTGGCCAGTAGTGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1174411683 20:50340611-50340633 TCTCAGAGCCTGGCACATAGGGG + Intergenic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1174787863 20:53449428-53449450 CAACGGTGCCTGACACATAGTGG - Intronic
1174848141 20:53964043-53964065 CCCTTGTGCCTGGAACATAGTGG + Intronic
1175308459 20:57994316-57994338 GCACGGTGCCCGGCACAGAGCGG + Intergenic
1175477886 20:59289656-59289678 GTGTGGTGCCTGGCACATAGTGG + Intergenic
1175496511 20:59418240-59418262 GCACAGTGCTTGGCATATAGTGG - Intergenic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1175722818 20:61297608-61297630 GGGCGGTGCCTGGCACACAGTGG + Intronic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178516815 21:33254977-33254999 GAACGTTGCCTGGCACATAACGG + Intronic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178854574 21:36239703-36239725 CCACGGTGCCTGGCGCACAGGGG + Intronic
1178993243 21:37373047-37373069 CTCCAGTGCCTGGCACATAGGGG + Intronic
1179094755 21:38303472-38303494 ACATGGTGCCTGGCAGACAGTGG + Exonic
1179805761 21:43835946-43835968 CCATGGTGTCTGGGCCATAGTGG - Intergenic
1179839506 21:44062266-44062288 GAACAGTGCCTGGCACATGGTGG - Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1179939771 21:44629812-44629834 CCCCAGTGCCTGGCTCATAAGGG + Intronic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1180971304 22:19817199-19817221 CCACTGTGCCTGGCCCCTAATGG - Intronic
1181620020 22:24084709-24084731 CCATTGTGCCTCGCACAGAGAGG + Exonic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181832953 22:25577460-25577482 CCACCGTGCCTGGCCCGTAAAGG + Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182006115 22:26961043-26961065 ACAAGGAGCCTGGCACATGGTGG - Intergenic
1182007962 22:26977232-26977254 TCACAGTGCCTGGCACAGAGTGG + Intergenic
1182102861 22:27670153-27670175 CCTCGGTGCCTGGCACAGGTAGG - Intergenic
1182114334 22:27746689-27746711 GCACAGTGCCAGGCACAGAGGGG - Intergenic
1182129688 22:27841932-27841954 CTCCAGTGCCTGGCACACAGTGG - Intergenic
1182149299 22:28017326-28017348 CCATGGTGCCTGGCACATCACGG - Intronic
1182152899 22:28042956-28042978 CCACCGTGCCTGGCCCAGGGAGG - Intronic
1182544353 22:31065720-31065742 CCACAGGGACTGGCACATAATGG - Intronic
1182562417 22:31170938-31170960 CCACTGTGCCTGGCATGTGGGGG + Intronic
1182889837 22:33808466-33808488 CCAAGGTGCTTGGCACAAATAGG + Intronic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183319726 22:37157542-37157564 CCACTGTGCCTGGGACTGAGGGG + Intronic
1183325427 22:37188754-37188776 CCCATGTGCCTGGCACAAAGGGG - Intronic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183482009 22:38070340-38070362 ACATGGTGGCTGGCACACAGTGG + Intronic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183592424 22:38787689-38787711 CCACAGTGGTTTGCACATAGTGG - Intronic
1183603205 22:38851975-38851997 CCACGGTGCCATGCACAGAACGG + Intergenic
1183637629 22:39074359-39074381 CCACTGCGCCTGGCACAAATGGG - Intronic
1183722731 22:39571872-39571894 GCACAGTGCTTGGCACATCGTGG + Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1183910971 22:41078901-41078923 ACACAGTGCCTGCCACATAGAGG + Intergenic
1183918751 22:41146452-41146474 CCACTGTGCCTGGCCTATAATGG + Intronic
1184063597 22:42101834-42101856 CCACTGTGCCTGGCCCATTAAGG + Intergenic
1184172679 22:42769073-42769095 TCAGGGTGCCCGGCACACAGTGG - Intergenic
1184280890 22:43436770-43436792 ACCCCGTGCCTGGCACACAGCGG - Intronic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184525509 22:45020351-45020373 CAGCAGTCCCTGGCACATAGTGG - Intergenic
1184607682 22:45583495-45583517 CAGCAGTGCCTGGCACACAGTGG + Intronic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
1184791751 22:46704182-46704204 CCACGGGGCAGGGCACACAGTGG + Intronic
1184890739 22:47377479-47377501 AAACGGTGCCTGGAACAGAGAGG + Intergenic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949097482 3:102829-102851 GCACAGTGCCTCACACATAGTGG - Intergenic
949410812 3:3762140-3762162 CCACAGTGCCTGAAACAGAGTGG - Intronic
949447684 3:4152578-4152600 CCACCGTGCCTGGCCCAGTGTGG + Intronic
949479768 3:4482467-4482489 TCGCAATGCCTGGCACATAGTGG - Intergenic
949493414 3:4610244-4610266 CCAAGGTGTCTGGCGCACAGAGG - Intronic
949516628 3:4813447-4813469 CCACAGTCCCTGGCAAATGGCGG - Intronic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
949650398 3:6151602-6151624 GCACAGTGCTGGGCACATAGTGG + Intergenic
949779329 3:7668355-7668377 CCACTGTGGGTGGCAAATAGAGG - Intronic
949897630 3:8780142-8780164 GCATGATGCCTGGCACATAGTGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950026742 3:9825438-9825460 TCACAATGCCTGGCACATAGTGG + Intronic
950103050 3:10369955-10369977 CCAGGGTTCCAGGCACAGAGGGG + Intronic
950156624 3:10725853-10725875 ACACAGAGCCTGGCACATGGAGG - Intergenic
950228435 3:11255305-11255327 CCTCATTGTCTGGCACATAGAGG - Intronic
950233952 3:11302077-11302099 CCACAGTGCCTTGCACACTGAGG - Intronic
950239050 3:11351472-11351494 CCAGGGTGGCTGCAACATAGAGG + Intronic
950500601 3:13361229-13361251 GAACCATGCCTGGCACATAGCGG + Intronic
950528610 3:13539541-13539563 GCACAGTACCTGGCACAGAGTGG + Intergenic
950542899 3:13622682-13622704 CCACGGCGCCTGGCCCACATGGG - Intronic
