ID: 1173648056

View in Genome Browser
Species Human (GRCh38)
Location 20:44645999-44646021
Sequence CTGTGGGCGCAGAGTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1173648056_1173648063 11 Left 1173648056 20:44645999-44646021 CCAACCTCACTCTGCGCCCACAG 0: 1
1: 0
2: 1
3: 27
4: 373
Right 1173648063 20:44646033-44646055 CCACCTCCCCAGCCAGACCATGG 0: 1
1: 0
2: 5
3: 56
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1173648056 Original CRISPR CTGTGGGCGCAGAGTGAGGT TGG (reversed) Intronic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904958396 1:34308684-34308706 CTGTGTGCTCAGAGTGTGGTTGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905848385 1:41254510-41254532 CTGTGGTCTCAGAGTGTGTTTGG + Intergenic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
911514511 1:98850412-98850434 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
911940889 1:104046024-104046046 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
912181109 1:107220196-107220218 CTGTTGGCGGAGGGTGAGGAGGG - Intronic
913546236 1:119871648-119871670 GTGTGGGCACAGAGTAGGGTCGG - Intergenic
914225496 1:145716630-145716652 CTGTGGGCGCAGACAGTGTTAGG - Intergenic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
915907796 1:159891676-159891698 CTGTGGGTGCAAAGTGAGGTAGG - Intronic
917572693 1:176285615-176285637 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
920046937 1:203139319-203139341 CTGTGGGCGCAGATGCTGGTAGG + Intronic
920247586 1:204600034-204600056 CGGTGGGCGCAGAGGAAGGATGG + Intergenic
920276043 1:204805134-204805156 CTGTGGGCCAAGAGTCAGGCTGG - Intergenic
920562455 1:206948372-206948394 TTGTGGGTGCAGGGTGAGTTTGG + Intergenic
920651180 1:207838522-207838544 CAGAGGGCGGAGAGTGAGGGGGG + Intergenic
921178903 1:212616207-212616229 CCCTGGGCTCAAAGTGAGGTGGG + Intronic
921628552 1:217405025-217405047 CTGTAGACGCTGAGAGAGGTGGG + Intergenic
922971520 1:229745277-229745299 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
924388987 1:243530314-243530336 CTGTGGTCTGAGAGTGTGGTTGG - Intronic
1062860029 10:803696-803718 CAGAGGGCACAGAGTGAGCTGGG - Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067445118 10:46337080-46337102 CTGGGGCCGCACTGTGAGGTGGG + Intergenic
1067930275 10:50554007-50554029 TTGTAGGTGCAGAGTGAGTTGGG - Intronic
1068950024 10:62767496-62767518 CTGAGGTGGAAGAGTGAGGTCGG - Intergenic
1068962222 10:62878039-62878061 GGGTGGGGGCAGGGTGAGGTGGG - Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072086835 10:92087963-92087985 ATGTGAGGGCAGGGTGAGGTGGG + Intronic
1072509814 10:96109278-96109300 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1074889706 10:117725305-117725327 CTGTGGGCTAAGAATGAGGCTGG - Intergenic
1075204418 10:120434612-120434634 CTGTGGTGTCAGAGTGGGGTTGG + Intergenic
1075280681 10:121135667-121135689 CTGTGGGCGGAGTGTGGGGTGGG + Intergenic
1075362878 10:121855204-121855226 GTGTGGACACAGAGTGAGATTGG - Intronic
1076570090 10:131426793-131426815 CTGTTGTTGCAGGGTGAGGTAGG - Intergenic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1080256768 11:30298685-30298707 CTGTGGTCCCAGAGTGTGGTTGG - Intergenic
1081670781 11:44941324-44941346 CTGTAGGGGAAAAGTGAGGTTGG - Intronic
1081854261 11:46294248-46294270 CTGGGGGCTGAGAGTGAGGTCGG + Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082005285 11:47415764-47415786 CTGAGGGGGCAGTGGGAGGTGGG - Exonic
1083170865 11:60923517-60923539 CTGTGGGGGCAGTGTGAAGCTGG + Intergenic
1083659010 11:64243512-64243534 CTGAGGGTGCAGAGCGAGTTTGG + Intronic
1083701048 11:64477872-64477894 CTGAGGACGCACAGTGAGTTGGG + Intergenic
1084116323 11:67044937-67044959 CTGTGAGGGCAGAGTGAAGGGGG + Intronic
1084399528 11:68935647-68935669 CTGGGGGCGCAGGGTGGGCTGGG + Intronic
1084668012 11:70586925-70586947 CTCTGGGAGAGGAGTGAGGTGGG - Intronic
1085302607 11:75467313-75467335 CAGTGGGCGCATAATGAGGGTGG + Intronic
1086293173 11:85334774-85334796 CTGTGGTCTGAGAGTGTGGTTGG + Intronic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1089384637 11:118059751-118059773 ATCTGGGCTCAGAGTGAGGCAGG - Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090742344 11:129676172-129676194 CTGTGGTCCCAGAGTCTGGTTGG - Intergenic
1091041398 11:132284743-132284765 CTGTCGGGGAAGAGTCAGGTGGG - Intronic
1093490961 12:19703585-19703607 CTGTGGTCTGAGAGTGTGGTTGG - Intronic
1093541813 12:20296587-20296609 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1094213225 12:27914444-27914466 AGGAGGGCACAGAGTGAGGTTGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1101869995 12:108558301-108558323 CTGTGGGATCAGGATGAGGTGGG + Intronic
1102351554 12:112196161-112196183 CCGTGGGTTCAGAGTGAGTTTGG - Intronic
1102427017 12:112851781-112851803 ATGTGGGGGCAAAATGAGGTTGG - Intronic
1102999793 12:117376506-117376528 GGGTGGGAGGAGAGTGAGGTTGG + Intronic
1103469500 12:121168706-121168728 GTGTGGGGTCAGAGTGACGTGGG - Intronic
1103488168 12:121296659-121296681 CTGGGGGCGCAGAGCGCGGGAGG - Intronic
1103944396 12:124518049-124518071 AGGTGGGCGCAGACTGGGGTGGG - Intronic
1104180581 12:126376458-126376480 CTGTGGTCTGAGAGTGCGGTTGG + Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1104733286 12:131120929-131120951 TTGTGGGCGCAGAGCGGGGCTGG + Intronic
1106702357 13:32244019-32244041 CTGTGGGGGCAAAGTGCGGCTGG - Intronic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107632743 13:42358834-42358856 CTGTGGTCTCAGAGTGTGTTTGG - Intergenic
1109317980 13:60774394-60774416 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111518627 13:89368102-89368124 CAGTAGGCGAAGAGTGAGATTGG + Intergenic
1112859605 13:103814254-103814276 CTGAGGGCTCAGTGTCAGGTGGG + Intergenic
1113370037 13:109715911-109715933 CAGTGGGGGCAGAATGAGGGAGG - Intergenic
1114669243 14:24400016-24400038 CTGAGTGCTCAGAGTCAGGTAGG + Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115868557 14:37775578-37775600 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1115890778 14:38025960-38025982 CTGTGGTCCGAGAGTGTGGTTGG - Intronic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1117639166 14:57778763-57778785 CTGTGGTCTGAGAGTGAGCTTGG - Intronic
1118068708 14:62221602-62221624 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1118782483 14:69017932-69017954 CTGTGGGCGGTGGGTGGGGTGGG - Intergenic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1121331974 14:93055446-93055468 GTGTGGGTGGCGAGTGAGGTGGG - Intronic
1121553616 14:94820303-94820325 CTGGGGGTGGAGAGTGAGGAGGG - Intergenic
1121595505 14:95158651-95158673 CTGTGTGCACATTGTGAGGTAGG + Intergenic
1121665361 14:95667722-95667744 CTCTGGCCACAGAGTGAGGCAGG - Intergenic
1124190851 15:27574889-27574911 CTGTGACCACAGAGTCAGGTGGG - Intergenic