950581651 3:13866200-13866222 ACCCAGTGCCTGGCACATGGAGG - Intronic
950689631 3:14645755-14645777 CCAGAGTCCCTGGCACACAGTGG + Intergenic
950975613 3:17239721-17239743 TAACTGTGCCTGGCAAATAGAGG + Intronic
951362345 3:21740111-21740133 CCATGTTGCCTGGGACTTAGAGG - Intronic
951593540 3:24292640-24292662 GCACTGTGCCTGGCAAATAGTGG + Intronic
951648778 3:24924907-24924929 AGATGATGCCTGGCACATAGAGG + Intergenic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
951926286 3:27912146-27912168 CCCCAGTGGCTGGCACCTAGTGG - Intergenic
952666110 3:35906271-35906293 GCACAGTGCTTGGCACATGGAGG + Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953134594 3:40171773-40171795 GCACAGTGCCTTGCACATAGTGG - Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953375461 3:42424475-42424497 CTACAGTGCCTGGCACATGGTGG - Intergenic
953481496 3:43256120-43256142 TCACAGTGCCTGGCACAGAGGGG - Intergenic
954237090 3:49265204-49265226 CCACTGTGCCCGGCCCAGAGTGG - Intergenic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954851563 3:53605254-53605276 CCACGGTGCCAGACACACAAAGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955354139 3:58216440-58216462 GCACGGTGCCTGGCCCTCAGGGG + Intergenic
955468918 3:59265624-59265646 ACACAGTGTCTGGCACATGGTGG - Intergenic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
955505600 3:59630063-59630085 GCATAGTGCCTGGTACATAGCGG - Intergenic
955666235 3:61351902-61351924 GAACAGTGGCTGGCACATAGTGG - Intergenic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955672058 3:61412370-61412392 CCACTGTGACTGGCACAGAATGG - Intergenic
955676377 3:61453195-61453217 GCACTGTCCCTGGCACAAAGTGG + Intergenic
955751253 3:62187064-62187086 AGACAGTGCCTGGCACGTAGTGG - Intronic
955863995 3:63362398-63362420 ACATGGTGCCTGTCACTTAGTGG - Intronic
955880324 3:63537553-63537575 GCACAGTGCCTGGCACCTGGTGG + Intronic
956052580 3:65264435-65264457 ACAGAGTGCCTGCCACATAGAGG + Intergenic
956052588 3:65264522-65264544 TCACAGTGCCTGCCACATAGAGG + Intergenic
956052602 3:65264671-65264693 TCACAGTGCCTGCCACATAGAGG + Intergenic
956052608 3:65264729-65264751 TCACAGTGCCTGCCACGTAGAGG + Intergenic
956052619 3:65264847-65264869 TCACAGTGCCTGCTACATAGAGG + Intergenic
956052627 3:65264934-65264956 TTACAGTGCCTGCCACATAGAGG + Intergenic
956052647 3:65265140-65265162 TCACAGTGCCTGCCACATAGAGG + Intergenic
956052650 3:65265169-65265191 TCACAGTGCCTGCCACATAAAGG + Intergenic
956487260 3:69736068-69736090 ACAATGTGCCTGGCACAGAGTGG + Intergenic
956657233 3:71564352-71564374 ACAGGGTGCCTGGCAAATACAGG - Intronic
956662053 3:71608662-71608684 ACACAGTGCCTGGCACTGAGTGG + Intergenic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
957724032 3:84041657-84041679 GAACAGTGACTGGCACATAGTGG - Intergenic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
959650683 3:108747718-108747740 GCACAGTGCCTGGCCCATGGAGG - Intronic
960046420 3:113203208-113203230 GCATGATGCCTGGCACATGGTGG - Intergenic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
960915894 3:122694496-122694518 GCACAGTGCCTGGCACATCGTGG + Intronic
961607929 3:128111308-128111330 ACACAGTTCCTGGCACATAGTGG - Intronic
961672886 3:128547738-128547760 GCACTGTCCCTGGCACATGGTGG - Intergenic
961831944 3:129627408-129627430 CCTCAGTGCCTGGCCCAGAGCGG - Intergenic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962325366 3:134427907-134427929 CCACAGTACCTGGCACGGAGTGG - Intergenic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
962741057 3:138362772-138362794 GCACGGTGCCTGCCACACAGTGG - Intronic
962886797 3:139635066-139635088 GCACAGTACCTGGCCCATAGAGG + Intronic
962951218 3:140220843-140220865 ACACAGTCCCGGGCACATAGAGG - Intronic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
963138740 3:141930791-141930813 GCACAGTGCCTAGCACACAGTGG - Intergenic
963715317 3:148796210-148796232 CCACTGTGCCTGGCCCTTACTGG - Intronic
964529329 3:157650242-157650264 CCTCAGTGCCTGGCACATCGTGG - Intronic
965667530 3:171111132-171111154 CCACTGTGCCTGGCTCATTGTGG - Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966177697 3:177157057-177157079 ACACTGTGCCTGGCCCAGAGAGG - Intronic
966436219 3:179887088-179887110 GCTCGGTGCCTGTCACATATAGG - Intronic
966542912 3:181111689-181111711 CCACTGTGCCTGGCTGATGGTGG - Intergenic
966552435 3:181219944-181219966 GAACAGTGCCTGGCACATAGTGG + Intergenic
966676402 3:182594845-182594867 GCACAGTGCCAGGCACATTGTGG + Intergenic
966784708 3:183612582-183612604 GCTCTGTGCCTGGCACATAGTGG - Intergenic
966812989 3:183865016-183865038 CCACTGTGCCTGGCCCCAAGAGG - Intronic
966896872 3:184451637-184451659 CCACAGTGCCTGGCCAACAGTGG + Intronic
967096446 3:186181243-186181265 CCATGGTGCCTGGCACGTGGTGG + Intronic
967108397 3:186272055-186272077 GCATGGTGCCTGGCACATAGTGG + Intronic
967141861 3:186568208-186568230 CCACTGTGCCAGACACACAGTGG - Intronic
967320034 3:188185880-188185902 GCATGAAGCCTGGCACATAGCGG + Intronic
967992974 3:195145360-195145382 CCACGGTGACTGGCACTGATGGG + Intronic
967992985 3:195145428-195145450 CCACGGTGACTGGCACTGATGGG + Intronic
968068989 3:195774270-195774292 CCCCGGCGCCTGCCCCATAGGGG + Exonic
968149441 3:196325485-196325507 CCACCGTGCCCGGCCCATATTGG + Intronic