1124474103 15:30016698-30016720 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
1125078178 15:35645249-35645271 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1126302575 15:47214886-47214908 CTGTTGGAGAAGAGTGAGTTTGG + Intronic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1127288998 15:57553937-57553959 CTTTTGGCGCAGTGTGTGGTGGG + Intergenic
1128068548 15:64779231-64779253 CTGGGGGTGGAGAGTGAGGATGG - Intergenic
1128562570 15:68678331-68678353 CTGGGGGCTCAGTGTGAGGGAGG - Intronic
1129230386 15:74193997-74194019 CTCAGGGCCCAGTGTGAGGTGGG - Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1130957685 15:88639055-88639077 CTGAGGGCGCAGAGGCAGGCAGG + Exonic
1131507142 15:93029068-93029090 CTGTTGGCGCTGACTGAGGAGGG - Intergenic
1132660126 16:1057620-1057642 CAGTGGGCCCTGCGTGAGGTCGG - Intergenic
1132689532 16:1176386-1176408 CTGTCCCCGCAGAGTGGGGTCGG + Intronic
1133317530 16:4893674-4893696 CTGTGGGTGCAGGGGGTGGTGGG - Intronic
1133512899 16:6477971-6477993 CTATGGAGGCAGAGAGAGGTGGG - Intronic
1134047147 16:11109274-11109296 CTGTGGTCCCAGGCTGAGGTGGG - Intronic
1134690807 16:16190091-16190113 GGGTGGGGGCAGGGTGAGGTAGG - Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1137531223 16:49280270-49280292 CCTTGGGCGCCGAGAGAGGTGGG - Intronic
1137838089 16:51613306-51613328 CTGGGGGCGCACTGTGAGGGTGG + Intergenic
1138776748 16:59732216-59732238 CTGTGGTCCAAGAGTGTGGTTGG - Intronic
1139850780 16:69950749-69950771 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1139879764 16:70173661-70173683 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1140372760 16:74421887-74421909 CTGTGGGCTCAAAGGGGGGTGGG + Intronic
1140893994 16:79309060-79309082 CCCTGGGCGCAGAGAGAGGTGGG + Intergenic
1141780123 16:86153863-86153885 ATGTGGGCGCCAAGTGAGGCTGG - Intergenic
1142173482 16:88634638-88634660 CTGTGGGCGCAGAGGACGGGAGG - Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143105819 17:4530169-4530191 CTGAGGGCCCAGTGTGAAGTGGG - Intronic
1143496121 17:7313601-7313623 GTGTGGGCCCATAGTGAGGTGGG + Exonic
1143570659 17:7755991-7756013 CTTTGGGTGCTGGGTGAGGTGGG + Intronic
1143729665 17:8874058-8874080 CTCTGGGGGCAAAGTGAGGCAGG - Intergenic
1143772707 17:9178779-9178801 CGGTGGCCTCAGAGTGTGGTGGG - Intronic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144826687 17:18109156-18109178 CTCTGGGCCCAGGGTGAGGTAGG + Intronic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145209531 17:21003074-21003096 CTGTGGAGGCAGAGAGAGGGAGG + Intronic
1146012137 17:29204661-29204683 CTGAGGTGGCAGACTGAGGTAGG - Intergenic
1146947116 17:36881102-36881124 GTGGGGGTGCACAGTGAGGTTGG - Intergenic
1147689671 17:42307530-42307552 CTGTGGGCGCAGAGAGACTGTGG + Intronic
1147716799 17:42514021-42514043 CTGTGGGCGCACTGTCAGTTGGG + Intronic
1147987328 17:44314220-44314242 CTGTGGGTTCACAGGGAGGTTGG + Intronic
1147997111 17:44366259-44366281 CTGTTGGCCCAGGGTGAGGTAGG + Intergenic
1149481177 17:57004280-57004302 CTCTGGAGGCTGAGTGAGGTGGG + Intronic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1150130731 17:62667290-62667312 CCGAGGGAGCAGAGGGAGGTAGG + Intronic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1150944592 17:69731258-69731280 CAGTGGGCCCAGAATGAGATCGG + Intergenic
1151095661 17:71494911-71494933 CTGTGGGTGCAGAGTTTAGTTGG - Intergenic
1152149008 17:78587349-78587371 TTGTGGGCGCAATGTGAGGGAGG - Intergenic
1152226135 17:79093748-79093770 CTCTGGGTGCAGAGTGAGCTGGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152593132 17:81223255-81223277 TTGTGGGCGGGGCGTGAGGTGGG + Intergenic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1153931364 18:9882497-9882519 CTCTGGGCTCAGAGGGAGTTGGG + Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154033522 18:10775457-10775479 CGGTGGTTGCAGTGTGAGGTGGG + Intronic
1155708803 18:28850029-28850051 CTGTGGTCCCAGAATGTGGTTGG - Intergenic
1155779605 18:29814222-29814244 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1155935522 18:31749189-31749211 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1158588200 18:58758811-58758833 GTGGGGGCGCAGAGTGGGGTGGG - Intergenic
1158836335 18:61334380-61334402 CTGTGGGAGGAGAATGTGGTGGG + Intronic
1159395430 18:67849313-67849335 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1159473918 18:68892421-68892443 ATGTGGGAGCAGAGTCAGATGGG - Intronic
1159574557 18:70159229-70159251 CTGTGGCCTGAGAGTGTGGTTGG - Intronic
1160135399 18:76267021-76267043 GTGTGGGTGCTCAGTGAGGTAGG - Intergenic
1160955251 19:1688313-1688335 CTGTGGGACCAGAATGGGGTGGG + Intergenic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1165382671 19:35492175-35492197 GTGTGGGGGCAGCGTGAGGATGG - Intronic
1165383294 19:35495755-35495777 CTGTGGGTGGAGAGTGACCTAGG + Intergenic
1166165330 19:40983958-40983980 GTGTGGGCACTGACTGAGGTAGG - Intergenic
1166686661 19:44800528-44800550 CTGTAGGCGGAGAGAGGGGTGGG - Intronic
1166970683 19:46565263-46565285 CTGTGGGAGCTGGGAGAGGTAGG - Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167787975 19:51651419-51651441 ATGGGGGCGGAGAGTGGGGTTGG - Intergenic
1167851586 19:52206319-52206341 CTGTGGGTTTAGAGTCAGGTTGG + Intronic
1167980760 19:53273015-53273037 GTGTGGGGGCAGTGGGAGGTGGG + Intergenic
1168132954 19:54332479-54332501 CTCTGGGCTCAGAGGGAGGGTGG - Intergenic
1168401696 19:56089012-56089034 CTGGGGGCGCAGACTGGGGCGGG + Exonic
925833951 2:7924587-7924609 CTGTGGGGTCAGGCTGAGGTTGG + Intergenic
925899536 2:8498731-8498753 CTGTGTGAGAACAGTGAGGTGGG + Intergenic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
927679735 2:25131736-25131758 CTGTGGGCCCTGAGAGCGGTGGG - Exonic
928628757 2:33168983-33169005 CTGTGGCAGCAGAGTTAGGGGGG + Intronic
930018676 2:46987594-46987616 CTCTGGGTCCAGAGTGAGCTTGG + Intronic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
933891443 2:86775083-86775105 CTATGGGGCCAGACTGAGGTTGG - Exonic
934012422 2:87837361-87837383 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
934937598 2:98476664-98476686 CCATGAGCGCAGAGGGAGGTGGG - Intronic
935755738 2:106275123-106275145 GGGTGGGGGCAGAGTGAGGGTGG + Intergenic
937984603 2:127632887-127632909 CCGTGGTCACAGAGAGAGGTGGG + Intronic
938243210 2:129758894-129758916 CTGTGGGTGCTGGGTGAGGCAGG - Intergenic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939782162 2:146462675-146462697 CTGTGGTCCCAGAGTGTGGTTGG + Intergenic
940464505 2:154011418-154011440 CTGTGGTCTGAGAGTGTGGTTGG + Intronic
941599906 2:167529575-167529597 ATGTGGGAGGAGAGTGAGATCGG - Intergenic
942128456 2:172851288-172851310 CTGTGGTCTAAGAGTGTGGTTGG + Intronic
942458262 2:176152243-176152265 CTGTGGGCGCAAAAGGGGGTGGG + Intronic