968424544 4:513596-513618 CCCTGGTACCTGGCACCTAGTGG + Intronic
968574251 4:1357666-1357688 GCAGGGTCCCTGGCACACAGGGG - Intronic
968793507 4:2686360-2686382 GCACAGGGCCTGGCACATATTGG - Intronic
969292987 4:6252485-6252507 CCACTGTGCCCGGCCCCTAGAGG - Intergenic
969378853 4:6781777-6781799 GCATAGTGCCTGGCACCTAGTGG + Intronic
969522976 4:7689527-7689549 GCACGGTGCCTGATACGTAGGGG - Exonic
970133285 4:12894389-12894411 GCATGGTGCCTGGCACAGAGCGG + Intergenic
970173251 4:13309984-13310006 GCACAGTGCCCAGCACATAGTGG + Intergenic
970258505 4:14197323-14197345 TCATAGTGCCTGGCACATTGTGG - Intergenic
970341977 4:15116899-15116921 GCACAGTGCCTGGCACCCAGTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970436504 4:16040738-16040760 GCACCGGGCCTGGCACACAGTGG + Intronic
970882857 4:20952001-20952023 ACATGGTGCCTAGCACAGAGTGG + Intronic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
971477755 4:27088330-27088352 GAACAGTGCCTGGCACATAGTGG + Intergenic
972487430 4:39555518-39555540 CCACAGTGCCTGGCCAACAGAGG + Intronic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972631307 4:40844241-40844263 ACAGTGTGCCTGGCACACAGAGG - Intronic
972645998 4:40967863-40967885 GCACAGTGCCTGGGACATAATGG + Intronic
973314936 4:48749843-48749865 CCACTGTGCCTGGCCCAGGGAGG - Intronic
973340391 4:48997465-48997487 GAATGGAGCCTGGCACATAGTGG + Intronic
973587133 4:52404640-52404662 CCCCAGTGTCTGGCACATAGGGG + Intergenic
973740461 4:53914916-53914938 GCACTGAGCCTGCCACATAGTGG + Intronic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
973943833 4:55937453-55937475 CCACTGTGCCTGGCCCTTTGAGG + Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974073449 4:57146792-57146814 CCAGAGTGACAGGCACATAGCGG - Intergenic
974453810 4:62100399-62100421 CCACTGTGCCTGGCCTAGAGTGG + Intergenic
975100420 4:70506972-70506994 TCTTGGTGCCTGGCACATAATGG - Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
975826126 4:78321155-78321177 TCACAGTGCCTGGCTCATGGTGG - Intronic
975868775 4:78754345-78754367 ACACAGTGCCTAGCCCATAGTGG + Intergenic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
976097543 4:81525653-81525675 CAGCAGCGCCTGGCACATAGTGG - Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
977696031 4:99967475-99967497 CCACTGTGCCTGGCCCACATTGG + Intergenic
977792400 4:101123229-101123251 GGATAGTGCCTGGCACATAGGGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978518026 4:109589781-109589803 GCAGGTTGCCTGGCACAGAGTGG + Intronic
978534644 4:109748290-109748312 ACACAGTGCCTGGTACATATAGG - Intronic
978860721 4:113445641-113445663 TCACAGTGCCTGTAACATAGTGG + Intergenic
979561554 4:122107503-122107525 GAATGGTGCCAGGCACATAGAGG + Intergenic
981029969 4:140114334-140114356 CAACAGTACCTGGCACAGAGGGG + Intronic
981040925 4:140220797-140220819 AAAAAGTGCCTGGCACATAGTGG - Intergenic
981177035 4:141693440-141693462 CCATAGTGCCTGACACATACGGG + Intronic
981639107 4:146915008-146915030 ACACAGTGCCTGACACATTGTGG - Intronic
981697472 4:147573460-147573482 GCACAGTGCCTAGCACAAAGTGG - Intergenic
982790315 4:159584572-159584594 CCACTGCGCCTGGCACACATGGG + Intergenic
982921110 4:161276479-161276501 CCACCGCGCCTGGCCCATGGAGG - Intergenic
983257509 4:165416856-165416878 GGACAGTGCCTGGCACACAGTGG + Intronic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984849059 4:184137382-184137404 CCACTGTGCCCGGCCTATAGTGG + Intronic
984862287 4:184251882-184251904 CCATGTTGCCAGGCACATAGGGG + Intergenic
984953624 4:185024502-185024524 AGACAGTGCCTGGCCCATAGGGG + Intergenic
985012621 4:185599908-185599930 CCAGGATGCCTGCCACAAAGTGG + Intronic
985279369 4:188270391-188270413 CCAGGGAGCCTGGCCCACAGGGG + Intergenic
986180397 5:5387643-5387665 CCAGAGTGCCTGGAACATTGAGG - Intergenic
986619408 5:9656143-9656165 GCACAGTACCTGGCACATATAGG + Intronic
987863549 5:23513592-23513614 CCACCATGCCTGGCCCAGAGTGG - Intronic
987879284 5:23720712-23720734 GAATAGTGCCTGGCACATAGAGG + Intergenic
988411560 5:30892543-30892565 CCACAGTGCCCAGCACATAGTGG - Intergenic
989356522 5:40549748-40549770 GAACAGTGCCTGGCACTTAGTGG - Intergenic
989654486 5:43731536-43731558 CCACTGTACCTGGCACTGAGTGG + Intergenic
989678039 5:43995814-43995836 ACACAGTGCTTGGCCCATAGTGG + Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990548773 5:56851277-56851299 GCACAATGCCTGGCACACAGGGG - Intronic
990896397 5:60704122-60704144 GTATGGTGCTTGGCACATAGTGG + Intergenic
991029950 5:62072222-62072244 GCACAGGGCCAGGCACATAGTGG + Intergenic
991504429 5:67309326-67309348 CAACTGAGCCTGGCACATGGTGG + Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
991671148 5:69049059-69049081 TCAGGGTCCCTTGCACATAGTGG - Intergenic
991899923 5:71450531-71450553 CCCCTGTGCCTGGCGCACAGTGG - Intergenic
992024461 5:72656964-72656986 AAACAGTGCCTGGCACATGGTGG - Intergenic
992062857 5:73073505-73073527 GCAAAGTGCCTGGCACATGGTGG + Intronic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
992768361 5:80024089-80024111 ACCCAGTGCCTGGCACATGGTGG - Intronic
993144438 5:84075760-84075782 CCACTGTGCCCGGCCCACAGGGG + Intronic
993436668 5:87904206-87904228 GCACAGTGCCTGGAACAAAGTGG - Intergenic
993584538 5:89707962-89707984 CCAACTTGCCTGGCAGATAGTGG + Intergenic