946194956 2:218027371-218027393 GTGTGGGTGCAGAGTAGGGTCGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948915792 2:241034536-241034558 GGGTGGGGGCAGAGTGAGGGAGG - Intronic
1168793505 20:595957-595979 CTCTGGGAGGAGAGTGAGGGTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170050786 20:12142841-12142863 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
1170520752 20:17182525-17182547 CTGTGGTCTGAGAGTGAGTTTGG - Intergenic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172620049 20:36312814-36312836 CTGCGGGGGCAGACAGAGGTGGG + Intronic
1172754195 20:37272030-37272052 CTGTGGGAGCAGAGTGGGTGTGG + Intergenic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1173712033 20:45166776-45166798 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1174169551 20:48607465-48607487 CTGTGGTCGCAGAGTGCTGGGGG - Intergenic
1174171172 20:48619071-48619093 CTGTGGTCCCAGGCTGAGGTGGG - Intergenic
1175022728 20:55868112-55868134 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175800386 20:61798032-61798054 CTGTGGACGCTCAGTGAGGCTGG - Intronic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1178781749 21:35609962-35609984 CTGTGGGTGCAAAGTGATGTAGG + Intronic
1179004890 21:37504831-37504853 CTGCGGGTGCACAGTTAGGTAGG + Intronic
1179080902 21:38170002-38170024 CTGTGGGTGCAGCCAGAGGTGGG - Intronic
1179210420 21:39320164-39320186 GGGTGGGAGGAGAGTGAGGTTGG + Intronic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1179933985 21:44591059-44591081 CGGGGGGCACAGGGTGAGGTGGG - Intronic
1179987936 21:44931723-44931745 CTTTGGTCGGACAGTGAGGTTGG + Intronic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1182890753 22:33816952-33816974 CTGTAGGGGCAGATTGTGGTGGG - Intronic
1183376393 22:37467848-37467870 CTGTGGTCACACAGTGAGTTGGG - Intergenic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1185157525 22:49203194-49203216 CTGAGGGCGCAGAGAGATGGAGG - Intergenic
1185320236 22:50197350-50197372 AGGTGGGCACAGGGTGAGGTAGG + Exonic
950454767 3:13086074-13086096 GTTTTGGGGCAGAGTGAGGTAGG + Intergenic
951167248 3:19497589-19497611 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
952956554 3:38561259-38561281 ATCTGGGTGTAGAGTGAGGTGGG + Intronic
953215273 3:40912484-40912506 CTATGGCCGCACTGTGAGGTGGG + Intergenic
954372365 3:50175511-50175533 CTCTGGGTGCTGAGTGAGGAAGG - Intronic
954573778 3:51663435-51663457 CTGGGGGCCCCAAGTGAGGTGGG - Exonic
954713772 3:52517215-52517237 CTGGGGGCGCTGAGAGAGGAGGG + Intronic
954776774 3:53026591-53026613 CTGTGGGGGCACAGGGAGGGAGG - Intronic
955540738 3:59973402-59973424 CTGTGGCAGAAGAGAGAGGTTGG - Intronic
959551900 3:107669445-107669467 ATGTGGGTGGGGAGTGAGGTGGG + Intronic
960343198 3:116500129-116500151 CTGTGGTCTCAGAGTGTGTTTGG - Intronic
961389625 3:126544616-126544638 GTGTGGGAGCTGAGTGAGCTGGG - Intronic
961846841 3:129772233-129772255 CTGTGGTCCCAGGCTGAGGTGGG + Intronic
962994110 3:140608025-140608047 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
963615050 3:147526250-147526272 CTGTGGTCTCAGAGTGTGTTTGG + Intergenic
967165075 3:186773083-186773105 ATGTGGGCCCATATTGAGGTAGG - Intergenic
967214480 3:187198931-187198953 CTGTGGGGGCTGAGTGGGGAGGG + Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968926622 4:3551737-3551759 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
969573259 4:8022494-8022516 CTGGGGGGCCAGAATGAGGTGGG - Intronic
970703712 4:18773705-18773727 CTGTGATCTCAGAGTGTGGTTGG - Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
972010428 4:34173492-34173514 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
974075547 4:57165185-57165207 CTGAGGGAGCAGGCTGAGGTAGG + Intergenic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
975390078 4:73805665-73805687 CTGTGGACTGAGAGTGTGGTTGG - Intergenic
976129496 4:81870012-81870034 CTGTGGGTGAAGAGTGGGGTGGG + Intronic
977482220 4:97593237-97593259 CTGTGGGAGAAGAGTGGGGGTGG - Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
979568409 4:122183818-122183840 CTGTAGGGGGACAGTGAGGTTGG - Intronic
980467224 4:133201934-133201956 CTTTGGGAGCAGAGTGAAGAAGG + Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
983155344 4:164340346-164340368 CTCGGGGGGCTGAGTGAGGTGGG - Intronic
983547966 4:168982710-168982732 CTGTGGTATGAGAGTGAGGTTGG - Intronic
985245505 4:187976292-187976314 GCGTGGACACAGAGTGAGGTTGG + Intergenic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
986654982 5:10002324-10002346 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
986909494 5:12536428-12536450 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
987715976 5:21571529-21571551 CTGTGAGGGCTGAGAGAGGTGGG + Intergenic
989716111 5:44465653-44465675 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
991211643 5:64111953-64111975 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
991707168 5:69369401-69369423 CTGGGGGCGCAGAGTGCTCTGGG - Intronic
994907874 5:105864085-105864107 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
995750814 5:115451707-115451729 CTCTGGGCACAGACTCAGGTGGG + Intergenic
996888419 5:128387693-128387715 CTGTGGTCTGAGAGTGTGGTTGG + Intronic
997886500 5:137634859-137634881 CTGAGGGCTGAGAGTGAGGTTGG + Intronic
998378571 5:141708026-141708048 GGGTGGGGGCAGGGTGAGGTGGG + Intergenic
998919569 5:147052880-147052902 GTGAGGGCTCAGAGTGAGGGAGG + Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000569867 5:162898501-162898523 CTGTGGTCCCAGAGTGTGGTTGG - Intergenic
1002638952 5:180621532-180621554 CTGTCGGTGCAGGGTGAGGCTGG - Exonic
1002640256 5:180627322-180627344 CTGGGGTCGCAGAGTGAGGCAGG + Intronic
1004772064 6:18795449-18795471 GTGTGGGGGCAGGGTGAGGAAGG - Intergenic
1005909983 6:30300920-30300942 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1005983701 6:30856879-30856901 CTGTGGCCTCAGGTTGAGGTGGG - Intergenic
1006739574 6:36297714-36297736 ATGTGGGTGCTGAGTGAGGTTGG + Intronic
1007167468 6:39839025-39839047 CTGTGGGAGGAGAGAGAGGGGGG - Intronic
1007354182 6:41299029-41299051 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1008021080 6:46578069-46578091 CTGTGGTCTGAGAGTGTGGTTGG - Intronic
1010466143 6:76168434-76168456 CTGTGGTCCAAGAGTGTGGTCGG - Intergenic
1011273064 6:85599694-85599716 CTGTGGTCCCAGGCTGAGGTGGG + Intronic
1011983467 6:93416677-93416699 CCGCGGGCGCAAAGGGAGGTCGG - Intronic
1012169423 6:96000468-96000490 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1012586611 6:100931007-100931029 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1012834168 6:104243988-104244010 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1015910164 6:138161817-138161839 CTGGGGCCGGAGAGTGAGGCTGG - Intergenic