993633751 5:90319052-90319074 CGCCAGTGCGTGGCACATAGAGG - Intergenic
993925769 5:93864022-93864044 TTACAGTGTCTGGCACATAGTGG - Intronic
994310241 5:98260719-98260741 TCACAGTGCCTGACACATATAGG - Intergenic
994389883 5:99179549-99179571 TCACGCCGCCTGGCACAAAGTGG - Intergenic
995061199 5:107813470-107813492 TCCCTGTGCCTAGCACATAGTGG - Intergenic
995412935 5:111878920-111878942 AAACAGTGTCTGGCACATAGTGG - Intronic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
996842361 5:127861293-127861315 CCACCGTGCCTGGCCCATCTTGG + Intergenic
997270036 5:132528639-132528661 GCATGGTGCCTGGCACATAGTGG + Intergenic
997291374 5:132737981-132738003 ACACAGAGCCTGGCACAGAGTGG + Intergenic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
997888196 5:137650467-137650489 CCCCAGTGCCTGGCAATTAGTGG + Intronic
997945336 5:138195306-138195328 CCACTGCGCCTGGCCCATAAAGG - Intronic
998132213 5:139657086-139657108 ACATGGTGCCTGCCACAGAGAGG - Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998508528 5:142691793-142691815 TGACGATGCCTGGCATATAGTGG + Intronic
998599454 5:143570210-143570232 GCACAGTGCTTGACACATAGGGG + Intergenic
999046185 5:148472267-148472289 GCACAATGCCTGGCACACAGTGG + Intronic
999176732 5:149637046-149637068 CCATGGTGCCAGGCAGTTAGTGG + Intergenic
999201764 5:149821714-149821736 ACACAGTGCCTGACACATAGGGG - Intronic
999253756 5:150197910-150197932 TCACGGTGCTGGGCACACAGTGG + Intronic
999277885 5:150344061-150344083 GCTCGGTGCCTTGCACATATGGG - Intergenic
999295830 5:150458958-150458980 CCACGGTGCGTGGAATACAGGGG + Intergenic
999637515 5:153638246-153638268 CCACAGTGTCTAGCCCATAGAGG + Intronic
999696023 5:154189825-154189847 GCACAGTGTTTGGCACATAGTGG + Intronic
999730259 5:154472023-154472045 CCACAGTGCCTAGCACATGGTGG + Intergenic
1000037864 5:157462363-157462385 CCACCGTGCCTGGCCCTAAGAGG - Intronic
1000092342 5:157940680-157940702 CCACCGTGCCTGGCCCCAAGTGG - Intergenic
1000141766 5:158411669-158411691 ACAGGGTGCCGGGCACATAGGGG + Intergenic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1000369701 5:160522962-160522984 TCACAGAGCCTGGCACATAGGGG - Intergenic
1000378113 5:160602978-160603000 GCACGGTGCCTGACACTTACTGG - Intronic
1000507152 5:162135468-162135490 GCACAGTGCCTGGGACATAGAGG - Intronic
1000957366 5:167559025-167559047 TCCCAGGGCCTGGCACATAGTGG + Intronic
1001095620 5:168773337-168773359 GCACGGCGCCTGGCATATGGTGG + Intronic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001427068 5:171629639-171629661 TCATTGTGCCTGGCACATAGTGG + Intergenic
1001566264 5:172701388-172701410 GAACAGTGCCTGGCACGTAGTGG + Intergenic
1001740853 5:174051616-174051638 GCACAGTGCCTGGCTCACAGAGG - Intronic
1001741472 5:174056340-174056362 GCACAGTGCCAGGCACATAGTGG + Intronic
1002192407 5:177485235-177485257 CCACAGTGCCTGGCCCTTTGTGG + Intronic
1002208209 5:177578958-177578980 CCACCGTGCCCGGCCAATAGAGG - Intergenic
1002377791 5:178800742-178800764 CCACTGTGCCTGGCCCACTGAGG - Intergenic
1002471438 5:179438371-179438393 CCTTGGTGCCCGGCACACAGAGG + Intergenic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002701318 5:181127206-181127228 GAATGGTGCCTGGCTCATAGCGG + Intergenic
1002790077 6:430782-430804 TCTTGGTGCCTGGCACACAGAGG + Intergenic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1002932799 6:1645980-1646002 GCACTGTGCCTGGCACGCAGAGG + Intronic
1002966963 6:1976396-1976418 ACCCAGTGCCTGGCACATAACGG + Intronic
1003128334 6:3373883-3373905 GGACAGTGCCTGGCACGTAGTGG - Intronic
1003363963 6:5455077-5455099 GCACGATACCTGGCACAGAGCGG + Intronic
1003377830 6:5595525-5595547 CCATAGTGCCTGGCGCACAGTGG - Intronic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003458512 6:6307142-6307164 GCACTATGCCTGGCACATAGTGG + Intronic
1003491881 6:6629546-6629568 CCACTGTGGGTGGCACATTGTGG + Intronic
1003537019 6:6984378-6984400 GCACGATGCCAGGCACACAGAGG - Intergenic
1003569665 6:7247627-7247649 CCAGGGTGCCTGCCCCACAGCGG - Intronic
1003740671 6:8935031-8935053 GCAAAATGCCTGGCACATAGTGG - Intergenic
1004267069 6:14157826-14157848 TAACAGTACCTGGCACATAGTGG - Intergenic
1004382424 6:15144035-15144057 CCACCGCGCCTGGCTCATACTGG - Intergenic
1004384202 6:15158406-15158428 CCACGGTGCCTGGCCCAAAATGG + Intergenic
1004477948 6:15991418-15991440 TCTCTTTGCCTGGCACATAGTGG + Intergenic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1004991312 6:21141503-21141525 ACTCAGTGCCTGACACATAGTGG + Intronic
1005062823 6:21792945-21792967 CCACCGTGCCTGGCCTCTAGAGG + Intergenic
1005456004 6:26020609-26020631 CCACGGTGCCCGGCCGGTAGCGG - Exonic
1005569818 6:27133882-27133904 CCACTGTGCCGGGCACGTAGCGG - Exonic
1005651658 6:27890651-27890673 CCACGGTGCCTGGCCTGTAGCGG + Exonic
1005892498 6:30151519-30151541 TCACGGGGCCTGGCTCATGGTGG + Intergenic
1006130705 6:31867778-31867800 ACCCAGTGCCTGGCACATAGTGG + Intronic
1006375350 6:33668776-33668798 CCACAGTGCCAGGCACACAGCGG - Intronic
1006402654 6:33826785-33826807 CCAGGCTGCCTGGCTCAGAGTGG + Intergenic
1006451334 6:34107359-34107381 CCATGGCGCCAGGCACATAGAGG - Intronic
1006612606 6:35303497-35303519 TCACGGGGCCTGGCACCTAATGG - Intronic
1006626820 6:35403579-35403601 GCACGGTGCCTGGCATTTAGTGG - Intronic
1006660738 6:35641715-35641737 CCACCGTGCCCGGCCCAAAGGGG - Intronic
1006680345 6:35792740-35792762 ACACGGTGCCAGGCACACTGTGG + Intronic
1007257568 6:40539516-40539538 CGACTGTGTCTGGCACATAGTGG - Intronic
1007425382 6:41743082-41743104 CCCCAGTGCCTAGCACATGGTGG + Intronic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007539644 6:42629302-42629324 CCACTGTGCCCGGCTGATAGTGG + Intronic
1007947473 6:45839259-45839281 CAACAGTGACTGGCACATAGTGG + Intergenic
1007958111 6:45935376-45935398 CCAGCCTGCCTGGCACATGGTGG - Intronic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1008541084 6:52546912-52546934 CAACAGCGCTTGGCACATAGTGG + Intronic
1008684942 6:53914945-53914967 TCAGAGTGCCTGGCACATAATGG + Intronic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1009705108 6:67239419-67239441 CGAGGGTGCCTGGCACATACTGG - Intergenic
1009926673 6:70128895-70128917 CCACAGAGCCTGGAAGATAGTGG + Intronic
1010372592 6:75128818-75128840 CCACTGTGCCTGGTCCACAGCGG - Intronic
1011113548 6:83865166-83865188 CCTGAGTGGCTGGCACATAGAGG + Intronic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1011622609 6:89257051-89257073 CTACCGTACCTGGCACAGAGTGG + Intergenic
1011690271 6:89860555-89860577 CCACTGTGCCTGGCCTATATTGG - Intronic
1011960825 6:93087780-93087802 ACACGGTACCTGGCATACAGTGG + Intergenic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1012841807 6:104338225-104338247 GTACAGTGCCTAGCACATAGTGG + Intergenic
1012949457 6:105502804-105502826 ACACAGTGCCTGCCACAGAGTGG - Intergenic
1013003017 6:106043382-106043404 GCACAGTGCCTGGCATGTAGAGG + Intergenic
1013241972 6:108254584-108254606 CAACACTGCTTGGCACATAGTGG - Intronic
1013432807 6:110070134-110070156 GAATGGTGCCTGGCACATGGTGG + Intergenic
1013535070 6:111056520-111056542 GCCCTGTGCCTGGCAAATAGGGG + Intergenic
1013604456 6:111734857-111734879 GCACAGTGCCTGTCACATAAAGG - Intronic
1014013954 6:116508213-116508235 GCACAGTACCTGGCACACAGTGG + Intronic
1014032829 6:116726087-116726109 GCACAGTGCCTGACACATAATGG + Intronic
1014652655 6:124059575-124059597 CTACAGTTCCTGGCACAGAGTGG + Intronic
1014750994 6:125256059-125256081 CCACCGTGCCTGGCCCCTAATGG - Intronic
1015019570 6:128456230-128456252 TCATAGTACCTGGCACATAGTGG - Intronic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1015866262 6:137729795-137729817 GCACAGTGCACGGCACATAGTGG - Intergenic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1016013918 6:139165043-139165065 GCACAGTACCTGGCACATAAAGG - Intronic
1016341978 6:143072077-143072099 CCACTATGCCTGGCTCATTGTGG + Intronic
1017014634 6:150090134-150090156 GCACAGTGCCTGGCACACGGTGG + Intergenic
1017419480 6:154258988-154259010 CCTATGTGCCTGGCAGATAGTGG + Intronic
1017476240 6:154796683-154796705 CCACCGTGCCTGGCCCCTAGAGG - Intronic
1017533501 6:155321729-155321751 GCAGGGTGCCTGGCACACAAGGG + Intergenic
1017705581 6:157119684-157119706 AGAGGGTGCCTGGCCCATAGGGG - Intronic
1017791216 6:157801439-157801461 CTACCATGCCTGGCACACAGTGG - Intronic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1017943292 6:159072578-159072600 GCACAGTGCCTGACACATAGTGG - Intergenic
1018223172 6:161601867-161601889 CCACCGCGCCCGGCATATAGTGG + Intronic
1018224013 6:161610540-161610562 TCACAGTGCCTGGTCCATAGAGG - Intronic
1018569123 6:165188256-165188278 GCCCAGTGCCTGGCACATGGTGG - Intergenic
1018630742 6:165819774-165819796 CAACAGTGCCTGCCACACAGTGG + Intronic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1019093753 6:169562612-169562634 TCACGCAGCCTGGCACAGAGTGG - Intronic
1019223766 6:170494797-170494819 CCTGTGTGCCTGGGACATAGTGG - Intergenic
1019351511 7:556234-556256 AAACGGTGCCTGGCACGTGGTGG - Intronic
1019490270 7:1309893-1309915 GCACAGTGCCTGGTGCATAGAGG - Intergenic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1020002220 7:4762437-4762459 CCCCGGTGCCTGGCCCCTGGGGG - Exonic
1020114733 7:5470215-5470237 CGAGGGGGCCTGGCACACAGAGG + Intronic
1020432181 7:8125705-8125727 TCCCAGTGCCTGGCACACAGTGG + Intronic
1020827284 7:13045302-13045324 GCACCGTGCCTGGCACATATTGG - Intergenic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1021971448 7:25969136-25969158 CCACCGTGCCCAGCCCATAGTGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022081768 7:27029694-27029716 CCACTGTGCCCGGCCTATAGTGG - Intergenic
1022100304 7:27165352-27165374 CCAGGGTCCCCGGCGCATAGCGG + Exonic
1022189765 7:28006108-28006130 CCACTGAGCCTGGCCCCTAGTGG - Intronic
1022966786 7:35481567-35481589 GCACAGTGCCTGGCACATGGTGG + Intergenic
1023083453 7:36546891-36546913 GCACAGTGCTTGGCACATCGTGG + Intronic
1023088934 7:36600128-36600150 TCTCAGTGCCTGGCACATAAGGG - Intronic
1023143736 7:37128796-37128818 GCACAGAGCCTAGCACATAGTGG - Intronic
1023539083 7:41245579-41245601 CAACGGTGCCTGGGACAGTGTGG + Intergenic
1024012733 7:45283890-45283912 CCACCGTGCCTGGCCTACAGTGG - Intergenic
1024051626 7:45627491-45627513 CCATGGAGCCTGGCACACAATGG + Intronic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1024295403 7:47837706-47837728 CCACAGTGTCTGGCACACAGTGG + Intronic
1024633831 7:51270414-51270436 GAACAGTGCCTGGCACGTAGTGG - Intronic
1025027469 7:55529090-55529112 CCACTGTGCCCGGCCCATTGAGG - Intronic