1016923391 6:149317637-149317659 GGGTGGGGGCAGAGGGAGGTGGG + Intronic
1017375132 6:153760141-153760163 CTGTGGGGGTAGTGTCAGGTGGG - Intergenic
1017554982 6:155554088-155554110 CTGTGGGAGCATATTCAGGTTGG + Intergenic
1017601547 6:156088263-156088285 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1017614530 6:156230352-156230374 CTGTGGGAGAAGTGTGGGGTTGG - Intergenic
1018377841 6:163230766-163230788 CTGTAGGTGCAGAGTTAGGGAGG + Intronic
1018608768 6:165625991-165626013 AAGTGGGCGAAGAGAGAGGTTGG + Intronic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1020425971 7:8066731-8066753 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1021824484 7:24534963-24534985 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1023497403 7:40813058-40813080 CTGTAGTCCCAGAGTGTGGTTGG + Intronic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023709287 7:42974748-42974770 GCGTGGGCACAGAGGGAGGTTGG + Intergenic
1024024698 7:45400481-45400503 CTGAGGTGGCAGAGTGAGGGAGG - Intergenic
1026899001 7:74027147-74027169 CTGTGGGGGAACAGGGAGGTGGG - Intergenic
1027053238 7:75032617-75032639 CTGTGGGCCAAGGGTGAGGCAGG - Intronic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1031039521 7:116824639-116824661 CTGTGGTCTGAGAGTGTGGTTGG + Intronic
1032185372 7:129720601-129720623 ATGTGGGCGCAGGGTGAGAAGGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1036037870 8:5040218-5040240 TTATGGATGCAGAGTGAGGTAGG + Intergenic
1036497235 8:9280355-9280377 CTGGGGGAGCAGAATGAGGGAGG + Intergenic
1036739509 8:11347874-11347896 CCGTGGTCGCAGAGTCAGGAGGG + Intergenic
1038859647 8:31373480-31373502 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039032409 8:33324720-33324742 TTGTGGGAGAAGAGTGGGGTTGG - Intergenic
1039875050 8:41578140-41578162 CGGTGGGCGCAGGGTCACGTTGG + Intronic
1041017361 8:53604296-53604318 CTGTGGTCGAAGAATGGGGTTGG - Intergenic
1041767411 8:61433632-61433654 CTGTGGGCTTCGAGTCAGGTGGG + Intronic
1044258090 8:90089706-90089728 CTTAGGGGGAAGAGTGAGGTGGG - Intronic
1044768236 8:95600065-95600087 CTGTGGCCTGAGAGTGTGGTTGG - Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1045010765 8:97956734-97956756 AAGAGGGCTCAGAGTGAGGTAGG - Intronic
1045430950 8:102114674-102114696 GGGTGGGAGGAGAGTGAGGTAGG - Intronic
1045676320 8:104612058-104612080 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1046097320 8:109577211-109577233 CTGTGAGCTCAGGGTGAGGGTGG - Intronic
1048780665 8:137996329-137996351 CTGTGGTTGCAGAGTGCAGTTGG + Intergenic
1049115456 8:140682661-140682683 CTGTGGTCCTAGAGTGTGGTTGG - Intronic
1049558018 8:143293173-143293195 CCTTGGGCGCAGGGTGAGGGAGG + Intronic
1049783637 8:144440248-144440270 CTGTGGACGCAGAGAAAGATGGG + Intronic
1049847103 8:144808142-144808164 CTTCTGGTGCAGAGTGAGGTTGG - Exonic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1051616576 9:19012529-19012551 CGGTGGGCACAGAGTTAGATGGG + Intronic
1052281419 9:26737346-26737368 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1053356076 9:37446710-37446732 CTGTGGGCCCTGAGTGAGTCGGG - Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053548427 9:39048590-39048612 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1053801541 9:41767119-41767141 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1053812549 9:41868654-41868676 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1054143658 9:61547707-61547729 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054189972 9:61979273-61979295 CTGTGGGCTCTGTGGGAGGTGGG + Intergenic