1025169129 7:56740399-56740421 CCATGGTGCCTGGCCCACATTGG + Intergenic
1025940802 7:66075373-66075395 TCTCTGTACCTGGCACATAGAGG + Intergenic
1025943512 7:66089723-66089745 CCCCAGTGCCTGGGACCTAGGGG - Intronic
1025958043 7:66197679-66197701 CCACCGTGCCTGGCCCATTCTGG + Intergenic
1026097632 7:67359085-67359107 GCATGGGGCTTGGCACATAGTGG - Intergenic
1026304395 7:69127721-69127743 TCACAGTGCCTGACTCATAGTGG - Intergenic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1026771386 7:73202747-73202769 GCACAGTGCCTGGCACACATGGG + Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027012252 7:74756144-74756166 GCACAGTGCCTGGCACACATGGG + Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027075788 7:75189910-75189932 GCACAGTGCCTGGCACACATGGG - Intergenic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027173394 7:75888432-75888454 ACACAGAGCCTGGCACATAGAGG - Exonic
1027368158 7:77480118-77480140 AGACAGTGACTGGCACATAGTGG + Intergenic
1027889779 7:83957015-83957037 GCATGATGCCTGGCACAAAGAGG - Exonic
1028730933 7:94147516-94147538 CCCCAGTGCCTGGCATGTAGTGG + Intergenic
1029156499 7:98521264-98521286 ACATGGTGCCTGGCACGTGGTGG + Intergenic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029670171 7:102024681-102024703 CCATGGGGCCTGGCACACAGTGG - Intronic
1029808620 7:103022987-103023009 CCACCGTGCCTGGCTAATGGTGG - Intronic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1030217933 7:107065764-107065786 TCACAGTGCCTGGCAGATAAAGG - Intronic
1030299253 7:107959054-107959076 GAACGGTGCCTGGCACATAGAGG + Intronic
1030857944 7:114584919-114584941 GCACAATGTCTGGCACATAGTGG + Intronic
1030947090 7:115737064-115737086 CCACTGTGCTTGGCCTATAGTGG + Intergenic
1031030332 7:116727428-116727450 CCTCAGTGCCTGGCACATTCTGG + Intronic
1031071435 7:117166600-117166622 CCACTGCGCCTGGCCCATAAAGG - Intronic
1031196653 7:118623677-118623699 CCACCGTGACTGGCCCATATAGG + Intergenic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1031979381 7:128114959-128114981 GCCCAGTGCCTGGCACACAGTGG + Intergenic
1031980149 7:128119487-128119509 GAATGGTGTCTGGCACATAGTGG - Intergenic
1032022488 7:128416716-128416738 GCACAGTGCCTTGCCCATAGTGG - Intergenic
1032102204 7:128990466-128990488 GAACAGTGCCTGGCACATAGTGG + Intronic
1032364516 7:131286816-131286838 CCACCGTGCCTGGCCCATTGGGG - Intronic
1032415615 7:131733206-131733228 CCCCTGTGCCTGGCACACAAGGG - Intergenic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1032710516 7:134456726-134456748 TCACAGTGCCTGGCAAATATAGG - Intronic
1033046037 7:137962809-137962831 ACACAGTACCTGGCACAAAGTGG + Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033657655 7:143383774-143383796 GCACAGTGCCTGGCACGTGGTGG - Intronic
1033822522 7:145151294-145151316 GATCAGTGCCTGGCACATAGTGG + Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1034475234 7:151277764-151277786 CCACAGTGCCCAGCACAGAGGGG + Intronic
1034631785 7:152536650-152536672 GCAACGTGCCTGGCACATAGTGG + Intergenic
1034712413 7:153205246-153205268 GCACAGTGCCTGGCATGTAGAGG - Intergenic
1034745485 7:153520098-153520120 GCACAGTGCCTGGTACATGGCGG - Intergenic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1035601932 8:902268-902290 CCATGGTATCTGGCACAGAGCGG + Intergenic
1035862677 8:3046929-3046951 CCACTGCGCCTGGCCCAGAGCGG - Intronic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037643067 8:20765981-20766003 ACATAGTGCCTGGCACAGAGTGG - Intergenic
1037706472 8:21319684-21319706 GTACAGTGCCTGGCACATGGTGG - Intergenic
1037761012 8:21741586-21741608 GCATGGTGCCTGGCACAGAGTGG + Intronic
1038075247 8:24065950-24065972 ATAGAGTGCCTGGCACATAGGGG + Intergenic
1038110249 8:24488742-24488764 ACACAGTACCTGGCACAAAGTGG - Intronic
1038176200 8:25184252-25184274 CTCCGGTGCCTGGCACTAAGCGG - Intergenic
1038240473 8:25803349-25803371 CCACTGTACCTGGCCCATTGGGG + Intergenic
1038291368 8:26252629-26252651 CCACTGTGCCTGGCCTGTAGTGG - Intergenic
1038601348 8:28946238-28946260 CCACCGTGCCCGGCCCATAGGGG + Intronic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1038818843 8:30933522-30933544 CCACCGCGCCTGGCCCAAAGTGG + Intergenic
1038905576 8:31898323-31898345 GCACAGTTCCTGGCACATAGTGG - Intronic
1039903714 8:41771011-41771033 GCACTGTGCCAGTCACATAGAGG - Intronic
1039933455 8:42017283-42017305 TCAAGGGGCCTGGCTCATAGTGG - Intronic
1039963543 8:42268097-42268119 CCACAGTGCCCAGCACATATAGG + Intergenic
1040016980 8:42707869-42707891 GAACAGTGCCTGGCCCATAGTGG - Intronic
1040060053 8:43096091-43096113 CCCCAGTGCCTGGCACACAGCGG - Intronic
1040650016 8:49437048-49437070 GCACAGTGCCTGGCACAACGTGG + Intergenic
1040720533 8:50316809-50316831 GCACAGTGCTTGGGACATAGTGG - Intronic
1040854316 8:51932930-51932952 TCACAGTGCCTGGAACATAGAGG - Intergenic
1041227022 8:55711001-55711023 CCACGGTGCCTGGCCAACAGTGG - Intronic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1042221199 8:66476463-66476485 CTATAGTGCCTGGCACATAGGGG - Intronic
1042618764 8:70679851-70679873 GCTCAGTGCTTGGCACATAGTGG + Intronic
1042937540 8:74075556-74075578 CCACTGTGCCTGGCTTATTGTGG + Intergenic
1043458683 8:80437858-80437880 TCACAGGGCCTGGCACATACTGG - Intergenic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1044787523 8:95810181-95810203 GCACAGTGCCTGATACATAGTGG - Intergenic
1044805638 8:96005667-96005689 GCACAATGCCTAGCACATAGTGG - Intergenic
1044811185 8:96063913-96063935 GCACAATGCCTGGCACATGGTGG + Intergenic
1044917764 8:97134207-97134229 CCTCAATGCCTGGCACTTAGTGG - Intronic
1044923003 8:97185669-97185691 CCCCGGAGCCTGGCACTCAGTGG - Intergenic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045378073 8:101595135-101595157 GGACACTGCCTGGCACATAGAGG + Intronic
1045663196 8:104459455-104459477 CCACAATGCCTGGCACTTAGTGG + Intronic
1046089138 8:109478280-109478302 CCAAAATGCCTGGCACATAGTGG - Intronic
1046116602 8:109792002-109792024 GCATGGTGCCAGGCACATAGTGG + Intergenic
1046131099 8:109969557-109969579 CCACCGTGCCCGGCCCATAATGG - Intronic
1046336070 8:112788664-112788686 TCACAATGCCTGGCACATAGAGG + Intronic
1046402921 8:113730621-113730643 CCACTGCGCCTGGCCCATACTGG + Intergenic
1046529435 8:115424424-115424446 GCACAGTGCCAGGCACATGGTGG - Intronic
1046614621 8:116462511-116462533 TTACAGTGCCTGGCCCATAGTGG - Intergenic
1046748822 8:117905395-117905417 ATATGGTGCCTGGCACATGGGGG + Intronic
1046847596 8:118935340-118935362 CCATGATGCCTGGTACATAGTGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047390468 8:124446517-124446539 CCACAGTGCCTGGCATATTTTGG + Intergenic
1047534850 8:125710075-125710097 ACCCTGTGCCTGGCACATAGTGG + Intergenic
1047711859 8:127560534-127560556 TCACAGTGCCTAGCACATAGAGG - Intergenic
1047722481 8:127653892-127653914 CCATGATGCCTTGCACACAGTGG + Intergenic
1047852535 8:128874109-128874131 GCACTGTGCTTGGCACATAACGG - Intergenic
1047953314 8:129953632-129953654 GCACGGAGCCTGGCACAAGGCGG + Intronic
1048026417 8:130591332-130591354 CCATAGTGCCTGACACAAAGTGG + Intergenic
1048168947 8:132086904-132086926 CCTTGGTGCCTTGCACATAGTGG - Intronic
1048215634 8:132491972-132491994 ATACGGTACCTGGCGCATAGCGG + Intergenic
1048366826 8:133745606-133745628 GCATGGTGCCTGGCACAGACTGG + Intergenic
1048380325 8:133859906-133859928 CCATGAAGCCTGGCACACAGAGG + Intergenic
1048407821 8:134140973-134140995 GGACGGTGCCTGGTGCATAGTGG + Intergenic
1048561983 8:135549244-135549266 GCACTGTGCATGGCACACAGAGG - Intronic
1048793418 8:138125834-138125856 ACACGCTGCCTGACACAGAGTGG - Intergenic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049320967 8:141996139-141996161 CCGTGCTGCCTGGCACACAGTGG - Intergenic
1049366070 8:142237452-142237474 CCAAAGGGCCTGGCACAAAGGGG + Intronic
1049980349 9:898404-898426 TCACCGTGCCTGGCCCAGAGAGG + Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1051114097 9:13674356-13674378 GTACAGTGCCTGGAACATAGTGG + Intergenic
1051741229 9:20254359-20254381 GCACAGAGCCTGGCACACAGTGG - Intergenic
1051785117 9:20733712-20733734 CCACTGTGCCTGGCCCAGTGAGG - Intronic
1051895876 9:21988798-21988820 GCACAGTGCCTTGTACATAGTGG - Intronic
1051903980 9:22074148-22074170 CCACTGTGCTTGGCACCTAGAGG + Intergenic
1051909555 9:22137908-22137930 ATACAGTGCCTGGCACATATAGG - Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1053263049 9:36687542-36687564 GCATAGTGTCTGGCACATAGTGG - Intergenic
1053384820 9:37678697-37678719 GAACAGTGCCAGGCACATAGAGG + Intronic
1053796786 9:41733885-41733907 CCACTGTGCCCGGCCAATAGAGG - Intergenic
1054185199 9:61945960-61945982 CCACTGTGCCCGGCCAATAGAGG - Intergenic
1054468150 9:65512078-65512100 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1054653310 9:67642536-67642558 CCACTGTGCCCGGCCAATAGAGG + Intergenic
1055109840 9:72548986-72549008 GCACAGTAGCTGGCACATAGTGG + Intronic
1055558361 9:77498593-77498615 ACATGATGCCTGGCACACAGTGG + Intronic
1055959611 9:81808033-81808055 CCACCGCGCCTGGCCTATAGTGG + Intergenic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057424629 9:94938265-94938287 CCACAGTGCTTGGCACTGAGAGG + Intronic
1057495713 9:95559555-95559577 GCACTGGGCCTGGCATATAGTGG - Intergenic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1057872420 9:98728470-98728492 GCACAGTGCCTGGCACATGGAGG - Intergenic
1057891874 9:98875739-98875761 GCCCAGTGCCTGGCACACAGAGG - Intergenic
1057891959 9:98876287-98876309 CCACGGTGCCTGGCCATTAGAGG + Intergenic
1057896442 9:98912682-98912704 GCACAGTGCCTGGCATGTAGTGG + Intergenic
1057993313 9:99796170-99796192 ACACAATGCCTGGTACATAGTGG - Intergenic
1058103694 9:100946037-100946059 TGACAGTGCCTGGCACAGAGTGG - Intergenic
1058182815 9:101818372-101818394 CCACTGCGCCTGGCCAATAGTGG + Intergenic
1058372341 9:104284434-104284456 AAACACTGCCTGGCACATAGTGG + Intergenic
1058437611 9:104977498-104977520 CCATGGTGCCTAGCACAGAGTGG - Intergenic
1058778621 9:108310568-108310590 CCAGAGTGCCTGGCACAGAAGGG + Intergenic
1059021566 9:110581709-110581731 CCACGGTGCTTTGCACATAAAGG - Intergenic
1059222966 9:112643280-112643302 GCCCAGTGCCTGGCACAGAGAGG + Intronic
1059380353 9:113918881-113918903 CCATGGTGTCTGGCACGTTGTGG + Intronic
1059541550 9:115135413-115135435 TCCCAGTGCCTGCCACATAGAGG - Intergenic
1059774713 9:117463554-117463576 GCCCAGTGCCTGGCACACAGTGG - Intergenic
1060019767 9:120119002-120119024 GCCCAGTGCCTGGCACAAAGTGG + Intergenic
1060031310 9:120217170-120217192 CCTTGGGGCCTGGCACACAGTGG - Intergenic
1060107358 9:120881432-120881454 TCACCGTGCCTGGCCCACAGGGG + Intronic