1054463434 9:65479042-65479064 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1054618046 9:67318785-67318807 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1054648542 9:67609318-67609340 CTGTGGGCTCTGTGGGAGGTGGG - Intergenic
1055589987 9:77802268-77802290 CTGTGAGCCCAGAGTGAGGGGGG - Intronic
1057883057 9:98807807-98807829 CTGCGGGCGCAGCGTGGGGCCGG + Exonic
1058058812 9:100474135-100474157 GTGTGTGTGCAGAGTGCGGTGGG + Intronic
1058284469 9:103158869-103158891 CTGTGATCTGAGAGTGAGGTTGG + Intergenic
1059224503 9:112659458-112659480 CTGTGGGTGCTGAGTAAGGCAGG + Exonic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1060140645 9:121206859-121206881 CTGTGGTCCCAGGCTGAGGTGGG - Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060233269 9:121841213-121841235 GTGTGGGCGAAGAGTGTGGCGGG + Intronic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1060793090 9:126498665-126498687 CTGAGGTCCCAGAGTGAGCTGGG - Intronic
1061002382 9:127909847-127909869 CTGTGGGGGCAGAGGGAGTGTGG - Intronic
1061650834 9:132048704-132048726 CCGTGGCCACAGAGTGGGGTTGG - Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062261281 9:135664437-135664459 CCTTGGGGGCAGGGTGAGGTGGG + Intronic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1062583994 9:137240851-137240873 CTGGGGGCGCCGAGGGAGGGCGG - Intergenic
1186367094 X:8906987-8907009 CTAAGGACACAGAGTGAGGTAGG + Intergenic
1187239674 X:17501239-17501261 CTGTGGGCCCAGGCTGAGATGGG + Intronic
1188057266 X:25555731-25555753 CTGTGGGAGCAGGGAGAGGCGGG - Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189653363 X:43213866-43213888 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1189776484 X:44474484-44474506 CTGTGGGAGTAGAGTGTGGCTGG + Intergenic
1189873283 X:45406488-45406510 CTGTGGTCCTAGGGTGAGGTTGG - Intergenic
1189926732 X:45962496-45962518 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190096284 X:47483257-47483279 CTGTGGGCGCAGAGGGTTGCGGG + Intergenic
1190281891 X:48936628-48936650 CTGTGGGAGCCCAGTGTGGTCGG - Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1191180333 X:57555699-57555721 CTGTGGTCTAAGAGTGTGGTTGG - Intergenic
1192689902 X:73351433-73351455 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
1192866175 X:75134617-75134639 CTGTGGTCTGAGAGTGTGGTTGG - Intronic
1194019671 X:88671189-88671211 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1194360146 X:92940391-92940413 CTGTGGGATCAGACTGAGGCTGG + Intergenic
1194982492 X:100454640-100454662 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1196475077 X:116074346-116074368 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1197079403 X:122394200-122394222 AGGTGGGAGCAGAGTCAGGTGGG - Intergenic
1198230406 X:134683810-134683832 ATGTTGGCACAAAGTGAGGTTGG - Intronic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1199132053 X:144201126-144201148 CTGTGGTCTGAGAGTGTGGTTGG + Intergenic
1199641009 X:149861297-149861319 CTGTGGTCTGAGAGTGTGGTTGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200668349 Y:6056213-6056235 CTGTGGGATCAGACTGAGGCTGG + Intergenic