1060139708 9:121199943-121199965 TAACAGTGCCAGGCACATAGTGG - Intronic
1060145881 9:121252053-121252075 TTACAGTGCCTGGTACATAGTGG - Intronic
1060171392 9:121464223-121464245 GCACAGTGCCTGGTACATAGTGG + Intergenic
1060208552 9:121696970-121696992 CCACTGTGTCTAGCACATAATGG + Intronic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060404936 9:123368445-123368467 CCTGGGTACCTGGCACACAGTGG + Intronic
1060456056 9:123799195-123799217 TCACAGTGCCTGGCAAATAGTGG - Intronic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060639932 9:125229937-125229959 GCACAGTGTCTGGCAGATAGTGG + Intronic
1061017849 9:127992889-127992911 CAACAGTGCCTGGCACGGAGTGG - Intergenic
1061206810 9:129168975-129168997 GCACAGTGCCTGGCATATATAGG + Intergenic
1061542402 9:131284556-131284578 CCATGGGGCCTGGCACATTGTGG + Intergenic
1061619064 9:131799127-131799149 ACATGGTGCCTGGCACAGACGGG + Intergenic
1061834549 9:133320301-133320323 GAATGGTGCCTGGCACTTAGTGG - Intergenic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062109485 9:134774155-134774177 ACAGGATGCCTGGCACATAGAGG - Intronic
1062507537 9:136885957-136885979 CCCCGGTGCCGGGCGCAGAGCGG - Intronic
1062509140 9:136895219-136895241 CCACCGTGTCGGGCACACAGTGG + Intronic
1185494007 X:540558-540580 CCACTGTGCCTGGCCCATGCAGG + Intergenic
1186191700 X:7073104-7073126 GCACCCTGCCTGGCACACAGTGG + Intronic
1186478522 X:9877917-9877939 CCACGGTCCCTGGCACCGAGTGG - Intronic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187247180 X:17563283-17563305 CCTCAATGCCTGGCACATAGGGG + Intronic
1187380469 X:18797151-18797173 CCTCAGTTCCTGGTACATAGTGG + Intronic
1187544444 X:20234001-20234023 CCAATGTGCCTGGCACATAATGG - Intronic
1188013767 X:25085416-25085438 ACAAAGTACCTGGCACATAGTGG + Intergenic
1188023673 X:25186313-25186335 AAATGGTGCCTGGCATATAGTGG + Intergenic
1188076018 X:25776045-25776067 CCACCGTGCCTGGCTCATTAAGG - Intergenic
1188308003 X:28582477-28582499 GAACCATGCCTGGCACATAGTGG + Intergenic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189131708 X:38505624-38505646 GCACAGTGCTTGCCACATAGTGG + Intronic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189990833 X:46592648-46592670 CCACTGTACCTGGCTGATAGAGG + Intronic
1190001862 X:46696630-46696652 CCATAGGGCCTGACACATAGTGG - Intronic
1190029614 X:46959426-46959448 ACACGGTGCCTGGTACATACTGG - Intronic
1190038825 X:47052342-47052364 CCACTGTGCCTGGCCCACTGTGG - Intronic
1190236198 X:48617537-48617559 GCACAGTGCCTGGCACATGTAGG - Intergenic
1190454614 X:50615574-50615596 GCACAGTGCCCGGCACACAGTGG + Intronic
1190553453 X:51609530-51609552 TGACAGTGCCAGGCACATAGAGG + Intergenic
1190736655 X:53259912-53259934 GCACTGTGCCTGGCATACAGAGG - Intronic
1190775081 X:53546194-53546216 CCCCGCTGCCCGGCACACAGTGG - Intronic
1190809664 X:53871052-53871074 CCACAGTGCCTGGCCCAGAATGG - Intergenic
1191056474 X:56246412-56246434 CAACAGTACCTGGCACAAAGAGG - Intronic
1191634985 X:63366463-63366485 CCACCGTGCCTGGCACTTTGTGG - Intergenic
1191675418 X:63787379-63787401 TCACAATGCCTGGCACACAGGGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192270205 X:69571951-69571973 GCACAGGGCCTGGCACACAGTGG + Intergenic
1192600622 X:72459773-72459795 GCATGGTGTCTGGCACATAATGG + Intronic
1194232665 X:91343343-91343365 CCACCGCGCCTGGCACATGTTGG - Intergenic
1194239461 X:91426314-91426336 GCATAGTGCCTGACACATAGGGG + Intergenic
1194659486 X:96614130-96614152 CCACCGTGCCTGGCCAGTAGTGG - Intergenic
1195430794 X:104787090-104787112 AAACGTTGCCTGGCACAAAGTGG - Intronic
1195754870 X:108190715-108190737 ATACGGTGCCTGGAACATAATGG - Intronic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1196193047 X:112813983-112814005 CCACTGCGCCTGGCAAACAGAGG - Intronic
1196200375 X:112879868-112879890 GCACAGTGCCTGGCATGTAGTGG + Intergenic
1196262884 X:113606037-113606059 GTACTGTGCATGGCACATAGCGG - Intergenic
1196274764 X:113754158-113754180 CCATGGTTCCTTTCACATAGAGG - Intergenic
1197152110 X:123231456-123231478 GCACAATGACTGGCACATAGTGG - Intronic
1197351341 X:125387198-125387220 CCAAGGTTCCTGTTACATAGGGG + Intergenic
1197703217 X:129615619-129615641 GCACTGTGCCTGGCACACAATGG - Intergenic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1197916707 X:131543519-131543541 CCACGGTGCCTGACATAGAGTGG - Intergenic
1198122419 X:133607322-133607344 GCACAATGCCTGACACATAGTGG + Intronic
1198405115 X:136304684-136304706 GCATGCTGCCTGGCACATAGAGG - Intronic
1198425491 X:136515729-136515751 GAACAGTGCCTGGCACATAGTGG + Intergenic
1198428208 X:136540706-136540728 CCACAATGCCTGACACATGGAGG + Intronic
1198428755 X:136545403-136545425 GCACAGTGCCTAGCACATAGTGG - Intronic
1198511471 X:137356146-137356168 GCAAAGTGCCTGGCACATAGTGG + Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1200226194 X:154419235-154419257 TGATGCTGCCTGGCACATAGGGG + Intronic
1200274947 X:154723272-154723294 GCACAGTGTCTGGCACATAGTGG - Intronic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201282566 Y:12354132-12354154 CCAGGGTCCCTGGCACCTGGCGG - Intergenic
1202300306 Y:23406553-23406575 GCATAGTGCCTGACACATAGTGG - Intergenic
1202570505 Y:26264045-26264067 GCATAGTGCCTGACACATAGTGG + Intergenic